ID: 984966338

View in Genome Browser
Species Human (GRCh38)
Location 4:185143408-185143430
Sequence CAGCGGCGACGCCCCCGGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984966338_984966345 12 Left 984966338 4:185143408-185143430 CCTGGCCGGGGGCGTCGCCGCTG 0: 1
1: 0
2: 2
3: 25
4: 200
Right 984966345 4:185143443-185143465 CCGCGGTCGCCCCCATCGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 29
984966338_984966341 -5 Left 984966338 4:185143408-185143430 CCTGGCCGGGGGCGTCGCCGCTG 0: 1
1: 0
2: 2
3: 25
4: 200
Right 984966341 4:185143426-185143448 CGCTGCCGTCTCCAAGACCGCGG 0: 1
1: 0
2: 0
3: 11
4: 80
984966338_984966346 13 Left 984966338 4:185143408-185143430 CCTGGCCGGGGGCGTCGCCGCTG 0: 1
1: 0
2: 2
3: 25
4: 200
Right 984966346 4:185143444-185143466 CGCGGTCGCCCCCATCGAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984966338 Original CRISPR CAGCGGCGACGCCCCCGGCC AGG (reversed) Exonic