ID: 984970818

View in Genome Browser
Species Human (GRCh38)
Location 4:185188261-185188283
Sequence CTTTGAAGGCTGAGGCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1132
Summary {0: 1, 1: 0, 2: 20, 3: 129, 4: 982}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984970818_984970824 -7 Left 984970818 4:185188261-185188283 CCCTCTAGCCTCAGCCTTCAAAG 0: 1
1: 0
2: 20
3: 129
4: 982
Right 984970824 4:185188277-185188299 TTCAAAGTAGCTGGGATTATAGG 0: 2
1: 279
2: 9132
3: 86662
4: 245826
984970818_984970825 12 Left 984970818 4:185188261-185188283 CCCTCTAGCCTCAGCCTTCAAAG 0: 1
1: 0
2: 20
3: 129
4: 982
Right 984970825 4:185188296-185188318 TAGGTATGTGCCACCACACCTGG 0: 22
1: 781
2: 9339
3: 38543
4: 101260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984970818 Original CRISPR CTTTGAAGGCTGAGGCTAGA GGG (reversed) Intronic
900954346 1:5877498-5877520 ATTTGAAGGCTGAGGAAAGGAGG - Intronic
901105268 1:6750934-6750956 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
901254165 1:7806684-7806706 CTTAGGAGGCTGAGGCAAGAGGG + Intronic
901351054 1:8597194-8597216 CTTAGGAGGCTGAGGCCAGAGGG - Intronic
901475179 1:9484599-9484621 TTTGGGAGGCTGAGGCTAGAGGG + Intergenic
902113584 1:14103022-14103044 CTTGGGAGGCTGAGGCATGAAGG - Intergenic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
903333650 1:22610713-22610735 CTTAGGAGGCTGAGGCAGGAAGG + Intergenic
903539754 1:24090262-24090284 CTGAGAAAGCTGAGGCCAGAGGG - Intronic
903988155 1:27244447-27244469 CTAGGAAGGCTGAGGCAGGAGGG - Intronic
904020147 1:27457726-27457748 CTCAGGAGGCTGAGGCAAGAGGG - Intronic
904161125 1:28522705-28522727 CTCTGGAGGCTGAGGCAGGAGGG + Intronic
904721133 1:32509523-32509545 CTTGGGAGGCTGAGGTTAGTTGG - Intronic
904866747 1:33585352-33585374 CTCTGAAGGCAGAGGTGAGATGG - Intronic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
905131581 1:35764040-35764062 TTTGGGAGGCTGAGGCCAGAGGG - Intronic
905149776 1:35918661-35918683 CTTGGGAGGCTGAGGCGGGAAGG - Intronic
905350310 1:37341211-37341233 CTGTGATGGCTCAAGCTAGATGG - Intergenic
905436288 1:37957572-37957594 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
905699079 1:39998505-39998527 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
905763437 1:40580330-40580352 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
906207375 1:43994336-43994358 CTTGGGAGGCTGAGGTGAGAAGG + Intronic
906394126 1:45445685-45445707 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
906483339 1:46215787-46215809 CTTAGGAGGCTGAGGCAGGAGGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906972648 1:50533177-50533199 CTTGGAGAGCTGAGGCTACAGGG - Intronic
907189904 1:52639894-52639916 CTCAGGAGGCTGAGGCGAGAGGG - Intronic
907309421 1:53530760-53530782 CTTTGAAGGCTGAGGGAGGTTGG - Intronic
907346613 1:53786936-53786958 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
907367760 1:53976731-53976753 CTTTGAGAGCTGAGGCCAGGAGG - Intergenic
907441769 1:54483171-54483193 CTCGGGAGGCTGAGGCGAGAGGG - Intergenic
908197417 1:61758866-61758888 CTTTGGAGGCTGAGGCCAGAGGG - Intronic
908315942 1:62932593-62932615 TTTAGGAGGCTGAGGCTGGAGGG - Intergenic
908539408 1:65108433-65108455 CTCAGAAGGCTGAGGCTAGAGGG + Intergenic
908598478 1:65712757-65712779 CTTGGTAGGCTGAGGCAGGAAGG + Intergenic
908725832 1:67175931-67175953 CTTGGGAGGCTGAGGCTGGAAGG - Intronic
908876012 1:68676670-68676692 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
909447226 1:75760450-75760472 CTTTGGGGGCTGAGGCGGGAGGG + Intronic
909636662 1:77824316-77824338 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
909838267 1:80285432-80285454 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
910254504 1:85234447-85234469 CTCAGGAGGCTGAGGCAAGAGGG - Intergenic
910820072 1:91336455-91336477 CTTTGAAGGATAGGGATAGAGGG - Intronic
910882955 1:91938947-91938969 CTTGGAAGGCTGAGGTTGGAGGG + Intergenic
911301590 1:96181138-96181160 CTTTGGAGGCTGAGGTGGGAGGG - Intergenic
911392207 1:97259478-97259500 CTTAGGAGGCTGAGGCAGGAGGG - Intronic
911607729 1:99927577-99927599 TTTGGGAGGCTGAGGCTAGAGGG - Intergenic
911615302 1:100004407-100004429 CTTGGGAGGCTGAGGGAAGATGG - Intronic
911702134 1:100966118-100966140 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
912236494 1:107856929-107856951 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
912262244 1:108121764-108121786 CTCGGAAGGCTGAGGCAGGAGGG - Intergenic
