ID: 984969434

View in Genome Browser
Species Human (GRCh38)
Location 4:185174055-185174077
Sequence GGGACTTACTCAAGGTCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1087
Summary {0: 1, 1: 6, 2: 53, 3: 246, 4: 781}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984969434 Original CRISPR GGGACTTACTCAAGGTCACA CGG (reversed) Intronic
900850776 1:5141217-5141239 GTGACTCGCTGAAGGTCACAGGG + Intergenic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901148959 1:7087642-7087664 GTGACTTGCCTAAGGTCACATGG - Intronic
901797718 1:11690502-11690524 GCGACTTGCTCGAGGTCATAGGG + Intronic
901839700 1:11946154-11946176 GGGACTTGCCCCAGGTCACATGG + Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902377252 1:16035587-16035609 GTGACTTGACCAAGGTCACAAGG - Intergenic
902381085 1:16052567-16052589 AGGACTTGCCCAAGGTCACCCGG - Intronic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902382430 1:16058842-16058864 GTGACTTGACCAAGGTCACAAGG - Intronic
902431034 1:16363323-16363345 GAGACTTGCCCAAGGTCACAAGG + Intronic
902434228 1:16386983-16387005 GGAACTTACCCAAGGTCACAAGG - Intronic
902525313 1:17053661-17053683 TTGAATTGCTCAAGGTCACATGG - Intronic
902525758 1:17056235-17056257 GGGGCTTATCCAAGGTCACATGG - Intergenic
902761003 1:18580719-18580741 AGGACTCACTCAAGGTCACCTGG + Intergenic
902775082 1:18669483-18669505 GTGACTTGCTAGAGGTCACACGG - Intronic
902795171 1:18796168-18796190 GTGACTGGCCCAAGGTCACACGG - Intergenic
903049436 1:20589724-20589746 ATGACTTGCCCAAGGTCACACGG + Intronic
903143757 1:21356405-21356427 GGGACTTGCCCAAGACCACAGGG - Intergenic
903239621 1:21974228-21974250 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903243429 1:21999156-21999178 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903247413 1:22025971-22025993 GGGACTTGCCCAAAGCCACAAGG - Intergenic
903284199 1:22266997-22267019 GTGACTTGCCCAAGGCCACAAGG + Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903424823 1:23245804-23245826 TGACCTTGCTCAAGGTCACACGG - Intergenic
903461237 1:23522242-23522264 GTGACTTGCTTAAGGTCTCACGG + Intronic
903464782 1:23544610-23544632 GTAACTTACCCAAGGCCACAGGG + Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903742202 1:25564875-25564897 GTGACTTGCCCAAGGTCTCACGG + Intronic
903755105 1:25655176-25655198 AGGACTTTCCCAAGATCACACGG - Intronic
903892859 1:26581456-26581478 GCAACTTGCCCAAGGTCACATGG - Intergenic
903954465 1:27015492-27015514 GGGACTTCCCCAAGGTCACGTGG - Intergenic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904046817 1:27614239-27614261 GTGACTTGCCCAAGGCCACATGG + Intronic
904417807 1:30373758-30373780 GTGACACACCCAAGGTCACACGG + Intergenic
904463703 1:30695484-30695506 GGAACTTGCCCGAGGTCACATGG + Intergenic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
904807569 1:33142569-33142591 GAGACTTGCTCAGGGTCACATGG + Intergenic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
905562687 1:38940082-38940104 GGGATTTGCCTAAGGTCACATGG - Intronic
905850154 1:41267995-41268017 GTGACTTGCTTAAGGTCACTGGG - Intergenic
905894264 1:41534933-41534955 GTGACTTGCCCAAGGTCACCTGG - Intronic
906041164 1:42788755-42788777 GATACTTGCTCAAAGTCACATGG - Intronic
906227150 1:44131457-44131479 AGAACTTTCTCAAGGTCACATGG - Intronic
906238613 1:44227804-44227826 GGAACTTGCTCAAGTTCACATGG - Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906676294 1:47695868-47695890 GAGACTAATCCAAGGTCACAGGG - Intergenic
906683237 1:47745124-47745146 AGGACTTGGCCAAGGTCACATGG + Intergenic
906774025 1:48512485-48512507 GGGACTTGCCCAAGGCCACAGGG + Intergenic
906951179 1:50335495-50335517 AGAACTTACCCAAGGTCACAGGG + Intergenic
907262950 1:53235305-53235327 GGAACTTGCCCAAGGTCACATGG + Intronic
907274643 1:53310393-53310415 ATGACTTCCTCCAGGTCACACGG - Intronic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907329043 1:53659496-53659518 AGGACTTCCTCAAGGTCACATGG + Intronic
907412074 1:54290028-54290050 GGCACTTGTCCAAGGTCACATGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
907557795 1:55359805-55359827 GTGAATTGCACAAGGTCACATGG + Intergenic
907670830 1:56473582-56473604 GGGACTCACACAATGTTACAAGG + Intergenic
907785687 1:57610443-57610465 GGGACTTGCCCAATGTCACCTGG + Intronic
907875061 1:58477890-58477912 GGAAGTTACTCAAGGGTACATGG - Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
908358509 1:63345236-63345258 GTGACTTGCTCAAAGGCACATGG - Intergenic
909597315 1:77421306-77421328 GAAGTTTACTCAAGGTCACATGG + Intronic
910106331 1:83634848-83634870 ATGACTTGCTCAAGGTCGCATGG + Intergenic
910464896 1:87488207-87488229 GGAGCCCACTCAAGGTCACATGG - Intergenic
911244497 1:95501733-95501755 GTGACTTGCTCAGAGTCACATGG - Intergenic
912391434 1:109305979-109306001 GTGACTTGTCCAAGGTCACAGGG + Intronic
912420526 1:109539534-109539556 GCAACTTGCCCAAGGTCACACGG + Intergenic
912853322 1:113145754-113145776 AGGACTTGCCCAAGGCCACATGG + Intergenic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
913201545 1:116498717-116498739 AAGGCTTGCTCAAGGTCACATGG + Intergenic
913277898 1:117157230-117157252 ATGACTTACTGAAGGTTACATGG - Intronic
914433180 1:147638343-147638365 GTCACTTGCTCAAGGTCATATGG + Intronic
914433438 1:147640214-147640236 AGGAGTTGCCCAAGGTCACAGGG + Intronic
915525030 1:156470670-156470692 GTAACTTACCCAAGGTCACATGG - Intronic
915538351 1:156551437-156551459 GGGATTTGCTCAAGGTCACATGG + Intronic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
915972395 1:160363899-160363921 GTGACTTATCCAAGGTCACCAGG + Intergenic
917259451 1:173150949-173150971 GTGACTTTCACAAAGTCACATGG + Intergenic
917437865 1:175039292-175039314 GTAACTTGCTCAAGGTCCCAGGG - Intergenic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
917733492 1:177899462-177899484 GTAACTTACCCAAGGTTACAAGG + Intergenic
918067573 1:181111796-181111818 GGAACTTACACGAGGTCACTGGG - Intergenic
918105874 1:181414750-181414772 GTGACTTTCTCAAGGTCACGTGG + Intronic
918220897 1:182435608-182435630 GTGACTTACTGGATGTCACATGG - Intergenic
918854915 1:189739790-189739812 GAGAATTCCTCAAGGTCAAAAGG - Intergenic
919151748 1:193709819-193709841 TGAACTTACTCAAGGTCAACAGG - Intergenic
919818179 1:201455233-201455255 GGGAGTTGTCCAAGGTCACAGGG + Intergenic
920044926 1:203127012-203127034 GGGACTTCCGGAGGGTCACAGGG - Intronic
920438674 1:205964264-205964286 GAGACTCACCCAAGGCCACATGG + Intergenic
920678878 1:208057973-208057995 GTGACTTGCTCAAAGTCACCTGG + Intronic
920689208 1:208132897-208132919 GCAACTTGCCCAAGGTCACATGG + Intronic
920872640 1:209806627-209806649 GTAACTTACCCAGGGTCACACGG - Intergenic
920872920 1:209808927-209808949 GTGATTTACTCAAGGTCACATGG + Intergenic
921167976 1:212520826-212520848 ATGACTTGCCCAAGGTCACAAGG + Intergenic
921467025 1:215501148-215501170 GTGCTTTACTCAAGATCACAGGG + Intergenic
921514826 1:216077041-216077063 GTAACTTTCCCAAGGTCACATGG - Intronic
921532107 1:216297122-216297144 GGCAATTACTCAAGAACACAGGG - Intronic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
922109167 1:222540609-222540631 GCAACTTGCTCAGGGTCACATGG - Intronic
922945117 1:229507764-229507786 GTGACTTACACCAGATCACACGG + Intronic
923307407 1:232701136-232701158 TTGACTGATTCAAGGTCACATGG + Intergenic
923496409 1:234529444-234529466 GGTCCTCACTCCAGGTCACAGGG - Intergenic
923614041 1:235521798-235521820 GTTACCCACTCAAGGTCACAAGG + Intergenic
924623415 1:245681530-245681552 GGGACTTACACAGGGTCACGTGG + Intronic
1063151577 10:3341702-3341724 GGAACCAACTCAAGGTCCCATGG + Intergenic
1063366127 10:5492034-5492056 GGTATTTGCTCAAGGCCACATGG + Intergenic
1063735069 10:8743763-8743785 GAAACTTGCCCAAGGTCACATGG - Intergenic
1065761392 10:28986430-28986452 GGGACTTACCCATGGTCTAATGG - Intergenic
1065850445 10:29783333-29783355 GCGATTTGCTCAAGGTCACATGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1065966808 10:30777349-30777371 GTGACTTGCTCAAGTCCACAGGG + Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067136029 10:43607874-43607896 AGAACTTGCTCAAGGTCCCAGGG - Intronic
1068614122 10:59093215-59093237 GTGATTTACTCAGTGTCACATGG - Intergenic
1068719342 10:60225442-60225464 TATACCTACTCAAGGTCACATGG + Intronic
1069274422 10:66571486-66571508 GTGGCTTACTCAAAGGCACATGG + Intronic
1069750660 10:70743359-70743381 AGCATTTACCCAAGGTCACATGG + Intronic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1070179284 10:73998528-73998550 AGGACTCGCTCAAGGTCACAGGG - Intronic
1070492423 10:76990111-76990133 GGAACTTACTCAAAGTCACATGG + Intronic
1070743200 10:78916155-78916177 GTGAGTTACCCAAGGTCACAGGG + Intergenic
1070772852 10:79092380-79092402 GTGACTGACCCAAGATCACATGG - Intronic
1070795184 10:79212113-79212135 GTGACTTGCTTAAGGTCACGTGG - Intronic
1070802117 10:79249935-79249957 GTGACTTACTCAAAGTCACCTGG - Intronic
1070978649 10:80626928-80626950 GGGATTCACCCAAAGTCACAGGG - Intronic
1071481476 10:86068169-86068191 GTGACTTGGCCAAGGTCACATGG + Intronic
1071837867 10:89437470-89437492 GTGACTTTCTGTAGGTCACAGGG + Intronic
1071942158 10:90601790-90601812 GAGACTTACTCACTGTCACAAGG - Intergenic
