ID: 984964573

View in Genome Browser
Species Human (GRCh38)
Location 4:185128713-185128735
Sequence CGCACCCCGCGCATAGCGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984964556_984964573 28 Left 984964556 4:185128662-185128684 CCGCACCTGGGTGTCGCCAGCCC No data
Right 984964573 4:185128713-185128735 CGCACCCCGCGCATAGCGACTGG No data
984964561_984964573 8 Left 984964561 4:185128682-185128704 CCCCGCCTGGCCCTCGGCGCCGG No data
Right 984964573 4:185128713-185128735 CGCACCCCGCGCATAGCGACTGG No data
984964566_984964573 3 Left 984964566 4:185128687-185128709 CCTGGCCCTCGGCGCCGGGACCC No data
Right 984964573 4:185128713-185128735 CGCACCCCGCGCATAGCGACTGG No data
984964565_984964573 6 Left 984964565 4:185128684-185128706 CCGCCTGGCCCTCGGCGCCGGGA No data
Right 984964573 4:185128713-185128735 CGCACCCCGCGCATAGCGACTGG No data
984964567_984964573 -2 Left 984964567 4:185128692-185128714 CCCTCGGCGCCGGGACCCCGACG No data
Right 984964573 4:185128713-185128735 CGCACCCCGCGCATAGCGACTGG No data
984964563_984964573 7 Left 984964563 4:185128683-185128705 CCCGCCTGGCCCTCGGCGCCGGG No data
Right 984964573 4:185128713-185128735 CGCACCCCGCGCATAGCGACTGG No data
984964568_984964573 -3 Left 984964568 4:185128693-185128715 CCTCGGCGCCGGGACCCCGACGC No data
Right 984964573 4:185128713-185128735 CGCACCCCGCGCATAGCGACTGG No data
984964560_984964573 12 Left 984964560 4:185128678-185128700 CCAGCCCCGCCTGGCCCTCGGCG No data
Right 984964573 4:185128713-185128735 CGCACCCCGCGCATAGCGACTGG No data
984964557_984964573 23 Left 984964557 4:185128667-185128689 CCTGGGTGTCGCCAGCCCCGCCT No data
Right 984964573 4:185128713-185128735 CGCACCCCGCGCATAGCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984964573 Original CRISPR CGCACCCCGCGCATAGCGAC TGG Intergenic
No off target data available for this crispr