ID: 984964584

View in Genome Browser
Species Human (GRCh38)
Location 4:185128742-185128764
Sequence GGTGGGGGACTGCGCCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984964571_984964584 11 Left 984964571 4:185128708-185128730 CCCGACGCACCCCGCGCATAGCG No data
Right 984964584 4:185128742-185128764 GGTGGGGGACTGCGCCTGCGAGG No data
984964572_984964584 10 Left 984964572 4:185128709-185128731 CCGACGCACCCCGCGCATAGCGA No data
Right 984964584 4:185128742-185128764 GGTGGGGGACTGCGCCTGCGAGG No data
984964568_984964584 26 Left 984964568 4:185128693-185128715 CCTCGGCGCCGGGACCCCGACGC No data
Right 984964584 4:185128742-185128764 GGTGGGGGACTGCGCCTGCGAGG No data
984964570_984964584 12 Left 984964570 4:185128707-185128729 CCCCGACGCACCCCGCGCATAGC No data
Right 984964584 4:185128742-185128764 GGTGGGGGACTGCGCCTGCGAGG No data
984964577_984964584 0 Left 984964577 4:185128719-185128741 CCGCGCATAGCGACTGGTGGCCT No data
Right 984964584 4:185128742-185128764 GGTGGGGGACTGCGCCTGCGAGG No data
984964575_984964584 2 Left 984964575 4:185128717-185128739 CCCCGCGCATAGCGACTGGTGGC No data
Right 984964584 4:185128742-185128764 GGTGGGGGACTGCGCCTGCGAGG No data
984964569_984964584 18 Left 984964569 4:185128701-185128723 CCGGGACCCCGACGCACCCCGCG No data
Right 984964584 4:185128742-185128764 GGTGGGGGACTGCGCCTGCGAGG No data
984964567_984964584 27 Left 984964567 4:185128692-185128714 CCCTCGGCGCCGGGACCCCGACG No data
Right 984964584 4:185128742-185128764 GGTGGGGGACTGCGCCTGCGAGG No data
984964576_984964584 1 Left 984964576 4:185128718-185128740 CCCGCGCATAGCGACTGGTGGCC No data
Right 984964584 4:185128742-185128764 GGTGGGGGACTGCGCCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984964584 Original CRISPR GGTGGGGGACTGCGCCTGCG AGG Intergenic
No off target data available for this crispr