1072159301 10:92751524-92751546 GAGACTTACTTAAGGTCACATGG + Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1072555287 10:96510073-96510095 ATGACTTGCTCAAGGCCACACGG + Intronic
1072569775 10:96648433-96648455 GTGACTTACCCAACGTCACAAGG + Intronic
1072835896 10:98711544-98711566 ACAACTTACCCAAGGTCACATGG - Intronic
1073044923 10:100631470-100631492 GTGACTTACCAAAGGTCACATGG + Intergenic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1073503085 10:103959871-103959893 GTGACTTGCCCAATGTCACAGGG + Intergenic
1073703377 10:105955477-105955499 GCCACTTGCTCAAGGTCTCATGG + Intergenic
1074082424 10:110178282-110178304 GTGACCTGTTCAAGGTCACATGG + Intergenic
1074299812 10:112223543-112223565 GTGATTTGCTTAAGGTCACAAGG - Intergenic
1074392193 10:113067718-113067740 AAGACTTGCTCAAGGTCACATGG - Intronic
1074404726 10:113171019-113171041 AGGAATTACCCAAGGACACACGG - Intergenic
1074784837 10:116829700-116829722 GTGACTCACTCAATGTCAAATGG + Intergenic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1074895866 10:117777245-117777267 GTGACCTACTTAAGGTCACCTGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1075073641 10:119335842-119335864 GCTACTTGCTCAAAGTCACAGGG - Intronic
1075116184 10:119628902-119628924 GGAACTTACCCAAGGTCACACGG - Intergenic
1075466724 10:122656995-122657017 GAGACTTACCCAAAGTCACAGGG - Intergenic
1075468782 10:122672393-122672415 GAGACTTTCCCAAAGTCACAGGG - Intergenic
1075533480 10:123250362-123250384 GTAACTTACCTAAGGTCACATGG + Intergenic
1075701632 10:124473532-124473554 GGGACTTCCTTGAGGCCACATGG - Intronic
1075737995 10:124675819-124675841 GGGCCTTGCCCAAAGTCACATGG - Intronic
1075837412 10:125466564-125466586 GGAATCTGCTCAAGGTCACATGG + Intergenic
1076398602 10:130161275-130161297 GTGACTTGCCCAAGGTCACCTGG + Intronic
1076934458 10:133558271-133558293 GGGGCTTGCTCACGGTCACATGG + Intronic
1077486877 11:2842934-2842956 GTGACTTGCCCAAGGTCACCCGG + Intronic
1077532808 11:3105154-3105176 GTGACTTGTCCAAGGTCACACGG + Intronic
1077856330 11:6129823-6129845 GAAACTTGCCCAAGGTCACAGGG + Intergenic
1077906746 11:6540096-6540118 GGGGCTTTCACTAGGTCACAAGG - Intronic
1078157656 11:8812667-8812689 GGGACTTGCCCAATGGCACATGG - Intronic
1078256768 11:9664680-9664702 GGGACTTGCCCAAGGTCGCTGGG + Intronic
1078753699 11:14188734-14188756 AGGACTTTCCCAAGGTCACATGG - Intronic
1078774496 11:14381669-14381691 GTGACCTGCTCATGGTCACATGG - Intergenic
1078899055 11:15624353-15624375 AGTACTTGCCCAAGGTCACATGG - Intergenic
1078910930 11:15731105-15731127 GTGACTTGCTCAGGTTCACATGG + Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1078921103 11:15831397-15831419 GTAACTCACTCAAGGACACATGG - Intergenic
1079149664 11:17886083-17886105 GAGATTTACCCAAAGTCACATGG - Intronic
1079350334 11:19686468-19686490 GGGAGGTACTCCAGGTCATAGGG + Intronic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1079989576 11:27232636-27232658 GTGACTTGCTCATGGTCACTTGG + Intergenic
1079996110 11:27296771-27296793 GACACTTATGCAAGGTCACATGG + Intergenic
1080008465 11:27433855-27433877 GGGACTTGCTTCAGGTCACATGG - Intronic
1080634502 11:34111800-34111822 AGTATTTGCTCAAGGTCACAGGG + Intronic
1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG + Intronic
1080888421 11:36387706-36387728 GTGACTTGCCCAAGGCCACAGGG + Intronic
1081607155 11:44534560-44534582 GTTACTTGCCCAAGGTCACATGG - Intergenic
1081694041 11:45097239-45097261 AGGACTTGTTTAAGGTCACATGG - Intronic
1081742727 11:45452203-45452225 GAGGCTTTCCCAAGGTCACAGGG + Intergenic
1081870497 11:46380840-46380862 GGGGCTTGCTCAAGGCCACAGGG - Exonic
1081915846 11:46729636-46729658 GCAACTTGCTCAAAGTCACATGG - Intronic
1081997593 11:47375317-47375339 GAGACTTGCACAAGGTCACACGG - Intronic
1082791036 11:57346982-57347004 GTGACTTGGCCAAGGTCACAGGG - Intronic
1082802764 11:57426784-57426806 GGAACTTGCCCAAGGTCACAGGG + Intronic
1082813489 11:57493192-57493214 ATGACTTGCTCAAGCTCACAGGG + Intronic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083260369 11:61519230-61519252 GAGACTTACCCACAGTCACAGGG + Intronic
1083403384 11:62440197-62440219 GTGGCTTTCTCAAGCTCACAGGG + Intronic
1083609383 11:63997929-63997951 GGGACTTGCCCAGGGTCCCAGGG + Exonic
1083622016 11:64053829-64053851 GGGGAGTGCTCAAGGTCACATGG + Intronic
1083655173 11:64226041-64226063 CAGACTTGCCCAAGGTCACACGG + Exonic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083949328 11:65945428-65945450 GGGACTTACACCAGGTCACACGG + Exonic
1084773523 11:71359746-71359768 GGGGCCTCCTCAAAGTCACATGG - Intergenic
1084978434 11:72815734-72815756 GGGCCTCAGTCAAGGTGACAGGG + Intronic
1085104206 11:73827943-73827965 TTGACTTACCCAAAGTCACAAGG - Intronic
1085121119 11:73968283-73968305 GGAACTTGGCCAAGGTCACACGG + Intronic
1085312339 11:75524142-75524164 GGGACCTGCTCAAGGTCTCAAGG - Intronic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085463635 11:76709982-76710004 GGGATTTACTCAAAGTCACGAGG + Intergenic
1085760831 11:79239868-79239890 GTGACTTACCCAAAGTCACGTGG - Intronic
1085770107 11:79317625-79317647 GTGACCTGCTCAAGGTCATATGG + Intronic
1085781438 11:79412516-79412538 GTGACTTATCCAAGGTCACATGG - Intronic
1085821577 11:79799217-79799239 GTAACTTAGTCAAGATCACATGG + Intergenic
1085874124 11:80385638-80385660 GAGACTTACTCACTGTCACGAGG + Intergenic
1086668639 11:89518764-89518786 GTGAATTACTCCACGTCACATGG - Intergenic
1086994819 11:93344227-93344249 GAGACATACACAAGGTCAAATGG - Intronic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1088373577 11:109117295-109117317 GGGACCCACTCAGAGTCACAGGG + Intergenic
1088415079 11:109579829-109579851 GGGACTTACTCAGAATTACAGGG - Intergenic
1088455258 11:110026746-110026768 GAAACTTGCCCAAGGTCACAAGG - Intergenic
1088505227 11:110520975-110520997 AGGACCTGCCCAAGGTCACACGG + Intergenic
1088727637 11:112653671-112653693 GAGACTTGCTCAGGGTGACATGG + Intergenic
1089159287 11:116425063-116425085 GTGAATTGCCCAAGGTCACAGGG + Intergenic
1089203424 11:116739394-116739416 GGGGCTTCCTCAAGGTCTCATGG + Intergenic
1089256850 11:117198743-117198765 GCGTCTTCCTCAAGGCCACATGG - Intergenic
1089503666 11:118948596-118948618 ATGACTTTCCCAAGGTCACAGGG - Intronic
1089607840 11:119651947-119651969 GGGCCTTGCTCAAGGTCACCTGG + Intronic
1089705408 11:120274219-120274241 AGAACTTGCCCAAGGTCACATGG - Intronic
1089975579 11:122728935-122728957 GAGACTTGCTCAAGGCCACCCGG + Intronic
1090253396 11:125266271-125266293 GTCACTTGCCCAAGGTCACACGG + Intronic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1090601106 11:128372376-128372398 GGGATTCACCAAAGGTCACATGG + Intergenic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091065178 11:132503028-132503050 GTGACTTATTCAAGGTCCCCTGG + Intronic
1091402690 12:190197-190219 GGGACTTTTTCAAGTTCACATGG - Exonic
1091452516 12:582071-582093 AGAACTTACCCAAAGTCACACGG + Intronic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091600906 12:1917155-1917177 GTGACTTCCCCAAGTTCACAAGG - Intronic
1091855997 12:3740796-3740818 GCAACTTGCTCGAGGTCACATGG - Intronic
1092022495 12:5214235-5214257 TTAACTTACTCAAGGTCATACGG - Intergenic
1092139373 12:6172170-6172192 GTGACTTACTCAAGGCCATCCGG - Intergenic
1092162222 12:6321943-6321965 ATAACTTACCCAAGGTCACATGG - Intronic
1092236808 12:6815544-6815566 GTAACTCACCCAAGGTCACATGG - Intronic
1092262834 12:6961705-6961727 GTCACTTGCCCAAGGTCACAGGG + Intergenic
1092275483 12:7057834-7057856 GTAACTTTTTCAAGGTCACACGG + Intronic
1092745843 12:11671707-11671729 GTGACCTACTGAAGGTCCCAAGG + Intronic
1092765736 12:11851041-11851063 GGGACTTGTTCAAGGTCACCTGG + Intronic
1092978377 12:13768556-13768578 GGGTCTTCCTCAAGGACATATGG - Intronic
1093259488 12:16917790-16917812 TGGACTTACCCAAGGCCAGAGGG - Intergenic
1093420761 12:18971721-18971743 GAGGCTTGCTCAAGTTCACATGG - Intergenic
1093491600 12:19711017-19711039 GTGACTCTCTCAATGTCACATGG + Intronic
1094299647 12:28948424-28948446 GTGATTTGCCCAAGGTCACATGG + Intergenic
1094464599 12:30738395-30738417 GGAACTTATTCAAAGTCATATGG - Intronic
1095881070 12:47136923-47136945 GGGAGTTACCCAAGGTTACGTGG - Intronic
1095993157 12:48052773-48052795 GGGATTTATGCAAGGTCACATGG - Intronic
1096089859 12:48891607-48891629 GTCACTCACTCAAGGTTACATGG - Intergenic
1096108490 12:49013656-49013678 GCAACTTGCCCAAGGTCACATGG + Intronic
1096201026 12:49683117-49683139 AGGACTTATGTAAGGTCACAAGG - Intronic
1096244788 12:49978399-49978421 TTGACTTGCTCAAGGTCACCTGG + Intronic
1096430586 12:51539713-51539735 GTAACTTTCTCAGGGTCACACGG - Intergenic
1096676326 12:53228072-53228094 GTGACTGGCTTAAGGTCACATGG + Intronic
1097289549 12:57902872-57902894 CTGACTTGCTCCAGGTCACAGGG + Intergenic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1098860588 12:75705689-75705711 GTGATTTACCCAAGGTCATATGG - Intergenic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1099171598 12:79371176-79371198 GAGACTCGCTCAAGGTCACAAGG + Intronic
1099979878 12:89586200-89586222 GTAACTTACTCTAGGTCACATGG - Intergenic
1100507805 12:95237201-95237223 GGAACTTGCCCAAGGTCACAAGG - Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1101116028 12:101532136-101532158 GGTACTTGCTCAAGATCATATGG - Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1101253240 12:102955384-102955406 GGGACTTGTTCAAGGTTATAAGG + Intronic