912629680 1:111235928-111235950 CTTTGAATGATGCTGCTAGAAGG - Intronic
914209927 1:145568039-145568061 TTTGGAAGGCTGTGGCAAGAGGG + Intergenic
914819844 1:151092494-151092516 TTTGGAAGGCTGAGGATGGAAGG - Intronic
914821734 1:151109775-151109797 CTTGGGAGGCTGAGGTGAGAAGG - Intronic
914848731 1:151298003-151298025 CTTAGAAGGCAGGGCCTAGATGG + Intronic
915199519 1:154216620-154216642 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915208183 1:154286622-154286644 CTTCGGAGGCTGAGGCGGGAGGG + Intergenic
915226530 1:154415869-154415891 CTCCGGAGGCTGAGGCAAGAGGG + Intronic
915305828 1:154977486-154977508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915527596 1:156485625-156485647 CTTGGGAGGCTGAGGCTGGAAGG - Intronic
915630860 1:157153478-157153500 ATTTGAAGGCTGAGGAAGGAAGG - Intergenic
916139790 1:161685566-161685588 CTTGGAAGGCTGAGGTCGGAGGG + Intergenic
916540979 1:165753701-165753723 CTTGGGAGGCTGAGACAAGAGGG + Intronic
916741056 1:167647343-167647365 CTTTGAAGGCTGAGGCAGGGTGG + Intronic
916830123 1:168482275-168482297 CATGGCAGGCTGAGGGTAGATGG + Intergenic
916966905 1:169956838-169956860 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
917283683 1:173403092-173403114 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
918374567 1:183896291-183896313 CTCAGAAGGCTGAGGCAGGAGGG - Intronic
918524534 1:185451182-185451204 CTGTGAAGGGAGAGGCTAGGGGG + Intergenic
919284760 1:195542123-195542145 CTCTGGAAGCTGAGGCCAGACGG + Intergenic
919427230 1:197447739-197447761 CTAAGGAGGCTGAGGCTAGGTGG + Intronic
920105993 1:203554010-203554032 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
920831833 1:209472443-209472465 CTCTGAATGCTAAGGATAGATGG - Intergenic
921233783 1:213102328-213102350 CTCAGGAGGCTGAGGCCAGAAGG - Intronic
921388966 1:214600214-214600236 CTTTGGGGGCTGAGGCTGGTGGG + Intergenic
921570177 1:216768595-216768617 CTGAGGAGGCTGAGGCAAGAGGG - Intronic
922042272 1:221908095-221908117 CCTTGGAGGCTGAGGCCGGAGGG + Intergenic
922281064 1:224124833-224124855 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
922653554 1:227361400-227361422 CTTGGAAGGCTGAGGCAAGGAGG - Intergenic
922810317 1:228411732-228411754 CTTGGAAGGCTGAGGTGGGAGGG - Intronic
922812828 1:228427206-228427228 CTTGGGAGGCTGAGGTAAGAGGG - Intergenic
923134332 1:231104818-231104840 TTTGGGAGGCTGAGGCTGGAGGG + Intergenic
923695412 1:236245095-236245117 CTTGGGAGGCTGAGGATAGAAGG - Intronic
924045824 1:240029543-240029565 CTTGGAAGGCTGAGGTAGGAGGG - Intronic
924244685 1:242072883-242072905 CTCAGGAGGCTGAGGCTGGAGGG - Intergenic
924460974 1:244258296-244258318 TTTGGGAGGCTGAGGCAAGAGGG + Intergenic
924712276 1:246539509-246539531 CTTGGAAGGTTGAGGCAGGAGGG - Intergenic
924765858 1:247031807-247031829 CTTGGGAGGCTGAGGCTGGCGGG - Intergenic
1063406033 10:5796105-5796127 CTTGGGAGGCTGAGGCGAGCAGG + Intronic
1063911522 10:10835331-10835353 CTGGGAAGACTGAGGCCAGAGGG - Intergenic
1064334180 10:14423452-14423474 CTTTGAAGGGTGAGAATAAATGG - Intronic
1064365741 10:14706333-14706355 CTTGGGGGGCTGAGGCAAGAGGG - Intronic
1064701709 10:18028825-18028847 CTCGGGAGGCTGAGGCTGGAGGG - Intronic
1065042497 10:21711636-21711658 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065096718 10:22287810-22287832 CTTGGAAGGCTGAAGGCAGAAGG + Intergenic
1065116685 10:22490020-22490042 CTTTGAAGGCCAAGGCGGGAAGG - Intergenic
1065126784 10:22581486-22581508 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065353479 10:24816465-24816487 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1065480071 10:26183976-26183998 CTCGGAAGGCTGAGGTGAGAGGG + Intronic
1065520869 10:26570580-26570602 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
1065551347 10:26871286-26871308 CTTGGGAGGCTGAGGCAAAATGG - Intergenic
1065737213 10:28765045-28765067 CTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1065821365 10:29528628-29528650 CTTGGGAGGCTGAGGTTGGAGGG + Intronic
1065949440 10:30638611-30638633 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1065972346 10:30815619-30815641 CTGTGAAAGCAGAGGCTCGAGGG - Intergenic
1066018299 10:31270270-31270292 CTTGGGAGGCTGAGGCAAGGAGG + Intergenic
1066275759 10:33866682-33866704 CTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1066359342 10:34715183-34715205 CTTGGAAGGCTGAGGCAGGTGGG - Intronic
