ID: 984964532

View in Genome Browser
Species Human (GRCh38)
Location 4:185128581-185128603
Sequence GATTCCGAGGGAGCGTCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984964532_984964544 3 Left 984964532 4:185128581-185128603 CCCCGCGACGCTCCCTCGGAATC No data
Right 984964544 4:185128607-185128629 GGGAAGAGCGCAGCAGAGGCGGG No data
984964532_984964549 22 Left 984964532 4:185128581-185128603 CCCCGCGACGCTCCCTCGGAATC No data
Right 984964549 4:185128626-185128648 CGGGGAGGAGGCGCGAGCGGAGG No data
984964532_984964550 23 Left 984964532 4:185128581-185128603 CCCCGCGACGCTCCCTCGGAATC No data
Right 984964550 4:185128627-185128649 GGGGAGGAGGCGCGAGCGGAGGG No data
984964532_984964551 24 Left 984964532 4:185128581-185128603 CCCCGCGACGCTCCCTCGGAATC No data
Right 984964551 4:185128628-185128650 GGGAGGAGGCGCGAGCGGAGGGG No data
984964532_984964545 4 Left 984964532 4:185128581-185128603 CCCCGCGACGCTCCCTCGGAATC No data
Right 984964545 4:185128608-185128630 GGAAGAGCGCAGCAGAGGCGGGG No data
984964532_984964546 7 Left 984964532 4:185128581-185128603 CCCCGCGACGCTCCCTCGGAATC No data
Right 984964546 4:185128611-185128633 AGAGCGCAGCAGAGGCGGGGAGG No data
984964532_984964543 2 Left 984964532 4:185128581-185128603 CCCCGCGACGCTCCCTCGGAATC No data
Right 984964543 4:185128606-185128628 GGGGAAGAGCGCAGCAGAGGCGG No data
984964532_984964548 19 Left 984964532 4:185128581-185128603 CCCCGCGACGCTCCCTCGGAATC No data
Right 984964548 4:185128623-185128645 AGGCGGGGAGGAGGCGCGAGCGG No data
984964532_984964541 -1 Left 984964532 4:185128581-185128603 CCCCGCGACGCTCCCTCGGAATC No data
Right 984964541 4:185128603-185128625 CCCGGGGAAGAGCGCAGCAGAGG No data
984964532_984964547 10 Left 984964532 4:185128581-185128603 CCCCGCGACGCTCCCTCGGAATC No data
Right 984964547 4:185128614-185128636 GCGCAGCAGAGGCGGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984964532 Original CRISPR GATTCCGAGGGAGCGTCGCG GGG (reversed) Intergenic