1101437175 12:104673762-104673784 GGAACTTGCCCAAGGTCACACGG - Intronic
1101548432 12:105738941-105738963 AGGAATTGCTCAAGGTTACAAGG + Intergenic
1101604241 12:106235751-106235773 GTGACTTGCCCAAGGCCACATGG + Intergenic
1101836069 12:108296222-108296244 CTGACTTGCCCAAGGTCACAGGG - Intronic
1101854421 12:108430193-108430215 ATGACTTGCCCAAGGTCACACGG - Intergenic
1102024072 12:109703568-109703590 GGGACCTGCCCAAGGTCACGTGG + Intergenic
1102161557 12:110773326-110773348 GTCATTTGCTCAAGGTCACATGG + Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102302616 12:111781719-111781741 GTGACTTACCCAAGGTCACTTGG + Intronic
1102396484 12:112590383-112590405 AGGACCTGCTCAAGGTCACTGGG - Intronic
1102403024 12:112647303-112647325 GAGACTCGCTCAGGGTCACATGG - Intronic
1102511619 12:113419424-113419446 GTGACTTACAAAAGGTCACAGGG + Intronic
1102576082 12:113856920-113856942 GTCACTTGCCCAAGGTCACACGG + Intronic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102716341 12:114976247-114976269 GGGGCTTGCTCAGGGTCACATGG + Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102861269 12:116338462-116338484 TAAACTTACCCAAGGTCACAGGG - Intergenic
1102972114 12:117177150-117177172 GGGATTTACTCAAGGTCACAGGG + Intronic
1103063474 12:117877668-117877690 GGAACTTGCCTAAGGTCACATGG + Intronic
1103165115 12:118763712-118763734 GAGACTTGCCCAGGGTCACATGG + Intergenic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103187853 12:118976928-118976950 GAGATTTACCCAAGGTAACATGG + Intergenic
1103333395 12:120170710-120170732 GTGTGTTGCTCAAGGTCACACGG + Intronic
1103357639 12:120333413-120333435 GTAACTTGCTCAAAGTCACATGG + Intergenic
1103367125 12:120391372-120391394 GTGACTTGCCCAAGGCCACACGG - Intergenic
1103548312 12:121717494-121717516 GTCACTTATCCAAGGTCACATGG + Intronic
1103736507 12:123064265-123064287 GGGACTTGGTCAAGGTCATCGGG + Intronic
1104201487 12:126593933-126593955 GGGATATGCTCAAGGTCACCAGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104610922 12:130227154-130227176 AGGACTTACTCGCGGTGACATGG + Intergenic
1104707588 12:130958940-130958962 GCGATTTGCTCAAGGTCACAGGG + Intronic
1105422375 13:20264499-20264521 GGAACTTCCCCAAGGCCACATGG + Intergenic
1107411357 13:40161573-40161595 GTAACTTACCCAGGGTCACATGG + Intergenic
1108005371 13:45941047-45941069 GTGATTTGCTCAAGGTCAAACGG - Intergenic
1108065463 13:46572943-46572965 GGAACTTGCCCAAGGTCACTGGG - Intronic
1108144513 13:47463054-47463076 GTGACTTAAGTAAGGTCACATGG + Intergenic
1108450754 13:50560192-50560214 GTAACTTACACAAGGCCACACGG - Intronic
1108454420 13:50598571-50598593 CTTACTTGCTCAAGGTCACATGG - Intronic
1110108243 13:71707873-71707895 GAGCCATACTCAAGGGCACATGG + Intronic
1110254077 13:73412456-73412478 GGGAATCACTCAGGGTCCCATGG + Intergenic
1112038388 13:95519016-95519038 GCAATTTACTCAAGGTCACATGG - Intronic
1112455798 13:99561859-99561881 GTGACTGTCTCATGGTCACATGG - Intronic
1112610049 13:100946928-100946950 GGAACTAAATGAAGGTCACAAGG + Intergenic
1112672074 13:101652340-101652362 GTAACTTACATAAGGTCACATGG - Intronic
1112981980 13:105396146-105396168 GGGACTTTCTCAAGGTAGCTAGG + Intergenic
1113236413 13:108279998-108280020 GGGTATTACTCAACATCACACGG - Intronic
1113355585 13:109576841-109576863 AGGACTTGCCCAAGGTCTCAAGG - Intergenic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1114570368 14:23662995-23663017 GTAACTTAGTCAAGGCCACATGG - Intergenic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115081375 14:29455127-29455149 GGGAATTTCTCAAGGCCACTTGG + Intergenic
1115325018 14:32128447-32128469 GGGACTTTCTCAGGGTCTCATGG - Intronic
1115436552 14:33381566-33381588 GGGATTTGCTTAAGGTCCCATGG + Intronic
1116057305 14:39879665-39879687 AAGACTTGCCCAAGGTCACAGGG + Intergenic
1116799000 14:49423205-49423227 ATAACTTACTCAAGGTCACATGG - Intergenic
1117012846 14:51488443-51488465 GGGATTTATTCAAGGTCACATGG + Intergenic
1117061773 14:51971193-51971215 AGGACTTGCCCAAGGTCGCATGG - Intronic
1118708687 14:68502409-68502431 GGGACTTTCTGAAGGCAACAGGG + Intronic
1118753460 14:68822465-68822487 GTGACTTATCCAAGGTCACCAGG + Intergenic
1118972244 14:70646642-70646664 GGGGCTTATCCAAGGTCACAAGG - Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1119481800 14:74962652-74962674 AAGACTTGCCCAAGGTCACACGG - Intergenic
1119690640 14:76669358-76669380 CTGACTTGTTCAAGGTCACAGGG - Intergenic
1119748878 14:77063888-77063910 GAGACATTCTCAAGGTCACATGG + Intergenic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120102464 14:80461124-80461146 GTGACTTGCTCAGGGTGACAGGG + Intergenic
1120341964 14:83232473-83232495 GTGACTTGGTCAAGGTCATATGG - Intergenic
1120786136 14:88538775-88538797 GTGACTTGCTCATGGTTACATGG - Intronic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121252808 14:92512681-92512703 GTGACTTGCTCAAGGCCATATGG - Intergenic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121429245 14:93875060-93875082 GTGACCTCCCCAAGGTCACATGG - Intergenic
1121436218 14:93921853-93921875 GAGACTTGCTGAAGGTCCCATGG - Intronic
1121520427 14:94582516-94582538 GGGAGTTGTTCAAGGTCACCTGG + Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121564020 14:94895231-94895253 GTGCCTCACCCAAGGTCACAGGG - Intergenic
1121611345 14:95282959-95282981 GGGACTCACCTAAGGTCACAGGG + Intronic
1121681374 14:95795303-95795325 AGGACTTGCTGAGGGTCACATGG + Intergenic
1121681956 14:95801147-95801169 GGTACTTGCTGAGGGTCACAGGG + Intergenic
1121691139 14:95877598-95877620 ATGACTTAATCAAGGTCACAAGG + Intergenic
1121812879 14:96907169-96907191 GTGACTTGCACAAGGTTACAAGG + Intronic
1121861698 14:97324754-97324776 AGGACCTGCTAAAGGTCACATGG - Intergenic
1122131859 14:99608836-99608858 GTCACTTGCCCAAGGTCACATGG + Intergenic
1122261330 14:100524758-100524780 CGGATTTGCTCAAGGTCACAGGG - Intronic
1123627674 15:22238850-22238872 GGGACTTGCTCAGGGCCACGTGG - Intergenic
1124134021 15:27018178-27018200 GTGACTTTCTCAAGGCCATATGG + Intronic
1124848333 15:33311985-33312007 GCGACTTGCTCAAGGTCACTTGG - Intronic
1125147793 15:36492265-36492287 GGGACACACTCTAGGTAACATGG - Intergenic
1126420474 15:48467048-48467070 GGAACTTGCCCAAGGTTACATGG + Intronic
1126582718 15:50255959-50255981 GGGACTAACTCAAGTTCACATGG + Intronic
1126737831 15:51750154-51750176 GTGACTTATTCAAGGTCATAGGG - Intronic
1126988117 15:54338750-54338772 GACATTTTCTCAAGGTCACAAGG + Intronic
1127964125 15:63911342-63911364 GTAATTTCCTCAAGGTCACACGG + Intronic
1128064125 15:64753960-64753982 GTGACTTGTCCAAGGTCACATGG + Intronic
1128084839 15:64878699-64878721 GGGACTTGCCCAAGGCCACCTGG + Intronic
1128093026 15:64931737-64931759 GTAACTTGCTCCAGGTCACAGGG - Intronic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1128171569 15:65517865-65517887 GCGACTTGCTGAAAGTCACAGGG + Intergenic
1128232610 15:66046163-66046185 GGGACCTGCTCCAGTTCACATGG + Intronic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1128709464 15:69860920-69860942 GAGACTTGTCCAAGGTCACATGG + Intergenic
1128770605 15:70278861-70278883 GGGACTCGCCCATGGTCACATGG + Intergenic
1129165178 15:73773122-73773144 AGGGCTTGCCCAAGGTCACACGG + Intergenic
1129237351 15:74231669-74231691 TGGACTTGCCCAAGGTCACACGG - Intergenic
1129257679 15:74343376-74343398 GTCACTTGCCCAAGGTCACATGG + Intronic
1129521873 15:76191395-76191417 GGGACTTGCTCAAGGCCACAGGG + Intronic
1129788932 15:78327833-78327855 GTGACTTACCCAAGGTCCCATGG - Intergenic
1129857608 15:78835800-78835822 GTTACTTGCTTAAGGTCACAGGG - Intronic
1130152701 15:81323755-81323777 GTGACTTGCCCAAGGTCACCTGG - Intronic
1130562888 15:84972355-84972377 GTGACTTGCCCATGGTCACAGGG - Intergenic
1130872324 15:87981225-87981247 GTGTCTTACCCAAGGTCACATGG - Intronic
1131480179 15:92774053-92774075 ATGACTTCCTCAAGGTCACTCGG + Intronic
1132293083 15:100716627-100716649 GGAACTCACTCAAGGCCACATGG - Intergenic
1133384026 16:5354408-5354430 GTGACTTGCCTAAGGTCACATGG - Intergenic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1133730856 16:8577441-8577463 GGGACTTACCTAAGGTCACATGG - Intronic
1133763001 16:8814623-8814645 GGGATTTGCCGAAGGTCACACGG + Intronic
1133864169 16:9626332-9626354 TTGTCTTACCCAAGGTCACATGG + Intergenic
1133873433 16:9710922-9710944 GGGGCTGAATCAAGGTGACAGGG + Intergenic
1133888532 16:9855211-9855233 GTGGCTTGTTCAAGGTCACATGG - Intronic
1133918395 16:10130146-10130168 GAGACTCATTCAAGGTTACATGG + Intronic
1133974681 16:10592049-10592071 TTGACTTGCTCAAGGGCACATGG + Intergenic
1134179929 16:12039350-12039372 GTGACTTGCTCAAGGTCATTTGG + Intronic
1134281222 16:12818805-12818827 GGGACTTATTCAAGGTTATATGG - Intergenic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134455161 16:14390073-14390095 GTCACTCACCCAAGGTCACAGGG + Intergenic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134796333 16:17040285-17040307 GGAACATGCTCAGGGTCACAAGG - Intergenic
1135159958 16:20085331-20085353 GCGACTTGGTCAAGGTCACGCGG - Intergenic