1066596373 10:37054625-37054647 CTTGGGAGACTGAGGCAAGAAGG + Intergenic
1067012554 10:42727993-42728015 TTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1067311037 10:45113895-45113917 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1067454874 10:46412241-46412263 CTTTGAAGATTGAGCCCAGAGGG + Intergenic
1067465882 10:46498442-46498464 CTTTGAAAGCTGAAGCCAGCTGG + Intergenic
1067514492 10:46926062-46926084 ATTTGAAGTCTGAGTCTTGAGGG + Intronic
1067621305 10:47886164-47886186 CTTTGAAAGCTGAAGCCAGCTGG - Intergenic
1067632329 10:47972393-47972415 CTTTGAAGATTGAGCCCAGAGGG - Intergenic
1067647768 10:48125751-48125773 ATTTGAAGTCTGAGTCTTGAGGG - Intergenic
1068547001 10:58358866-58358888 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1069036594 10:63651899-63651921 CTTTGGCGGCTGAGGCACGAGGG + Intergenic
1069238234 10:66105108-66105130 CATTGAAGGCTTTGGCGAGAGGG - Intronic
1069626384 10:69870418-69870440 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1069647556 10:70014008-70014030 CTCAGGAGGCTGAGGCAAGAGGG + Intergenic
1069699507 10:70411695-70411717 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1069808999 10:71144704-71144726 CTCTGAGGCCTGTGGCTAGAAGG - Intergenic
1070113572 10:73507881-73507903 CTCGGAAGGCTGAGGCAGGAGGG + Intronic
1070226837 10:74516629-74516651 CTTGGGAGGCTGAGGCTACTTGG - Intronic
1070236794 10:74635978-74636000 CTCAGAAGGCTGAGGCAAGGAGG + Intronic
1070949253 10:80417948-80417970 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1071237427 10:83665415-83665437 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1071682937 10:87725801-87725823 CTCAGGAGGCTGAGGCAAGAGGG - Intronic
1072075095 10:91963204-91963226 CTTAGGAGGCTGAGGCAGGAAGG - Intronic
1072107586 10:92289431-92289453 CTTGGGAAGCTGAGGCTAGAAGG + Intronic
1072262326 10:93691281-93691303 CTTGGGAGGCTGAGGTTAGAAGG - Intronic
1072352475 10:94570385-94570407 ATTATAAGGCTGAGGCTAAAAGG - Intronic
1072422160 10:95297965-95297987 AGTTGAAGGCAGAGGCTAGGTGG - Intergenic
1072458593 10:95599220-95599242 CTTAGGAGGCTGAGGCGGGAGGG - Intergenic
1072597225 10:96885487-96885509 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1072833570 10:98686507-98686529 CTTAGAAGGCTGAGGTAGGAGGG - Intronic
1072838236 10:98740281-98740303 CTTGGGAGACTGAGGCTGGAGGG - Intronic
1073098858 10:100996920-100996942 CTGTGAAGTCAGAGGCCAGAGGG + Intronic
1073104474 10:101024349-101024371 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1073159911 10:101383605-101383627 TTTAGAAGGCTGAGGCGAGAGGG - Intronic
1073439159 10:103542365-103542387 CTTGGAAGGCTGAGATGAGAGGG - Intronic
1073575498 10:104619263-104619285 CTTGGGAGGCTGTGGCAAGAGGG + Intergenic
1073834454 10:107425188-107425210 CTCAGGAGGCTGAGGCCAGACGG + Intergenic
1074196594 10:111192525-111192547 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1074748346 10:116558300-116558322 CTTGGGAGGCTGAGGCAGGATGG - Intronic
1074775838 10:116767518-116767540 CCTTGCTGGCTGAGGCTAGTGGG - Intergenic
1075046531 10:119150559-119150581 CTCAGAAGGCTGAGGCAGGAGGG + Intronic
1075403406 10:122177459-122177481 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1075743726 10:124711953-124711975 CTCAGAAGTCTGAGGCAAGATGG + Intronic
1075888447 10:125923633-125923655 CTTGGGAGGCTGAAGCAAGAGGG - Intronic
1076025270 10:127107063-127107085 CTTTGAAGGCAGAGGCGGGAGGG - Intronic
1076701405 10:132275150-132275172 CTGTCAGGGCTGAGGCCAGACGG - Intronic
1077519486 11:3023500-3023522 CTCAGAAGGCTGAGGTAAGAGGG - Intronic
1077669987 11:4148333-4148355 CCTGGGAGGCTGAGGCAAGAGGG - Intergenic
1079043790 11:17082049-17082071 TTTGGAAGGCTGAGGCTGGAGGG - Intronic
1079398322 11:20085084-20085106 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1079497887 11:21066844-21066866 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1079849241 11:25510281-25510303 CTTTGAAGGGTTATGCAAGAGGG + Intergenic
1080615629 11:33942524-33942546 CTTGGAAGACTGAGGCAGGAAGG + Intergenic
1081551333 11:44115295-44115317 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1082039793 11:47675494-47675516 CTTGGGAGGCTGAGGCGGGAGGG - Intronic
1082046066 11:47728642-47728664 CTTGGAAGGCTGAGGTGGGAAGG - Intronic
1082270102 11:50161036-50161058 CTTTGAAAGGTGAGGCGATATGG - Intergenic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1082858520 11:57831109-57831131 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1082917719 11:58455953-58455975 CTAGGAAGGCTGAGGCAGGAGGG + Intergenic
