ID: 984964582

View in Genome Browser
Species Human (GRCh38)
Location 4:185128727-185128749
Sequence AGCGACTGGTGGCCTGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984964563_984964582 21 Left 984964563 4:185128683-185128705 CCCGCCTGGCCCTCGGCGCCGGG No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data
984964572_984964582 -5 Left 984964572 4:185128709-185128731 CCGACGCACCCCGCGCATAGCGA No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data
984964560_984964582 26 Left 984964560 4:185128678-185128700 CCAGCCCCGCCTGGCCCTCGGCG No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data
984964571_984964582 -4 Left 984964571 4:185128708-185128730 CCCGACGCACCCCGCGCATAGCG No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data
984964570_984964582 -3 Left 984964570 4:185128707-185128729 CCCCGACGCACCCCGCGCATAGC No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data
984964569_984964582 3 Left 984964569 4:185128701-185128723 CCGGGACCCCGACGCACCCCGCG No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data
984964568_984964582 11 Left 984964568 4:185128693-185128715 CCTCGGCGCCGGGACCCCGACGC No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data
984964561_984964582 22 Left 984964561 4:185128682-185128704 CCCCGCCTGGCCCTCGGCGCCGG No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data
984964567_984964582 12 Left 984964567 4:185128692-185128714 CCCTCGGCGCCGGGACCCCGACG No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data
984964566_984964582 17 Left 984964566 4:185128687-185128709 CCTGGCCCTCGGCGCCGGGACCC No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data
984964565_984964582 20 Left 984964565 4:185128684-185128706 CCGCCTGGCCCTCGGCGCCGGGA No data
Right 984964582 4:185128727-185128749 AGCGACTGGTGGCCTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984964582 Original CRISPR AGCGACTGGTGGCCTGGTGG GGG Intergenic
No off target data available for this crispr