1135306674 16:21373117-21373139 GTGACTTGCTCAAGGTCATTTGG + Intergenic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1136179317 16:28539896-28539918 GGGACTCGCCCAAGGTCACACGG - Intergenic
1136303416 16:29352259-29352281 GTGACTTGCTCAAGGTCATTTGG + Intergenic
1136470553 16:30477025-30477047 GAGACTTGACCAAGGTCACATGG + Intronic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137310014 16:47245877-47245899 GGACCATACTCACGGTCACAAGG + Intronic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1137686895 16:50392579-50392601 AGGATTTAACCAAGGTCACAGGG + Intergenic
1137693633 16:50446926-50446948 GACACTTCCTCAAGGTCACTTGG + Intergenic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1138297571 16:55900038-55900060 GGGGATTTCCCAAGGTCACAGGG + Intronic
1138480267 16:57298126-57298148 GTGATCTACCCAAGGTCACACGG + Intergenic
1138526230 16:57608972-57608994 GAGACTTGCCCAAGGTCACCCGG + Intergenic
1138555180 16:57766707-57766729 GGAACTTGCTCAAAGCCACATGG - Intronic
1139236431 16:65344215-65344237 GCTACTTATTCAAGGTCATATGG + Intergenic
1139297041 16:65910051-65910073 GTAACTTGTTCAAGGTCACACGG - Intergenic
1139704898 16:68734571-68734593 CTGACTTCCCCAAGGTCACAGGG + Intergenic
1139768189 16:69250497-69250519 GGAACTTATTTAAGGTCACAAGG - Intronic
1140028411 16:71312920-71312942 GTGATTCACCCAAGGTCACAGGG + Intergenic
1140558213 16:75946069-75946091 AGAACTTACTCCAGGCCACAGGG + Intergenic
1140641676 16:76980972-76980994 GGGACTTGCCCAAGGTCATATGG - Intergenic
1140659215 16:77171320-77171342 GTAACTTGCTCAAGGTCATATGG - Intergenic
1140822422 16:78675216-78675238 GTGACTCACTCAAGATCACGTGG + Intronic
1140836539 16:78799593-78799615 GGGACTTGGCCAAGGTCACATGG + Intronic
1140897988 16:79342143-79342165 GGGACTTGCCCAAAGTCACCCGG + Intergenic
1140959976 16:79902424-79902446 GTGGCTCACTCAAGGCCACAGGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141283459 16:82649806-82649828 GGGGTTTGCTCAAGGTTACAGGG - Intronic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1141629648 16:85280255-85280277 AGGCCTTACTCAAGGTCACCTGG - Intergenic
1141884294 16:86881138-86881160 GTGAATTCCTGAAGGTCACACGG + Intergenic
1141904506 16:87015238-87015260 GAGACTGACTCAGGGCCACACGG + Intergenic
1141984461 16:87570926-87570948 GGGACTTGCCCAAGGTCACTCGG - Intergenic
1142047539 16:87935279-87935301 GGGCCTCGTTCAAGGTCACAAGG + Intronic
1142480288 17:214807-214829 GGGGTCTGCTCAAGGTCACATGG + Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1143100677 17:4503139-4503161 GACACTTACCCAAGGTCACACGG + Intronic
1143289413 17:5817695-5817717 GCAACTTGCTCAAGGCCACAGGG + Intronic
1143355305 17:6323565-6323587 GTCACTTGCTGAAGGTCACAGGG + Intergenic
1143610971 17:8017161-8017183 GACACTTTCCCAAGGTCACATGG - Intronic
1143623215 17:8093035-8093057 GGGACTTGCTCAAGATCAGCTGG + Intergenic
1143794287 17:9324059-9324081 AAGACTTGCTCAAGGTCTCAGGG + Intronic
1143982120 17:10879192-10879214 GTGACTTCCTCAAGGTCGCATGG - Intergenic
1144224762 17:13134240-13134262 GTGACTTGTGCAAGGTCACATGG + Intergenic
1144827865 17:18116428-18116450 GGGACTTGCTCGAGGCCACCTGG - Intronic
1145816305 17:27797456-27797478 GGGACTTGCCAAAGGTTACAGGG + Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146076850 17:29738486-29738508 GAGACTTTCTCAAGGTCTCAAGG - Intronic
1146309088 17:31753248-31753270 GTAACTTATTCAAGTTCACATGG - Intergenic
1146520031 17:33519186-33519208 GTAGCTTACCCAAGGTCACACGG + Intronic
1146558677 17:33849430-33849452 GTAACCTACTCAAGGTCCCATGG + Intronic
1146927220 17:36753379-36753401 CAGCCTTGCTCAAGGTCACAGGG + Intergenic
1146944921 17:36866983-36867005 GTGACTTGCTCAAGGTCCCTTGG - Intergenic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147358039 17:39912722-39912744 GTGACTTACCCAAGGTCATGTGG - Intronic
1147386781 17:40087663-40087685 GTAACTTACCCCAGGTCACATGG - Intronic
1147507940 17:41038973-41038995 GGGACTTGCTCAAGGATTCATGG + Intergenic
1147595288 17:41712719-41712741 GTGACTTGCCCAAAGTCACAGGG + Intronic
1147664319 17:42136514-42136536 GTGACTTGGCCAAGGTCACACGG - Intronic
1147789540 17:43004948-43004970 GAAACTTGCCCAAGGTCACAGGG - Intergenic
1148152267 17:45403860-45403882 GTGACTTGCTCAAGGTCCCTCGG - Intronic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1148330888 17:46813325-46813347 GGGACTCATCCTAGGTCACAGGG + Intronic
1148546456 17:48522788-48522810 GTGACTTACCCAAGGACACAAGG + Intergenic
1148732309 17:49844958-49844980 GTGACTTGTCCAAGGTCACACGG + Intronic
1149541731 17:57472593-57472615 GGGGCTTGCTCAAGGTCATGAGG - Intronic
1149545104 17:57497523-57497545 GGGTCTTTGTCAAGGTTACATGG + Intronic
1149564832 17:57633684-57633706 ATGACTTGCTCAAGGCCACATGG - Intronic
1149995975 17:61406060-61406082 GGGACTTGCCAAAGGTCACACGG - Intronic
1150645181 17:66973463-66973485 GTGACTTACGCAAGGTGGCATGG + Intronic
1150722785 17:67627767-67627789 GAGGCTTGCTCAAAGTCACATGG - Intronic
1151190675 17:72395621-72395643 GTCACTCACTCAAGGTTACACGG + Intergenic
1151880017 17:76889211-76889233 GTGGCTTTCCCAAGGTCACACGG - Intronic
1152025922 17:77809215-77809237 GGGCCTGACCCAAGGTCACAAGG + Intergenic
1152517014 17:80831312-80831334 GGGATTTTCTCAGGGTGACATGG - Intronic
1152718763 17:81912265-81912287 GGGGCTTCCTCAAGGACAAATGG + Exonic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1153518877 18:5933193-5933215 ATAACTTAGTCAAGGTCACATGG - Intergenic
1154111436 18:11571899-11571921 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1155245113 18:23900847-23900869 AGGACTGACCCAAGGTTACATGG - Intronic
1155494854 18:26432833-26432855 GTGACTTATTCATGGTTACATGG - Intergenic
1155515269 18:26618131-26618153 AAGACTTGCTTAAGGTCACATGG - Intronic
1155557915 18:27042268-27042290 GTGACTTGGTCAAGGTCACTTGG - Intronic
1156197209 18:34788501-34788523 GTGACTTGCCCAAGGTCATAGGG + Intronic
1156596378 18:38552410-38552432 GAGGCTTATTCAAGGTCACATGG - Intergenic
1157298218 18:46461183-46461205 GGGACTTGCTCAAGGTCATTGGG - Exonic
1157306427 18:46520884-46520906 ATGACTTGCCCAAGGTCACACGG + Intronic
1157740958 18:50092384-50092406 GGGACAGGCCCAAGGTCACATGG + Intronic
1158021535 18:52847840-52847862 GTGACCTACTCAAAGTTACAAGG - Intronic
1158427060 18:57349805-57349827 GTAACTTACCCAAGGTCACCTGG + Intergenic
1158535123 18:58301618-58301640 GGAGCTTACTCAGGGTCAGAGGG + Intronic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1158589834 18:58769905-58769927 CTGGCTTGCTCAAGGTCACAGGG + Intergenic
1158706821 18:59800009-59800031 GGGACTTCTTCAAGGTCACCAGG - Intergenic
1158876539 18:61739495-61739517 GGGATGTGCTCAAAGTCACACGG - Intergenic
1160481389 18:79243568-79243590 AGGACCTAGTCAAGGACACAAGG - Intronic
1161438271 19:4277050-4277072 GTGGCTGATTCAAGGTCACAGGG + Intergenic
1161672862 19:5623749-5623771 GGGACTCGGCCAAGGTCACACGG + Intronic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1161850639 19:6736492-6736514 GGGACTTGTACAAGATCACATGG + Intronic
1161867481 19:6844129-6844151 GTGAATTACTTAATGTCACATGG + Intronic
1161885101 19:6988482-6988504 GTGGCTGGCTCAAGGTCACATGG - Intergenic
1162135170 19:8550833-8550855 GGCACTTACCCAAGGTCACGCGG - Intronic
1162556208 19:11387560-11387582 GTAACTTACTCAAGGTCCCATGG - Intronic
1163126132 19:15245204-15245226 GGGACTTGTCCAGGGTCACATGG + Intronic
1163372435 19:16908899-16908921 GGGAGTTACCCCAGGTCACGCGG + Intronic
1163497610 19:17655833-17655855 GGGGCTGCCACAAGGTCACAGGG - Intronic
1164764504 19:30753712-30753734 AGGACTTTGCCAAGGTCACAGGG - Intergenic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1165717195 19:38053998-38054020 GGGACCTGTCCAAGGTCACACGG + Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166608939 19:44171596-44171618 GGAACGTGCTCAAGTTCACATGG + Intronic
1166772495 19:45292356-45292378 GTTACTTGCCCAAGGTCACACGG - Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
1166831585 19:45642583-45642605 GGGACTTCCCCAAGGTCACACGG - Exonic
1167020674 19:46873047-46873069 GGGACTTGCCCAAGGCCACATGG + Intergenic
1167368612 19:49067537-49067559 AGGTGTTACCCAAGGTCACAAGG - Exonic
1167578842 19:50330524-50330546 GGCACTGCCTAAAGGTCACAGGG + Intronic
1168148479 19:54432447-54432469 GGGACCTTCCCAAGGTCACACGG + Intronic
1168160520 19:54507630-54507652 GGGCCTTGCTCAGGGTCACGTGG - Intronic
925297004 2:2783951-2783973 GGCCCTTGCTCGAGGTCACATGG - Intergenic
925332858 2:3072145-3072167 GGGGTTTTCTCAAGGTTACATGG - Intergenic
926063581 2:9820158-9820180 AGGACTTGCCCAAGGTCACGCGG + Intergenic
926216860 2:10911404-10911426 GGGACTTGCCCAAGGTCACGCGG - Intergenic
926268599 2:11347241-11347263 GTAACTTGCTCAGGGTCACATGG - Intronic
926294912 2:11562178-11562200 ATGACTCACCCAAGGTCACACGG - Intronic
926694898 2:15764337-15764359 GGGACTTCCCCAAGGTCACATGG + Intergenic
926806775 2:16718396-16718418 GGGGCTTGCCCAAGGACACACGG - Intergenic
926931603 2:18046728-18046750 GTGATTCACTCAAGGTCACTTGG + Intronic
927197904 2:20560678-20560700 GGGACTCACCCAAGGTCACATGG + Intronic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
928034202 2:27806559-27806581 AGAACTTGCTCAAGGTCAAATGG + Intronic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928376586 2:30779295-30779317 GGGAATTGTTCAAGGTCTCAAGG - Intronic