1083013267 11:59424477-59424499 CTTGGAAGGCTGAGGTGAGGGGG + Intergenic
1083422686 11:62564040-62564062 CTTGGCAGGCTGAGGTGAGAGGG - Intronic
1083798756 11:65034311-65034333 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
1083809026 11:65092440-65092462 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
1084057813 11:66648276-66648298 TTTTGGAGGCTGAGGCAAGCAGG + Intronic
1085356027 11:75837906-75837928 CTTTGGAGGCTGAAGCAGGAGGG + Intronic
1085520316 11:77134573-77134595 CTTAGGAGGCTGAGGCAGGAGGG - Intronic
1085674151 11:78499371-78499393 CTTGGAAGCCTGAGGCAGGAGGG - Intronic
1085893341 11:80607526-80607548 CTTGGGAGACTGAGGCAAGAAGG - Intergenic
1086383375 11:86283024-86283046 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1086467474 11:87070062-87070084 CTTGGGAGGCTGAGGCCAGGAGG + Intronic
1087392817 11:97560206-97560228 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1087802344 11:102517903-102517925 CTTGGAAGGCTGAGGTGGGAGGG - Intergenic
1088214846 11:107496602-107496624 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1088273052 11:108055550-108055572 CTTAGGAGGCTGAGGCAGGAGGG - Intronic
1088419974 11:109635422-109635444 CTCTGAAGACTAAGGCTACAAGG - Intergenic
1088453887 11:110013506-110013528 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1088818976 11:113441050-113441072 CTTTGATGGCTGTGGCAAGAAGG + Intronic
1088919582 11:114251328-114251350 CTCAGAAGGCTGAGGGTAGGAGG - Intergenic
1089203044 11:116736574-116736596 CTCAGGAGGCTGAGGCAAGAAGG + Intergenic
1089516442 11:119035278-119035300 TTTGGAAGGCTGAGGTGAGAGGG + Intergenic
1089517648 11:119043965-119043987 CTTGGGAGACTGAGGCTGGAGGG - Intergenic
1089955523 11:122567637-122567659 CTCGGAAGGCTGAGGTGAGAGGG + Intergenic
1090078870 11:123597332-123597354 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1090405798 11:126475270-126475292 CCATGCAGGCTGAGGCTGGAAGG - Intronic
1090477020 11:127032291-127032313 CTTGGGAGGCTGAGGCGGGAGGG + Intergenic
1090854461 11:130599326-130599348 CTTTGATGGCTGGGGCCAAAGGG + Intergenic
1091569137 12:1669369-1669391 CTCTGCTGGCTGAGGCTGGAGGG - Intergenic
1091682289 12:2535596-2535618 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1091723696 12:2831222-2831244 CATTGAAGGATGAGGTCAGAGGG - Intronic
1091853633 12:3721289-3721311 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
1092377542 12:7968307-7968329 CTCTGAAGGCAGAGGCAGGAAGG + Intergenic
1092515279 12:9204987-9205009 CTCAGGAGGCTGAGGCAAGAAGG + Intronic
1092570480 12:9715995-9716017 CTTTGAAGGCAGAAGATACAAGG - Intronic
1092607377 12:10135383-10135405 CTTGGGAGGCTGAGGTGAGAGGG + Intergenic
1092624315 12:10310225-10310247 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1093281498 12:17201908-17201930 CTTAGGAGGCTGAGGCAGGAAGG + Intergenic
1093443027 12:19222012-19222034 CTCAGGAGGCTGAGGTTAGAAGG + Intronic
1093543045 12:20310407-20310429 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1093564207 12:20582434-20582456 CTTGGAAGGCTGAGGCGGGCAGG - Intronic
1094293413 12:28877206-28877228 GTTTGAAGGCAGAAGCCAGATGG - Intergenic
1094365576 12:29676603-29676625 GTTTGAAGGCAGAGTGTAGATGG - Intronic
1094616283 12:32039173-32039195 CTTGGAAGGCTGAGGAGAGAGGG - Intergenic
1094820576 12:34221000-34221022 CTTGGGAGGCTGAGCCTGGAGGG - Intergenic
1095203390 12:39411632-39411654 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1095417275 12:41990579-41990601 CCTGGGAGGCTGAGGCCAGAGGG - Intergenic
1095470178 12:42528186-42528208 CTTTGGAGGCTGAGGTGGGAGGG - Intronic
1095616389 12:44194721-44194743 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1096268421 12:50143501-50143523 TTTTGAAGGCTGAGGGCCGAAGG + Intronic
1096332544 12:50726741-50726763 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1096348995 12:50878468-50878490 CTTGGAAGGTTGAGGCAAGAAGG + Intronic
1096390953 12:51228785-51228807 CTTGAGAGGCTGAGGCAAGAGGG - Intergenic
1096416293 12:51417281-51417303 CTCAGAAGGCTGAGGCAGGAGGG - Intronic
1096581669 12:52589653-52589675 CTTTGATGGAGGAGGCCAGAAGG + Intronic
1096664623 12:53155012-53155034 TTTGGAAGGTTGAGGCTGGAAGG + Intergenic
1096723338 12:53540837-53540859 CTTAGGAGGCTGAGCCTAGGAGG - Intronic
1096724299 12:53548738-53548760 TTTGGAAGGCTGAGGCAAGAGGG + Intronic
