ID: 984964568

View in Genome Browser
Species Human (GRCh38)
Location 4:185128693-185128715
Sequence GCGTCGGGGTCCCGGCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984964568_984964580 9 Left 984964568 4:185128693-185128715 CCTCGGCGCCGGGACCCCGACGC No data
Right 984964580 4:185128725-185128747 ATAGCGACTGGTGGCCTGGTGGG No data
984964568_984964582 11 Left 984964568 4:185128693-185128715 CCTCGGCGCCGGGACCCCGACGC No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data
984964568_984964578 5 Left 984964568 4:185128693-185128715 CCTCGGCGCCGGGACCCCGACGC No data
Right 984964578 4:185128721-185128743 GCGCATAGCGACTGGTGGCCTGG No data
984964568_984964573 -3 Left 984964568 4:185128693-185128715 CCTCGGCGCCGGGACCCCGACGC No data
Right 984964573 4:185128713-185128735 CGCACCCCGCGCATAGCGACTGG No data
984964568_984964579 8 Left 984964568 4:185128693-185128715 CCTCGGCGCCGGGACCCCGACGC No data
Right 984964579 4:185128724-185128746 CATAGCGACTGGTGGCCTGGTGG No data
984964568_984964584 26 Left 984964568 4:185128693-185128715 CCTCGGCGCCGGGACCCCGACGC No data
Right 984964584 4:185128742-185128764 GGTGGGGGACTGCGCCTGCGAGG No data
984964568_984964574 0 Left 984964568 4:185128693-185128715 CCTCGGCGCCGGGACCCCGACGC No data
Right 984964574 4:185128716-185128738 ACCCCGCGCATAGCGACTGGTGG No data
984964568_984964581 10 Left 984964568 4:185128693-185128715 CCTCGGCGCCGGGACCCCGACGC No data
Right 984964581 4:185128726-185128748 TAGCGACTGGTGGCCTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984964568 Original CRISPR GCGTCGGGGTCCCGGCGCCG AGG (reversed) Intergenic
No off target data available for this crispr