928455140 2:31413936-31413958 GGGACTTAGGGAAGGTGACATGG - Intronic
929171584 2:38937721-38937743 GGGACTCATTAGAGGTCACAGGG + Intronic
929557946 2:42937156-42937178 GGGGCTTGCTTAAGGTCACCCGG + Intergenic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930688691 2:54336454-54336476 GTGACTTGCCCAAAGTCACATGG - Intronic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
932476860 2:72011722-72011744 GTAACTTACCCAAGTTCACATGG - Intergenic
932721331 2:74140870-74140892 AAAACTTGCTCAAGGTCACATGG + Intronic
933028755 2:77297864-77297886 AGGACTGACACAAGATCACATGG + Intronic
933668785 2:84986904-84986926 TGGACTTACTTAAGGTTCCAAGG + Intronic
933693146 2:85195132-85195154 GTAACTTGCTCAAGGTTACAAGG - Intronic
933808231 2:86015574-86015596 GCCACTTGCTGAAGGTCACAGGG + Intergenic
934603898 2:95679840-95679862 GGGACCTGCCCAAAGTCACAGGG - Intergenic
936004158 2:108867171-108867193 GTGACTTATTTAATGTCACAGGG + Intronic
936373041 2:111919055-111919077 GTGACTTACACAAGGTCACCTGG + Intronic
936537282 2:113322069-113322091 GGGACCTGCCCAAAGTCACAGGG - Intergenic
936688526 2:114857943-114857965 GTAGCTTTCTCAAGGTCACATGG - Intronic
936880946 2:117250254-117250276 GGGAATTACTGGAGGTCAGAAGG - Intergenic
936913790 2:117618665-117618687 GTGACTGGCTTAAGGTCACATGG - Intergenic
937198396 2:120180462-120180484 GGAACTTGCCCTAGGTCACATGG + Intergenic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
938736131 2:134188374-134188396 GGGACTTGTGCAAGGCCACATGG - Intronic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941329794 2:164165670-164165692 GCCACCGACTCAAGGTCACAGGG + Intergenic
942605659 2:177687862-177687884 GTGACTTGTTCAAGGTCCCAGGG + Intronic
943537038 2:189165652-189165674 GGAACTTGTTCAAGGTCACAAGG + Intronic
944014026 2:195010524-195010546 GTGAAATACTCAAGGTCACAGGG - Intergenic
944016266 2:195043062-195043084 GTGAGTTGCTCAAAGTCACATGG - Intergenic
944384473 2:199149316-199149338 GGGACTTATTCACTATCACAAGG - Intergenic
944685536 2:202114178-202114200 GGGACTGACTCAAAGTCATCTGG - Intronic
945603789 2:211901211-211901233 GTGACTTATTCAAGGTTACAGGG - Intronic
945975798 2:216269769-216269791 GCCAGTTCCTCAAGGTCACAAGG + Intronic
945978202 2:216286988-216287010 ATGACTCACTCAAGGTCACACGG + Intronic
946046759 2:216827763-216827785 GGAACTTGCCCAAGGTCATATGG + Intergenic
946109933 2:217405944-217405966 ATGACTCAGTCAAGGTCACATGG + Intronic
946395240 2:219440740-219440762 GTTACTTGCCCAAGGTCACATGG - Intronic
946565407 2:220959017-220959039 GTGATTTACCCAAAGTCACATGG - Intergenic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
947354862 2:229281470-229281492 GTGACTTTCTCAAAGTCACCTGG - Intergenic
948164989 2:235854249-235854271 AGGCCTTGTTCAAGGTCACATGG + Intronic
948268705 2:236657397-236657419 GGGACTCTCTCCAGGGCACATGG - Intergenic
948321443 2:237072890-237072912 TGGCCTTGCTCAAGGTCACGCGG + Intergenic
948814597 2:240503342-240503364 GGGACTTTCTGAAGGTCCCCTGG + Intronic
1168796481 20:613145-613167 GTGACTTGCCCGAGGTCACACGG + Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168833478 20:860521-860543 GTGATTTGCCCAAGGTCACATGG - Intergenic
1168851039 20:977370-977392 GGCACTGGGTCAAGGTCACATGG - Intronic
1168858724 20:1029375-1029397 GTCACCTACACAAGGTCACATGG - Intergenic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1169250839 20:4060212-4060234 GTCACTTGCTCAAGGCCACATGG - Intergenic
1169760234 20:9083665-9083687 AGCACTTACTGAGGGTCACATGG + Intronic
1169777949 20:9276590-9276612 GGGATTTGTCCAAGGTCACATGG + Intronic
1170419641 20:16180125-16180147 GGGAGATACTCAATGTCACGTGG + Intergenic
1170427004 20:16245150-16245172 ATGACTTGCTGAAGGTCACAAGG + Intergenic
1170486422 20:16821090-16821112 GGGATTTGTTCAAGGTCACATGG + Intergenic
1170799144 20:19576034-19576056 GGAACTTACCCAAGTACACATGG - Intronic
1170855154 20:20045767-20045789 GTGACTTATCCAAGATCACATGG - Intronic
1172030776 20:31980545-31980567 ATGACTTGCCCAAGGTCACATGG - Intronic
1172053524 20:32138056-32138078 AAGACTTAGTCAGGGTCACATGG + Intronic
1172187810 20:33042157-33042179 GGGACTTTCCTAAGCTCACACGG - Intronic
1172254469 20:33505121-33505143 GTGATTTACTCACTGTCACACGG + Intronic
1172318066 20:33971785-33971807 ATAACTTACTCAAAGTCACATGG - Intergenic
1172331629 20:34079741-34079763 GAGACTTGCCCAAGGTTACATGG + Intronic
1172376598 20:34446839-34446861 GTAACTTACTCAAAGTCATATGG - Intronic
1172425796 20:34855072-34855094 GAGACTCATTCAAGTTCACATGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172647170 20:36477858-36477880 GGGACTTGCCCAAGGTCATACGG + Intronic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
1172772110 20:37387951-37387973 ATAACTTACCCAAGGTCACATGG + Intronic
1172801180 20:37577297-37577319 GTGACTTGCGCAGGGTCACAAGG - Intergenic
1172810668 20:37645608-37645630 GTGAGTTACTCAAGGTCGCATGG - Intergenic
1172852017 20:37973230-37973252 GAGACTTTCCCAAGGCCACATGG + Intergenic
1172852968 20:37979891-37979913 ATGACTTGCCCAAGGTCACACGG + Intergenic
1172855791 20:38001315-38001337 TTAACTTACTCAAGGTCACATGG + Intronic
1173113393 20:40217534-40217556 GTAGCTTACCCAAGGTCACAGGG + Intergenic
1173421856 20:42908201-42908223 GTGACTTGTCCAAGGTCACATGG - Intronic
1173954336 20:47019043-47019065 GTCACTTACCCAAGGTCACACGG + Intronic
1173981359 20:47226576-47226598 GGAAATTATTCAAAGTCACACGG - Intronic
1174089547 20:48036161-48036183 GTGACCTACTCAAGGCCCCAGGG + Intergenic
1174140443 20:48409565-48409587 GTGACTCACCCAAGGTCACCTGG - Intergenic
1174162399 20:48560907-48560929 GGGTCTTGCTCAAGGTCACGAGG - Intergenic
1174179415 20:48665551-48665573 GAAACTTTCTCAAGGTTACATGG - Intronic
1174191408 20:48743178-48743200 AGGACTTGCCCAAGGTCACTGGG + Intronic
1174267840 20:49344845-49344867 GTGGCTTGCTCAAGGTCCCATGG - Intergenic
1174269138 20:49354338-49354360 GTGCCTTGCCCAAGGTCACATGG + Intergenic
1174367713 20:50066551-50066573 GCCACTGGCTCAAGGTCACAGGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174392453 20:50226389-50226411 GTGACTTGCCCCAGGTCACACGG - Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174792140 20:53489150-53489172 GGGATTTACTCATGGGCATAGGG + Exonic
1174915503 20:54649205-54649227 AGGTCTTACTCCAGGCCACATGG + Intronic
1174994544 20:55551170-55551192 GTGACTTACCCAAGGTCACGTGG - Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175073482 20:56354402-56354424 GGAACTTTTTGAAGGTCACAGGG - Intergenic
1175189289 20:57200270-57200292 GTGACTCACCCTAGGTCACAAGG + Intronic
1175264987 20:57697103-57697125 GGGACTCACACAGGGTGACAAGG + Intronic
1175371901 20:58497781-58497803 AGCACTTACTGAAGATCACATGG + Intronic
1175458772 20:59135121-59135143 GGGACTCACACAAGATCACTGGG + Intergenic
1175462767 20:59165480-59165502 GTGACTTATTCCAGGTTACAGGG + Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175669937 20:60893369-60893391 ATAACTTGCTCAAGGTCACATGG + Intergenic
1176372969 21:6073660-6073682 GGGACTCACTCAAGGTCACAGGG - Intergenic
1176913138 21:14592481-14592503 GTGGCTCACTCAAGTTCACATGG - Exonic
1178138315 21:29653587-29653609 GAGGGTTACTCAAGGTGACATGG - Intronic
1178235053 21:30832230-30832252 GAGAATTACTGAAGGTCACATGG + Intergenic
1178592292 21:33921565-33921587 GGTACTTGCCCAAGGCCACAGGG + Intergenic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1178974538 21:37209651-37209673 GGGGCTTAAGGAAGGTCACATGG - Intergenic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179326623 21:40352742-40352764 GTGAATTACCCAAGATCACATGG - Intronic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179567267 21:42257143-42257165 GGAACTTGCCCAAGGTCACACGG + Intronic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1179710655 21:43211268-43211290 GTGACTTATCCAAGGTCACAGGG - Intergenic
1179750508 21:43464583-43464605 GGGACTCACTCAAGGTCACAGGG + Intergenic
1180595509 22:16970358-16970380 GGAAAATACTCAAGGCCACAAGG - Intronic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181601127 22:23952430-23952452 GGGACTTGCACAAGGCCACAGGG + Intergenic
1181607382 22:23988896-23988918 GGGACTTGCACAAGGCCAGAGGG - Intergenic
1181762813 22:25069593-25069615 GGGACTTGGCCAAGGTCACGCGG - Intronic
1181857658 22:25793588-25793610 GGGACTTTTGCAAAGTCACATGG + Intronic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1181915469 22:26276308-26276330 GGAATTTGCTCAAGGTCACATGG + Intronic
1181936912 22:26445601-26445623 GGGACTTGCCCAAGGTCCCGAGG - Intronic
1181993530 22:26856981-26857003 GTGACTAGCCCAAGGTCACACGG + Intergenic
1182020234 22:27075514-27075536 TTGACTTATCCAAGGTCACAAGG - Intergenic
1182038449 22:27217545-27217567 AAGACTTGCCCAAGGTCACACGG - Intergenic
1182065601 22:27429344-27429366 GTAACTTGCTCAAGGTCATATGG + Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182414540 22:30212779-30212801 GTGACTTCCTCTGGGTCACACGG + Intergenic
1182520594 22:30882439-30882461 GGGACTCGCCCAAGGCCACAAGG - Intronic
1182554548 22:31122270-31122292 GGAACTTGCTCAAGGTCACCTGG - Intergenic
1182735288 22:32528865-32528887 GGGTCTTACCCAAGGTCTGAGGG + Exonic