1096819426 12:54222187-54222209 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1097116493 12:56701264-56701286 CTTGGGAGGCTGAGGCTGGAAGG - Intergenic
1098329887 12:69342059-69342081 CTCTGGAGGCTGAGGCAGGAGGG + Intergenic
1098459514 12:70716737-70716759 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1099172383 12:79380500-79380522 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1100485526 12:95022800-95022822 CTTGGGAGGCTGAGGCGGGAAGG - Intronic
1100922319 12:99502032-99502054 TTTTGAATGCTGAGGATACAAGG - Intronic
1101632820 12:106512125-106512147 CTCAGGAGGCTGAGGCGAGAAGG + Intronic
1101960151 12:109242855-109242877 ACTTGAAGGCTGAGGCAGGAAGG + Intronic
1102304116 12:111791792-111791814 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1102335995 12:112080606-112080628 CTCTGGAGGCTGAGGCAGGAGGG - Intronic
1102434375 12:112909414-112909436 TTTTGGAGGCTGAGGCAGGAGGG + Intronic
1102490098 12:113285478-113285500 CTTGGGAGGCTGAGGCTACTCGG - Intronic
1102671651 12:114624367-114624389 CTTGGAAGGCTGAGGTGGGAGGG + Intergenic
1102694757 12:114790193-114790215 CTTGAGAGGCTGAGGTTAGAAGG - Intergenic
1102867479 12:116385679-116385701 CTTTGGAGGCTGAGGCGGGTGGG - Intergenic
1102879387 12:116472612-116472634 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1102978221 12:117221751-117221773 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1103092544 12:118107591-118107613 CTTGAAAGGCTGAGGCAGGAGGG + Intronic
1103110660 12:118275244-118275266 ATTGGAAGGCTGAGACAAGAGGG - Intronic
1103460609 12:121101800-121101822 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1104007306 12:124902676-124902698 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1105208553 13:18243279-18243301 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1105220098 13:18317738-18317760 CTTGGGAGGCTGAAGCAAGAGGG + Intergenic
1105392814 13:19996776-19996798 CTTGGGAGGCTGAAGCTGGAAGG + Intronic
1105591681 13:21798265-21798287 CTCACAAGGCTGAGGCCAGAGGG + Intergenic
1105796346 13:23857460-23857482 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1106234187 13:27847864-27847886 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1106270595 13:28149721-28149743 CTAAGGAGGCTGAGGCAAGAGGG - Intronic
1106288857 13:28342289-28342311 CTTTGAAGGCTGTAGCTGGAAGG - Intronic
1106524807 13:30530937-30530959 CTCAGAAGGCTGAGGTGAGAAGG + Intronic
1108025125 13:46169690-46169712 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1108073466 13:46653721-46653743 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
1108386368 13:49903030-49903052 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
1108584657 13:51859998-51860020 CTTGGAAGGCTGAGGAAGGAAGG - Intergenic
1108641653 13:52388031-52388053 GTTTGAAGGCTGTGGCTGAAGGG + Intronic
1108838951 13:54587650-54587672 CTATGAATACTGAGGATAGAAGG + Intergenic
1109151112 13:58848252-58848274 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1109340599 13:61053343-61053365 CTCTGCAGGCTGAGGCAGGAAGG - Intergenic
1110053932 13:70940834-70940856 CTTTGAAGGCTGAGGGTGGGAGG + Intergenic
1110133912 13:72042190-72042212 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
1110369232 13:74720977-74720999 CTTTGAAGGTTGAAGATTGAAGG + Intergenic
1110465166 13:75792074-75792096 CTTGGGAGGCTGAGGGCAGAAGG - Intronic
1110666864 13:78127216-78127238 CTTTTAAGGCTGTAGGTAGAGGG + Intergenic
1110848174 13:80213381-80213403 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1111571915 13:90100060-90100082 CTTGGAAGGCTGAGGTAGGAGGG + Intergenic
1111802633 13:92998971-92998993 GTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1111915569 13:94356792-94356814 CTTGGAAGGTTGAGGCGGGAGGG + Intronic
1112036500 13:95501419-95501441 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1112173630 13:96999096-96999118 CTTGGGAGGCTGAGGCGAGAGGG + Intergenic
1112277562 13:98035484-98035506 CTTGAGAGGCTGAGGCGAGAAGG + Intergenic
1112351546 13:98639099-98639121 TTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1112994104 13:105551440-105551462 CTCAGGAGGCTGAGGCAAGAAGG + Intergenic
1112999817 13:105621329-105621351 CTTTGAAAGCTGAGGACAGGAGG - Intergenic
1113567850 13:111329442-111329464 CTCTGAAGGCTCAGTCTAGCGGG - Intronic
1114161216 14:20169875-20169897 CTCAGGAGGCTGAGGCTAGAGGG - Intergenic
1114287761 14:21261068-21261090 ATTGGAAGGCTGAGGCAGGAGGG - Intronic