1182740588 22:32564461-32564483 GTAACTTTCCCAAGGTCACACGG + Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183016927 22:34996468-34996490 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1183106032 22:35615725-35615747 GAGACTTGTCCAAGGTCACATGG + Intronic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183198554 22:36370172-36370194 ATGACTCACTCAAGGTCAAAGGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183567135 22:38623535-38623557 GTGACTCACCCAAGGCCACAAGG - Intronic
1183589691 22:38772779-38772801 GGGAGTCACTCAAGGCCACACGG + Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183688324 22:39374676-39374698 GGGATGGACTCAGGGTCACATGG + Intronic
1183730072 22:39613557-39613579 GTGACTTGCCCAAAGTCACATGG + Intronic
1183741639 22:39671859-39671881 ATGACTTACTCAAGATCATAAGG + Intronic
1183835682 22:40450927-40450949 GGGACTTGCTGTAGGTTACACGG - Intronic
1184040711 22:41941585-41941607 GTGACCTATTCAAAGTCACACGG + Intronic
1184060022 22:42075706-42075728 GGAACTTGCCCAAGGTTACATGG - Intronic
1184449986 22:44577056-44577078 GGGACTTGCTCAGGGTCACACGG - Intergenic
1184470765 22:44694643-44694665 GTGACTTATCCTAGGTCACATGG - Intronic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949355112 3:3172149-3172171 GGGAATTTCTAAATGTCACAAGG + Intronic
949517706 3:4822075-4822097 GTGACTTGCCCAGGGTCACACGG - Intronic
949856431 3:8466103-8466125 GTGATCTACCCAAGGTCACACGG + Intergenic
949907293 3:8868821-8868843 AGGACTCACTCAAGATCCCACGG + Intronic
949919031 3:8987052-8987074 GAGATTTGCTCAGGGTCACACGG - Intronic
949953200 3:9246533-9246555 ATGACTTGCCCAAGGTCACAAGG - Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950094685 3:10321998-10322020 GGGACTTACTCAGGACCCCAGGG - Intergenic
950191114 3:10976801-10976823 GGGATTTGTTCAAGGTCACATGG - Intergenic
950206843 3:11087291-11087313 GTGACTTGCTCAGGTTCACATGG + Intergenic
950243233 3:11390924-11390946 GATACTTGCTCAAGGTCACATGG - Intronic
950440768 3:13008960-13008982 GTGACTTGCACAAGGCCACATGG + Intronic
950549387 3:13656935-13656957 GGGACTTGCCCAAAGCCACATGG + Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950567889 3:13781972-13781994 AGGACTTGCTCAAGGTCACACGG + Intergenic
950585632 3:13890410-13890432 GTCACTTGCACAAGGTCACAGGG - Intergenic
950897908 3:16469974-16469996 GTGACTTGCTCAAGGTCATGGGG + Intronic
950997229 3:17515548-17515570 GTGACTTATGTAAGGTCACAGGG + Intronic
951133711 3:19078289-19078311 AGGTCTAACTCAAGGCCACAGGG + Intergenic
952307967 3:32162095-32162117 GTGACTTGCCCAAGGCCACAGGG - Intronic
952323757 3:32301854-32301876 GTGATTTACCCAATGTCACATGG - Intronic
952519185 3:34138247-34138269 GTGACTTATTCAAGCTCATAAGG + Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
954423057 3:50428745-50428767 GGGACTTGCCCAAGGTCACTAGG + Intronic
955150181 3:56359566-56359588 GTGACTTGCCCAAGGCCACATGG + Intronic
955693636 3:61614325-61614347 GTAACTCACTCAAGGTCATAGGG - Intronic
955705981 3:61728222-61728244 CAGACTTGCTCAAGGTCGCACGG - Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
956100201 3:65760344-65760366 GAAACTTGCCCAAGGTCACACGG + Intronic
956417680 3:69051078-69051100 GTAACTTGCTCTAGGTCACACGG - Intronic
956760016 3:72433508-72433530 GTAACATACCCAAGGTCACAAGG + Intronic
957326081 3:78696425-78696447 AGAACTTTATCAAGGTCACAGGG + Intronic
958482955 3:94667469-94667491 GAAACTAACCCAAGGTCACATGG + Intergenic
958664984 3:97126004-97126026 GAGACTTATTCAAGATCAAATGG + Intronic
958827436 3:99048709-99048731 GTGACTTAGTCAAGAGCACATGG + Intergenic
959393848 3:105811406-105811428 GTGACTTACTCAAAGCCACCAGG - Intronic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960356539 3:116660584-116660606 GTAACTTACTCAAGGTCACTTGG + Intronic
960502776 3:118457149-118457171 AGGACTCACTCACTGTCACAAGG + Intergenic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
960667726 3:120126951-120126973 GGAACTTACTGAAAGTCATATGG - Intergenic
960915488 3:122690250-122690272 GAGACATGCCCAAGGTCACATGG + Intronic
961210165 3:125119469-125119491 GGGTCTTGTTCAAGGTTACAGGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961633060 3:128315462-128315484 GGCCCTTGCTCAAGGCCACACGG + Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
961669748 3:128520338-128520360 GTGACTCACCCAAAGTCACATGG - Intergenic
961708267 3:128806755-128806777 GGGACTTAACCCAGGTCACCTGG - Intronic
962357341 3:134706046-134706068 GGCACTAACTCAAAGTCACAAGG + Intronic
963044150 3:141090174-141090196 TGGACTTTCTCATGGACACATGG - Intronic
963219746 3:142796152-142796174 GTAACTTGCGCAAGGTCACATGG + Intronic
963900245 3:150726663-150726685 GTTACTTACTCAAGTTTACATGG - Intergenic
964143378 3:153429667-153429689 GGGACTTTCTTAAGGTTACACGG + Intergenic
964724284 3:159798265-159798287 GTAATTTGCTCAAGGTCACATGG - Intronic
965450800 3:168835312-168835334 CTAACTTACTCAAGGCCACATGG + Intergenic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966239437 3:177739922-177739944 GTAACTTGCTGAAGGTCACATGG - Intergenic
966929450 3:184666316-184666338 GTGACTTACCCAAGTTCACAAGG - Intronic
967016581 3:185487882-185487904 GGGGCTAACTCAAGCTCAAATGG - Exonic
967526658 3:190502925-190502947 GAGAGTTGCTTAAGGTCACACGG - Intergenic
967830557 3:193915845-193915867 TTGACTTGTTCAAGGTCACATGG - Intergenic
967864042 3:194175730-194175752 GAGACTCAGCCAAGGTCACAGGG + Intergenic
967954553 3:194868413-194868435 ATCACTTACCCAAGGTCACACGG - Intergenic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
967976830 3:195040224-195040246 GTGACTTGCCCAAGGTCACGCGG + Intergenic
968045279 3:195620481-195620503 GGGACTTGCCCAAGGTCACTCGG - Intergenic
968061134 3:195726824-195726846 GGGACTTGCCCAAGGTCACTCGG - Intronic
968884523 4:3320504-3320526 GTGACTTGCTCACAGTCACAGGG + Intronic
969053835 4:4389505-4389527 GGGACATACCCAAGGTCACTGGG + Intronic
969134314 4:5017903-5017925 GGCACTTGCCCATGGTCACACGG - Intronic
969292800 4:6251594-6251616 GTGACTTGCCCAAGGTCACCTGG - Intergenic
969427686 4:7135303-7135325 GGGACTTGTTCAAGCTCACATGG - Intergenic
969485285 4:7468912-7468934 GTGACTTGTCCAAGGTCACACGG - Intronic
970081848 4:12296261-12296283 GGAACTCACTCAAGGATACAAGG - Intergenic
970559025 4:17264837-17264859 GTGACATATCCAAGGTCACAGGG + Intergenic
970620386 4:17811342-17811364 GGGACTTACCCGAGGTCGCCTGG + Intronic
970693152 4:18643086-18643108 GTGTCTCTCTCAAGGTCACATGG - Intergenic
971066469 4:23038498-23038520 GTGACTTGCCCAAGGTGACATGG + Intergenic
971157197 4:24095861-24095883 GGGACTTAATCACATTCACAAGG + Intergenic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
971658738 4:29384664-29384686 GGCACTTGCTCTATGTCACAGGG + Intergenic
971748724 4:30618874-30618896 GGGATTTGCTCAAGGTTACATGG + Intergenic
971970668 4:33616151-33616173 GGGATTTACTCAATGACATAAGG + Intergenic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
972287219 4:37660711-37660733 TGCACTTGCTCAAGGTCACATGG + Intronic
972425624 4:38929900-38929922 GTGACTTATTCAAGGTTACAAGG - Intronic
972736672 4:41848750-41848772 GAGGCTTGGTCAAGGTCACATGG + Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
974490972 4:62564195-62564217 TTGACTTACTTAAGATCACATGG - Intergenic
974600998 4:64079290-64079312 CTTACTTACTCAAGGTCACCAGG + Intergenic
976001980 4:80385589-80385611 GTGACTTGCCCGAGGTCACAAGG + Intronic
977491590 4:97720193-97720215 GAGAATTAATCAAGGTCACATGG - Intronic
977640013 4:99346893-99346915 AGGACTTGCACAAGGTCACAGGG - Intronic
978459464 4:108935039-108935061 GTGACTTGCCCAAGGTCAGACGG + Intronic
979324156 4:119360035-119360057 GCAACTTAGGCAAGGTCACATGG - Intergenic
979458963 4:120958518-120958540 GTAACTTACGCAAGGTAACATGG - Intergenic
979459691 4:120967875-120967897 GTGACTTGACCAAGGTCACATGG + Intergenic
979478208 4:121183411-121183433 GGGAGTTGCTCATAGTCACATGG + Intronic
979513892 4:121584959-121584981 GAAACTTGCTCAAGGTCACTTGG - Intergenic
979533200 4:121791227-121791249 ATTACTTTCTCAAGGTCACATGG - Intergenic
981127812 4:141126860-141126882 GTGACTGACTCAAAGTCAAATGG + Intronic
981347398 4:143692247-143692269 GTCACTTACTCAAGGTCACACGG + Intronic
981648341 4:147025956-147025978 GTGCCTTCCTTAAGGTCACATGG - Intergenic
982293730 4:153805934-153805956 GTAACTTTCTCAAGGTCACCTGG - Intergenic
982342405 4:154315276-154315298 GTAACTTGTTCAAGGTCACATGG + Intronic
983241993 4:165244736-165244758 GCAACTTAGGCAAGGTCACATGG - Intronic
983830231 4:172317843-172317865 GGTACTTAATCAAGTTCACAAGG - Intronic
984748720 4:183251049-183251071 GTGACTTGTTCAAGCTCACATGG - Intronic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
985170476 4:187143591-187143613 GAGACTTGCTGAATGTCACATGG + Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
988992670 5:36686827-36686849 GGGACTTGCTCAAGGCCACATGG - Exonic
989532136 5:42520336-42520358 GGGATTTACACAAGATCACAAGG - Intronic
990382346 5:55230024-55230046 GTGACTTGCTTAAGGTCACCTGG + Intergenic
990488120 5:56278918-56278940 GAGACCTCCTGAAGGTCACATGG - Intergenic
991189579 5:63853835-63853857 GTAACTTTCTCAGGGTCACATGG - Intergenic
991416556 5:66398732-66398754 GGGACTTGCTCAAGGATCCAAGG - Intergenic
991495698 5:67223696-67223718 TGCACTTACTGAAGGTCATAAGG + Intergenic
992853406 5:80834937-80834959 GCCACTTCCTCAAGGTGACAGGG - Intronic
993008923 5:82458048-82458070 GTAACTTAATCCAGGTCACAAGG - Intergenic
993275249 5:85849469-85849491 AGAACTTACTCAATATCACAAGG + Intergenic
995138586 5:108707090-108707112 TGAACGTGCTCAAGGTCACAGGG - Intergenic
995850234 5:116537326-116537348 ATGACTTACTCAAAGACACATGG + Intronic
995926405 5:117380247-117380269 GGGACCTACTCAAGGTTAATAGG + Intergenic
996133931 5:119815816-119815838 GTGATTTTCACAAGGTCACATGG + Intergenic
996763085 5:127005469-127005491 GGGACTTACCCAGGATCACGTGG - Intronic
997430301 5:133833728-133833750 GGGACATACTTGAAGTCACATGG - Intergenic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997650277 5:135512258-135512280 GTGGCTCACCCAAGGTCACAAGG - Intergenic
997752373 5:136358675-136358697 GGGACCTGCTCAAGGTCTCAAGG - Intronic
997994630 5:138575676-138575698 AGGAAAGACTCAAGGTCACACGG + Intergenic
998151493 5:139759961-139759983 AGGCCTTGCCCAAGGTCACATGG + Intergenic
998207758 5:140171336-140171358 GTAACTCACTCAAAGTCACATGG + Intergenic
998364819 5:141622801-141622823 GTAACTTTCTGAAGGTCACATGG - Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
998861621 5:146449455-146449477 GTGACTTACACAAGGTCACTGGG + Intronic
999038866 5:148384549-148384571 TGGACCTAGACAAGGTCACACGG - Intronic
999252200 5:150189537-150189559 GTTACTTACTCAAAGTCACGGGG - Intergenic
999255887 5:150209898-150209920 GGGACTTGCCCCAGGTCGCATGG + Exonic
999437239 5:151572401-151572423 GAGACTTGCCCAAAGTCACAGGG + Intergenic
999515144 5:152294492-152294514 GGGACTCACCCAGGGTCACATGG + Intergenic
999543172 5:152597048-152597070 CTGACTTACCCAAGGTCCCATGG + Intergenic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
999681817 5:154067772-154067794 GGGGCTTGTCCAAGGTCACATGG - Intronic
999718989 5:154384817-154384839 GGAACTTGCTCAAGGCCCCATGG - Intronic
1000015636 5:157273268-157273290 GGGACTTGTGCAAGGTCACTGGG - Intronic
1000247809 5:159463441-159463463 GTGACTTGCACAAGGTCATATGG + Intergenic
1000274779 5:159724433-159724455 GCGACTTACCTAAGGTCACATGG + Intergenic
1000815230 5:165912907-165912929 GGAACTTGCTCAAGGTCAAAGGG - Intergenic
1001007407 5:168065384-168065406 GGGACGTGCTCAAGGTCCCCTGG - Intronic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1001323002 5:170698276-170698298 GTGACTTACCCAAGGCCACCAGG + Intronic
1001702242 5:173715172-173715194 AGCACTTACTCAAGGTTACCCGG - Intergenic
1001837892 5:174847420-174847442 GGCACTTACTCAAGGTCACGGGG + Intergenic
1001954075 5:175836457-175836479 GGCTCTTACTCAAGTCCACAGGG + Intronic
1001954189 5:175837152-175837174 GTGACCTGGTCAAGGTCACAGGG + Intronic
1001960569 5:175878285-175878307 GGGCCTTGCTGAAGGTCCCATGG + Intronic
1002248189 5:177903567-177903589 GAGACTTGTTCAAGGTCACACGG + Intergenic
1002329086 5:178429212-178429234 GGGACTCATCCAAGGTCACAGGG + Intronic
1002372495 5:178766643-178766665 GGAGCTTGCCCAAGGTCACATGG - Intergenic
1002839080 6:890350-890372 GGAACTGACCCAGGGTCACATGG - Intergenic
1004199912 6:13538537-13538559 GTGACTTGCCCAAGGTCATATGG - Intergenic
1004342637 6:14820947-14820969 GTCATTTACTCAGGGTCACATGG - Intergenic
1006228392 6:32560410-32560432 TGGACTTTCACAAGGTCCCATGG + Intronic
1006376161 6:33672771-33672793 GGTGCTTTCCCAAGGTCACAGGG + Intronic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006738173 6:36289900-36289922 GTGATTTACCCAAAGTCACATGG - Intronic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1006803704 6:36775356-36775378 AGAGCTTGCTCAAGGTCACACGG - Intronic
1007072591 6:39048383-39048405 GGGACTTGTCCAAGGTCACACGG - Intergenic
1007505332 6:42331384-42331406 GGGACTAACTGAAAGTCAGAAGG + Intronic
1007953623 6:45896430-45896452 GAGCCTTGCTCAAGGGCACATGG + Intergenic
1007990509 6:46250594-46250616 AGGACTTACCCATGGGCACATGG + Intronic
1008088513 6:47269088-47269110 GTGACTTGCCCAAAGTCACATGG - Intronic
1008210190 6:48712684-48712706 GTGACTTGCCCAAAGTCACAAGG + Intergenic
1008487989 6:52055856-52055878 GTTACTTACTCAAGGTTGCATGG - Intronic
1008506362 6:52234678-52234700 GCGACTTGCTCAAGGTCACTTGG - Intergenic
1008895531 6:56549925-56549947 GTGACTTGTCCAAGGTCACACGG - Intronic
1010050245 6:71495671-71495693 GGAACTTACCCAAGGTCATCTGG + Intergenic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1010300051 6:74249509-74249531 GGGACTGGCTCAAGTTCACATGG - Intergenic
1010421472 6:75681224-75681246 AGAACTTACTCAATGTAACAAGG - Intronic
1010932459 6:81819209-81819231 GGGACTGATTCAAGTTAACATGG - Intergenic
1011504289 6:88023943-88023965 ATGACTTGCTCAGGGTCACATGG + Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1011701609 6:89960308-89960330 GGGATTTACCCAAAGTCACAGGG + Intronic
1012265483 6:97136980-97137002 GTGACTTTCTCAGGGTCACACGG - Intronic
1013441352 6:110173510-110173532 GTAATTTGCTCAAGGTCACATGG - Intronic
1013457479 6:110343800-110343822 AGGCCTTACTGAAGGTCTCAGGG - Intronic
1013520621 6:110929731-110929753 GGAACTTGCTTAAGGTCATAAGG + Intergenic
1013591126 6:111620365-111620387 GCAACTTACCCAAGGCCACAAGG + Intergenic
1014153321 6:118084096-118084118 GTGACTTGCCCAGGGTCACATGG + Intronic
1015022236 6:128490627-128490649 GCGACTGCCCCAAGGTCACATGG - Intronic
1016276281 6:142356735-142356757 GTGACTACCTCAAGGTCACATGG + Intronic
1016319061 6:142822113-142822135 GAGAGTTACTTAAGGTCATATGG - Intronic
1017414392 6:154204651-154204673 ATGACTTCTTCAAGGTCACATGG - Intronic
1017447078 6:154516869-154516891 CTGACTTGCTCAAGGTTACAGGG - Intergenic
1017587538 6:155943822-155943844 GTCACTTGCTCAAAGTCACATGG - Intergenic
1017780401 6:157711205-157711227 GTGACTTACCCAAGGTCACGTGG - Intronic
1017804460 6:157931775-157931797 CTGACTTGCCCAAGGTCACATGG - Intronic
1018002619 6:159593102-159593124 GAGACTTGCCCAAGGACACATGG - Intergenic
1018347016 6:162910227-162910249 ATAACTTCCTCAAGGTCACACGG + Intronic
1018364471 6:163103873-163103895 ATGACTTGCCCAAGGTCACAGGG + Intronic
1018954099 6:168396375-168396397 GGGACTCACTCCAGCTCACCTGG + Intergenic
1020035866 7:4962797-4962819 GGGACCTTCCCAAGGTCACAGGG + Intergenic
1020444993 7:8259679-8259701 GTAACTTGGTCAAGGTCACACGG + Intronic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1021640104 7:22728233-22728255 GGAATTTACCCAAGATCACAAGG - Intronic
1021731914 7:23603897-23603919 GGGACTTAATCAGGGAGACATGG + Intronic
1021904643 7:25321406-25321428 AAGATTCACTCAAGGTCACATGG + Intergenic
1022581565 7:31560336-31560358 GGCTCTTACTCAGTGTCACAAGG + Intronic
1022779482 7:33564414-33564436 GTTACTTACTCAAAATCACATGG - Intronic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1022838532 7:34140112-34140134 GTAATTTACTCAATGTCACAGGG - Intronic
1023132506 7:37016812-37016834 GTGACTTCTCCAAGGTCACATGG + Intronic
1024803980 7:53114550-53114572 TGAACTTACCCAAGGTCAGATGG + Intergenic
1025706257 7:63867051-63867073 GGGACTTACTGGAGGAAACATGG - Intergenic
1026023877 7:66730270-66730292 GTGACTTCCTCAGGGTCTCAGGG - Intronic
1026124751 7:67569820-67569842 GTGACTTAATCAATGTCACGTGG + Intergenic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1026470533 7:70691457-70691479 GGGACTGAATCCAGGTCAGAGGG - Intronic
1027162429 7:75812479-75812501 GTAACTTGCTCAAGGTCACGTGG - Intronic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1029141921 7:98417449-98417471 GTGACTTACTCCAAGTCACAGGG - Intergenic
1029587671 7:101485814-101485836 GGGACAATCCCAAGGTCACATGG - Intronic
1031251573 7:119389771-119389793 GGAACTTTCTCAAAGTCTCATGG - Intergenic
1031414600 7:121480379-121480401 GGGACTTACTTAACTTCACCAGG - Intergenic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1031958820 7:127970337-127970359 ATGACTTACACAAGGTCACATGG - Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1032668124 7:134057882-134057904 GGTATTTGCCCAAGGTCACATGG + Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1032728063 7:134610516-134610538 GGCACTTCCTCAAGGGGACATGG + Intergenic
1033438268 7:141353935-141353957 GAGACTTTCTCAAGGTCAAATGG - Intronic
1033806334 7:144958565-144958587 GAGACTTGCTCAAGGTCAGATGG - Intergenic
1034418323 7:150976674-150976696 AAGAGTCACTCAAGGTCACATGG + Intronic
1034550887 7:151819960-151819982 GTGACGTGCCCAAGGTCACATGG + Intronic
1034563495 7:151896163-151896185 GTGACTCATTCAAGGTCACAGGG + Intergenic
1035274451 7:157739152-157739174 GGGACTCACCCAAGGTCACACGG + Intronic
1035520241 8:270493-270515 GGGACTTACCCAGACTCACAGGG + Intergenic
1035770649 8:2144017-2144039 GGGTCTAACTCAATGTCACAGGG + Intronic
1036457563 8:8923458-8923480 GAGACTTACTCACTTTCACAAGG + Intergenic
1036547414 8:9785285-9785307 AGGAACTTCTCAAGGTCACATGG - Intergenic
1036770930 8:11577998-11578020 GTGAATTGCTCCAGGTCACAAGG + Intergenic
1037580291 8:20241391-20241413 AGGGCTTTCTAAAGGTCACACGG - Intergenic
1037588241 8:20292851-20292873 GGAACTTTCTCAGGGTCCCATGG - Intronic
1037723393 8:21463869-21463891 GAGACTTACTCACTATCACAAGG + Intergenic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1038240343 8:25802342-25802364 GTGACTTGCTTAAGGTCAAATGG + Intergenic
1038327868 8:26586225-26586247 GGTAGTGACTCAAGGTCACACGG - Intronic
1038688493 8:29740212-29740234 GGGAATTAGTCAAGGTCATATGG - Intergenic
1039417300 8:37406821-37406843 GTGATTTTCCCAAGGTCACATGG + Intergenic