1114390344 14:22301545-22301567 CTTTCAAGGCTGTGGAAAGAAGG + Intergenic
1114423008 14:22600311-22600333 CTTGAAAAGCTGAGGCTGGAAGG + Intronic
1114446467 14:22792453-22792475 CTTGGAAGGCTGAGGTGGGAAGG + Intronic
1114707908 14:24746162-24746184 CTTTTAAAGCTAGGGCTAGAGGG - Intergenic
1114770212 14:25422155-25422177 CTTCGAAGGCTGAGGCCAGAGGG - Intergenic
1115228125 14:31126788-31126810 CTGAGAAGGCTGAGGTGAGAGGG - Intronic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1115534112 14:34356581-34356603 CTTACAATTCTGAGGCTAGAAGG - Intronic
1117696649 14:58371171-58371193 CTTGGAAGGCTGAGGCAGGAGGG + Intronic
1118022083 14:61727778-61727800 TTTGGAAGGCTGAGGCAAGCGGG + Intronic
1118213364 14:63786298-63786320 CTCAGGAGGCTGAGGCAAGAGGG + Intergenic
1118633008 14:67723339-67723361 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118715828 14:68559486-68559508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118765506 14:68906878-68906900 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1119303050 14:73585895-73585917 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1119312090 14:73656666-73656688 CATGGGAGGCTGAGGCAAGAGGG - Intronic
1119363028 14:74067678-74067700 TTTGGAAGGCTGAGGTGAGAAGG + Intronic
1119456258 14:74758289-74758311 CTTGGGAGGATGAGGCGAGAGGG + Intergenic
1119458679 14:74779748-74779770 CTTGGAAGGCTGAGGCAAGGAGG - Intronic
1119524654 14:75312754-75312776 CTTGGGAGGCTGAGGCAAGCAGG + Intergenic
1119653863 14:76402774-76402796 CTTAGGAGGCTGAGGCAGGAGGG - Intronic
1119945067 14:78684684-78684706 CTTAGGAGGCTGAGGCAGGAGGG + Intronic
1120002842 14:79323139-79323161 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1120644907 14:87062550-87062572 CTTTGAAGACTATGGCTAGAGGG - Intergenic
1120785840 14:88534764-88534786 CTTGGGAGGCTGAGGCTACTTGG + Intronic
1120791123 14:88583358-88583380 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1120911420 14:89670201-89670223 CTCAGGAGGCTGAGGCCAGAGGG + Intergenic
1121064007 14:90944371-90944393 TTTGGAAGGCTGAGGCAGGAGGG + Intronic
1121079671 14:91097286-91097308 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
1121100091 14:91244587-91244609 GTTTGAAGGCAGAGCCTAGCTGG - Intronic
1121365654 14:93307258-93307280 CTTGGGAGGCTGAGGCTTGGAGG - Intronic
1121600004 14:95196255-95196277 GTTTGAAGACTGAGGAGAGAAGG + Intronic
1121631462 14:95424072-95424094 GTTTTAGGACTGAGGCTAGAAGG + Intronic
1121769576 14:96521596-96521618 CTTGGGAGGCTGAGGCCAGGAGG - Intronic
1121777327 14:96599190-96599212 CTCTGAAGGCAGAGCCAAGAGGG + Intergenic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122425656 14:101603760-101603782 TTTGGAAGGCTGAGGAGAGAGGG + Intergenic
1123681187 15:22765437-22765459 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1123914505 15:25008865-25008887 CTCAGAAGGCTGAGGCAAGAGGG - Intergenic
1124188039 15:27547015-27547037 TTTTGGAGGCTGAGGCTGGGAGG - Intergenic
1124333400 15:28839899-28839921 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1124464584 15:29925359-29925381 CTTTGAGGACTGAGGACAGAGGG + Intronic
1125019380 15:34969737-34969759 CTCTGAAGGCTGAGGATATCCGG - Exonic
1125431467 15:39599031-39599053 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
1125783849 15:42297403-42297425 CTTGGGAGGCTGAGGCTAGAGGG - Intronic
1125848308 15:42879752-42879774 CTTGGGAGGCTAAGGCAAGAGGG + Intronic
1125987871 15:44073024-44073046 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1125992932 15:44127762-44127784 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1126121873 15:45260652-45260674 CTCAGAAGGCTGAGGCAGGAGGG + Intronic
1126752976 15:51895998-51896020 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1127103815 15:55592321-55592343 CTTACAAGGCAGAAGCTAGAAGG + Intergenic
1127184843 15:56467247-56467269 CTTGGGAGACTGAGGCAAGAAGG + Intergenic
1127285808 15:57532797-57532819 CTTTTAGGGCTGAGGCTCTAAGG - Intronic
1127560655 15:60133022-60133044 CTTTGAGGGATGTGGCAAGAGGG + Intergenic
1127798616 15:62458659-62458681 CTTTGGAGGCTGAGGTGGGAGGG + Intronic
1127880150 15:63149964-63149986 CTCGGGAGGCTGAGGCCAGAGGG + Exonic
1128071032 15:64797360-64797382 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1128641969 15:69345823-69345845 CTTGGGAAGCTGAGGCGAGAAGG + Intronic
1129006607 15:72378909-72378931 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1129289616 15:74554408-74554430 CTTGGGAGGCTGAGGCGGGAGGG - Intronic