1040906308 8:52472816-52472838 AGAACTTGCTCAAGGTCACATGG + Intergenic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041414282 8:57590168-57590190 GTGACTTGCTCAAAGTAACATGG - Intergenic
1041485161 8:58368463-58368485 GTGACTTTCTTAAGGTCACACGG - Intergenic
1042636127 8:70877460-70877482 GTGATTTACTCAAGATCACTTGG + Intergenic
1042923327 8:73941109-73941131 GAGACTTACTCACTATCACAAGG - Intronic
1042923424 8:73942197-73942219 GGGCCTTGTTCAAGGTCACATGG + Intronic
1043656327 8:82672913-82672935 AGGCCTTAATCAAAGTCACAAGG - Intergenic
1044356422 8:91227959-91227981 GGGACATTCTCAAGGCCACGAGG - Intronic
1045356211 8:101391448-101391470 GGAATTTACTCATGGTTACAAGG + Intergenic
1045439191 8:102192983-102193005 GTAACTCATTCAAGGTCACATGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1046540585 8:115576533-115576555 GTGACTCACCCAGGGTCACACGG + Intronic
1047199521 8:122753487-122753509 GTAACTTACCCAATGTCACACGG + Intergenic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1047562854 8:126008251-126008273 GGGACTGAATCCAGGTCAAAGGG + Intergenic
1047730662 8:127725299-127725321 GGGACTTGCTTAAACTCACACGG - Intergenic
1047837786 8:128713161-128713183 GTGACTTTTTCAAGGTCACTTGG - Intergenic
1047852699 8:128876165-128876187 GTGACTGTGTCAAGGTCACAAGG + Intergenic
1047942409 8:129838168-129838190 GAGACTTGCTCAAAGTCATACGG + Intergenic
1047976382 8:130134578-130134600 GTGACTTACACAAGGTCACACGG + Intronic
1048334075 8:133490235-133490257 GTGGCTTACTCCAGGTCACATGG + Intronic
1048363805 8:133720850-133720872 GGGTCTCATTCGAGGTCACAAGG + Intergenic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1048458418 8:134599491-134599513 GTGACTTGCCCAAGGCCACAGGG + Intronic
1048543058 8:135360605-135360627 GTTACTTGCCCAAGGTCACACGG - Intergenic
1048704606 8:137138914-137138936 TGGACTTGCTGATGGTCACAGGG + Intergenic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1049195620 8:141314127-141314149 GGGTCATACCCCAGGTCACATGG + Intergenic
1049220138 8:141425313-141425335 GTGACTTTCTTGAGGTCACACGG - Intronic
1051256428 9:15218310-15218332 GGGACATTGTGAAGGTCACAAGG - Intronic
1051427831 9:16951529-16951551 AGGACTTACTCAATGTGATAAGG - Intergenic
1052338383 9:27341772-27341794 GTGACTTGCCCAAGGTTACATGG + Intronic
1052361170 9:27560608-27560630 GTGACTTACTTAAAGTCAAATGG + Intronic
1052960419 9:34291390-34291412 GGGACTTGCCTAAGGTCATATGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1054878987 9:70125374-70125396 GAAACTTGTTCAAGGTCACAGGG + Intronic
1054892447 9:70266324-70266346 GATAATTGCTCAAGGTCACAAGG - Intronic
1054959817 9:70955585-70955607 GTGGTTTATTCAAGGTCACATGG + Intronic
1055058052 9:72041566-72041588 GGTCCTTGCCCAAGGTCACATGG + Intergenic
1055657378 9:78464866-78464888 GTGACTTGACCAAGGTCACAGGG + Intergenic
1055659787 9:78491354-78491376 AGGACTTACTCAATGTTACAGGG - Intergenic
1055765339 9:79657201-79657223 GGGACTTACTGTTGGGCACATGG - Intronic
1056068948 9:82965930-82965952 GTTATTTACTCAAGGTCACATGG - Intergenic
1056236060 9:84595860-84595882 TGGACTTGCTCAAGATAACATGG - Intergenic
1056411763 9:86335193-86335215 ATAACTTGCTCAAGGTCACAAGG + Intronic
1056438826 9:86599551-86599573 GTAACTTACCCAGGGTCACATGG + Intergenic
1057186542 9:93060280-93060302 GCGACTCACCCCAGGTCACAGGG - Intronic
1057329520 9:94100192-94100214 GTGACTTGCTCAGGGTCACGTGG + Intronic
1057695136 9:97317788-97317810 AGGGCTTGGTCAAGGTCACATGG - Intronic
1057802600 9:98199259-98199281 GGGACATGTCCAAGGTCACATGG + Exonic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1058872294 9:109213036-109213058 ATGACTTTCTCAAGGTCACACGG - Intronic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059332822 9:113546903-113546925 GCAATTTGCTCAAGGTCACACGG - Intronic
1059372578 9:113854672-113854694 AGGACTTACTCAAGGTCATATGG - Intergenic
1059544144 9:115159442-115159464 GCAACTTACACAAGTTCACATGG - Intronic
1059614157 9:115930792-115930814 GGGACTTGCTCTAGGTCACAGGG - Intergenic
1059659389 9:116386547-116386569 GGGACTTGCCCAAGTTCACTTGG + Intronic
1059781244 9:117530357-117530379 GTGACTTGCCCAAGGGCACACGG + Intergenic
1059911134 9:119045538-119045560 GTGACTTTCCCAAAGTCACACGG + Intergenic
1059963366 9:119589364-119589386 GGGATCTACTCAAGGTTACAGGG - Intergenic
1060025424 9:120166668-120166690 GTGACTTGGCCAAGGTCACAGGG - Intergenic
1060063356 9:120481450-120481472 GTAACTTGTTCAAGGTCACATGG - Intronic
1060118309 9:120964021-120964043 GGCACTGGTTCAAGGTCACATGG + Intronic
1060152322 9:121296606-121296628 GTGACTTGCCCAAGGTCACCAGG + Intronic
1060199745 9:121645522-121645544 GCGACTCACCCAAGGTCACATGG - Intronic
1060401020 9:123349715-123349737 GTGACTCACCCAAGGTCGCATGG - Intergenic
1060903484 9:127282507-127282529 GTGATTTTCCCAAGGTCACATGG + Intronic
1060978089 9:127777074-127777096 GAGACTTGCTTGAGGTCACACGG - Intronic
1060987107 9:127826028-127826050 GGGACTTGCACAGGGTCACTTGG - Intronic
1061006293 9:127930161-127930183 GTGACTTACCTAAGGTCACAAGG - Intronic
1061160649 9:128892132-128892154 GGGACTTTCTCACGGTCTCGTGG + Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061211392 9:129195431-129195453 GGCACTTGCTCAGGGTCACACGG + Intergenic
1061234849 9:129336440-129336462 GGGACTAACCCAAGATCACTGGG - Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061498594 9:130989839-130989861 GGGACTTACCGAGGGTCCCAGGG - Intergenic
1061510549 9:131058443-131058465 TGGCCTTGCTCAAGGTCACATGG + Intronic
1061663284 9:132145162-132145184 ATGACTCACCCAAGGTCACATGG + Intergenic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1061787154 9:133036519-133036541 GGTACTTACTCAAGAACACGGGG - Intronic
1062359132 9:136179123-136179145 GGGATTCACTCAAAGCCACAGGG + Intergenic
1062378850 9:136277132-136277154 GTGATTTGTTCAAGGTCACATGG - Intergenic
1185927790 X:4166472-4166494 GGGGCTTACTCAAGCTCAGGAGG - Intergenic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187435567 X:19265754-19265776 GAGACCTGCTCAAGCTCACATGG - Intergenic
1187444005 X:19344551-19344573 AAAACTTGCTCAAGGTCACAGGG - Intronic
1187828512 X:23357011-23357033 GTGACTTCCTCAAGGTCATCAGG + Intronic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1188072712 X:25736770-25736792 GTGATTCACCCAAGGTCACAGGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189257498 X:39651925-39651947 GGGACTTATTCAAGTTCACAAGG + Intergenic
1189367796 X:40402546-40402568 GTGACTTATCTAAGGTCACAGGG - Intergenic
1189977426 X:46476643-46476665 GTGAGTAACTCAAGGTCCCATGG + Intronic
1190116726 X:47630170-47630192 GTGACTCACCCAAGGTCACACGG - Exonic
1190969216 X:55332675-55332697 GTAACTTACTCAAGGTCCCATGG + Intergenic
1191678468 X:63816282-63816304 CTGACTTGCCCAAGGTCACACGG - Intergenic
1191721014 X:64228790-64228812 GGGACTTTGGTAAGGTCACATGG + Intronic
1191975914 X:66870729-66870751 GTGACTTGCCCAAGGTCATAAGG + Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192049964 X:67715673-67715695 CTGACTTACCCAAGGTCATATGG - Intronic
1192266600 X:69543064-69543086 AGAACTTGCCCAAGGTCACACGG + Intergenic
1192558512 X:72109345-72109367 TTGACTTGCCCAAGGTCACAGGG + Intergenic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1194655967 X:96573777-96573799 GTGACTTTCTCAAGGCCACAAGG - Intergenic
1194836211 X:98686127-98686149 GGGAGTTACTCACGGGAACAGGG - Intergenic
1195412601 X:104584254-104584276 GGGACATGCTCAAGGTTACAGGG + Intronic
1195460662 X:105120024-105120046 GTGACTTATCCAAGGTCACATGG + Intronic
1195671394 X:107473147-107473169 GTGACTTGCTCAGGGGCACATGG + Intergenic
1195702057 X:107712983-107713005 GTGACTTGCCCAAAGTCACATGG - Intergenic
1195740558 X:108060920-108060942 GGGACTGACTCATGGGCACTAGG + Intronic
1195862421 X:109396138-109396160 GTAACTTACCCGAGGTCACATGG + Intronic
1195981798 X:110586485-110586507 GTAACTTACTCGAGGTCACATGG - Intergenic
1196020670 X:110987532-110987554 GCAACTTACTCCAGGTCTCACGG - Intronic
1196607513 X:117672808-117672830 ATGACTTATCCAAGGTCACATGG - Intergenic
1196699283 X:118650133-118650155 GTGACTTGCTTAGGGTCACAGGG - Intronic
1196735476 X:118977603-118977625 GGCATTTTCTCAAGGTCACACGG - Intronic
1196811653 X:119633777-119633799 GTGTCTTACTCAAGGCCCCACGG + Intronic
1197627888 X:128823594-128823616 GTAACTTGCTCAAAGTCACAGGG + Intergenic
1197843636 X:130777150-130777172 GGGATTTATCTAAGGTCACATGG - Intronic
1197888567 X:131243424-131243446 GTGACTGTTTCAAGGTCACATGG - Intergenic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1198769057 X:140109040-140109062 GGGACTTGTTTAAGGTCATATGG + Intergenic
1198968798 X:142256388-142256410 GTAACTTAGTCAATGTCACAAGG - Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199434793 X:147801521-147801543 GTAACTTGCTCAGGGTCACAGGG + Intergenic
1199504239 X:148543509-148543531 GTGACTTGCCCAAGGCCACAGGG + Intronic
1199713698 X:150490967-150490989 GGGACTTTCTCAAGTTCACACGG + Intronic
1199802966 X:151269584-151269606 GTGACTCACCCAAGGCCACAGGG - Intergenic
1199811445 X:151353774-151353796 GTAACTTACCCAAGGTCACACGG - Intergenic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic
1200070819 X:153528276-153528298 AGAGCCTACTCAAGGTCACACGG - Intronic