1129294750 15:74593932-74593954 CTTGGGAGGCTGAGGCCAGGAGG + Intronic
1129509861 15:76113460-76113482 CTTAAAAGGCTGGGGCCAGATGG + Intronic
1129764635 15:78154619-78154641 CTCAGGAGGCTGAGGCAAGAGGG + Intronic
1130136678 15:81187485-81187507 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1130180636 15:81624309-81624331 CTTGGAAGGCTGAGGCGAGAAGG - Intergenic
1130682283 15:86007175-86007197 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
1130701893 15:86191991-86192013 CTTAGGAGGCTGAGGTTGGAGGG + Intronic
1130936525 15:88475563-88475585 CTTGGGAGGCTGAGGCTGGATGG + Intronic
1131352370 15:91712954-91712976 GTTTTAAAGCTGAGGCTAAAAGG - Intergenic
1131416184 15:92260646-92260668 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1132203425 15:99970578-99970600 CTCAGGAGGCTGAGGCAAGAAGG - Intergenic
1132351818 15:101144218-101144240 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1132461530 16:57716-57738 CCCTAAAGGCTGAGGCTGGAGGG - Intergenic
1132811682 16:1802160-1802182 TTTGGGAGGCTGAGGCTGGAGGG + Intronic
1132839203 16:1970485-1970507 CTCTGGAGGCTGAGGTGAGAGGG - Intergenic
1133072852 16:3257928-3257950 CTTGGGAGGCTGAGGTTGGAGGG - Intergenic
1133190315 16:4128979-4129001 CTTGGGAGGCTGAGGTTGGAAGG - Intergenic
1133213648 16:4277245-4277267 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1133291337 16:4723528-4723550 TTTGGGAGGCTGAGGCCAGAGGG - Intronic
1133342835 16:5048134-5048156 CTTGGTAGGCTGAGGCAGGAAGG - Intronic
1133556950 16:6914764-6914786 CTTTGAAGGCTGAAGCAAGGAGG + Intronic
1133720751 16:8492147-8492169 CTTTGAAGAATGAGACTTGAAGG - Intergenic
1134002957 16:10796945-10796967 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1134237940 16:12482407-12482429 CTTGGGAGGCTGAAGCAAGAGGG - Intronic
1134646582 16:15872591-15872613 CTTGGGAAGCTGAGGCAAGAAGG + Intronic
1135379705 16:21985220-21985242 CTTTGGAAGCAGAGGCCAGAGGG - Intronic
1135386805 16:22049306-22049328 CTCAGAAGGCTGAGGCAAGAAGG - Intronic
1135633435 16:24054217-24054239 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1135815805 16:25632349-25632371 CTTTTGAGGCTGAGGAAAGAAGG + Intergenic
1136251865 16:29010652-29010674 CTTGGAAAGCTGAGGCAGGAGGG + Intergenic
1136372528 16:29845309-29845331 CATGGAAGGGGGAGGCTAGAAGG - Intronic
1136376391 16:29867980-29868002 CCTTGCTGGCTGAGGCTGGAGGG - Intergenic
1136463368 16:30425699-30425721 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1136670432 16:31851666-31851688 CTTGGAAGATGGAGGCTAGATGG - Intergenic
1136872189 16:33817367-33817389 CTTGGAAGGTTGAGGCTTGAGGG + Intergenic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1137716417 16:50601117-50601139 CTGCGGAGGCTGAGGCGAGAGGG - Intronic
1138148546 16:54634330-54634352 TTTGGGAGGCTGAGGCCAGAGGG + Intergenic
1138398654 16:56728107-56728129 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1138447513 16:57073699-57073721 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1138891673 16:61150489-61150511 CTTTGGAGGCTCAGTCTCGATGG + Intergenic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1139407853 16:66733595-66733617 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1139591009 16:67932946-67932968 CTCAGAAGGCTGAGGCAGGAGGG + Intronic
1139622122 16:68154022-68154044 CTTAGAAGGCTGAGGTGGGAGGG - Intronic
1139787018 16:69401587-69401609 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1139961085 16:70717752-70717774 CTCAGGAGGCTGAGGCGAGAGGG - Intronic
1140807571 16:78547018-78547040 CTTGGGAGGCTGAGGTTCGAGGG + Intronic
1140971731 16:80020017-80020039 CTTTTAAGGCTGAGGATTCAAGG + Intergenic
1141064932 16:80906772-80906794 CTCAGAAGGCTGAGGTGAGAGGG - Intergenic
1141183189 16:81768671-81768693 CTCGGAAGGCTGAGGCAGGAGGG - Intronic
1141431270 16:83971404-83971426 CTTGCCAGGCTGAGGCTCGAAGG - Intronic
1141584373 16:85023724-85023746 CTTGGAAGCCTGAGGTTAGAGGG - Intergenic
1141588604 16:85051894-85051916 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
1142154982 16:88528809-88528831 CTTAGGAGGCTGAGGCAGGATGG - Intronic
1142332980 16:89467468-89467490 CTTGGGAGGCTGAGGCTGGATGG - Intronic
1142345172 16:89549414-89549436 CTTTGGGGGCTGAGGCAGGAGGG + Intronic
1203099983 16_KI270728v1_random:1298701-1298723 CTTGGAAGGTTGAGGCTTGAGGG - Intergenic
1142798304 17:2326742-2326764 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1142826650 17:2516713-2516735 CTTGGAAGGCTGAGGCAGGTAGG + Intergenic
1142897891 17:2993935-2993957 CTTGGCAGGCTGAGGCGAGGAGG + Intronic
1143084165 17:4403445-4403467 CTCAGGAGGCTGAGGCGAGAAGG - Intergenic
1144462103 17:15466669-15466691 CTCTGGAGGCTGAGGCAGGAGGG - Intronic
1145715888 17:27020728-27020750 CTCAGGAGGCTGAGGCTAGAGGG - Intergenic
1145819349 17:27819593-27819615 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
1145985120 17:29040769-29040791 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1146041279 17:29457205-29457227 CTTGGAAGGCTGAGGTGGGAGGG - Intronic
1146421105 17:32686755-32686777 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1146832222 17:36080014-36080036 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1146921300 17:36714373-36714395 CTTGGGAGGCTGAGGTGAGAAGG - Intergenic
1146999120 17:37347658-37347680 TTTGGAAGGCTGAGGCAGGAGGG + Intronic
1147511844 17:41076647-41076669 CTTGGGAGGCTGAGGTGAGAGGG + Intergenic
1147599939 17:41739288-41739310 TTTGGGAGGCCGAGGCTAGATGG - Intergenic
1147654580 17:42081616-42081638 TTTGGAAGGCTGAGGCGAGCAGG - Intergenic
1147658811 17:42106048-42106070 CTTGGGAGGCTGAGGGCAGAAGG + Intronic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1148162726 17:45460495-45460517 TTTGGAAGGCTGAGGCAAGTGGG - Intronic
1148249141 17:46059509-46059531 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1148282558 17:46360427-46360449 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
1148304776 17:46578352-46578374 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
1148770973 17:50066134-50066156 CTTGGGAGGCTAAGGCTGGAGGG - Intronic
1148851217 17:50556312-50556334 CTTTCGAGGCTGGGGCTAGATGG - Intergenic
1148925764 17:51083661-51083683 CTCTGGAGGCTGAGGCAGGAGGG - Intronic
1149425384 17:56549896-56549918 CTTTGAAGGGAGAGGAGAGAGGG - Intergenic
1149443759 17:56697897-56697919 CTTGTAAGGCTGAGGCAGGAAGG - Intergenic
1149623276 17:58061862-58061884 CTTTGCAGGCTGAGGGTAACTGG - Intergenic
1149871689 17:60188086-60188108 CTTGGGAGGCTGAGGTTGGAGGG - Intronic
1149884257 17:60325304-60325326 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1150107754 17:62474902-62474924 CTTAGGAGGCTGAGGCAGGAGGG - Intronic
1150393957 17:64807163-64807185 TTTGGAAGGCTGAGGCAAGTGGG - Intergenic
1150440647 17:65188718-65188740 CTTGGGAGGCTGAGGTGAGAGGG - Intronic
1151085178 17:71372201-71372223 CATTAAAGGCACAGGCTAGAGGG + Intergenic
1153104029 18:1507295-1507317 CTTTTAATTCTGAAGCTAGAGGG - Intergenic
1153283402 18:3435302-3435324 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1153567575 18:6434237-6434259 CTTAGGAGGCTGAGGCAGGAGGG - Intergenic
1153835986 18:8964368-8964390 CTTGGGAGGCTGAGGCGGGAGGG + Intergenic
1153906895 18:9669761-9669783 CTTGGGAGGCTGAGGCTCAAGGG + Intergenic
1154195188 18:12260426-12260448 TTTGGAAGGCTGAGGCAGGAGGG - Intronic
1154471769 18:14710090-14710112 CTTAGGAGGCTGAGGCAAGAGGG + Intergenic
1155154222 18:23144614-23144636 CTGAGAAGACTGAGGCTGGATGG + Intronic
1155243407 18:23884867-23884889 CTCTGCAGGCTGAGGCGGGAGGG - Intronic
1155248216 18:23931412-23931434 CTAAGAAGGCTGAGGCAAGAGGG + Intronic
1155309591 18:24510617-24510639 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1155644787 18:28064371-28064393 CTTGGGAGGGTGAGGCAAGAGGG - Intronic
1155712768 18:28903454-28903476 CTTTAAAAGATGAAGCTAGAAGG + Intergenic
1155788639 18:29934799-29934821 CTGGGGAGGCTGAGGCAAGAAGG + Intergenic
1156951221 18:42900733-42900755 CTTTGTAGGCTGAGGCAGAAGGG + Intronic
1157208070 18:45717415-45717437 TTTTGGAGGCTGAGGTGAGAGGG + Intergenic
1157225001 18:45854614-45854636 CTTGGGAGGCTGAGGCTAAGAGG + Intronic
1157378558 18:47189838-47189860 CTGTGAAGGCAGAGGGTTGAGGG + Intergenic
1157398386 18:47364101-47364123 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1157759767 18:50252649-50252671 TTTGGAAGGCTGAGGCAGGAGGG - Intronic
1157824761 18:50802800-50802822 CTTAGGAGGCTGAGGCATGAGGG - Intronic
1158447683 18:57535381-57535403 TTTGGGAGGCTGAGGCAAGAGGG - Intergenic
1158509226 18:58075681-58075703 TTTGGAAGGCTGAGGCGGGAGGG + Intronic
1158513196 18:58109676-58109698 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1158561311 18:58516109-58516131 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1158574280 18:58623152-58623174 GGTTGAAGGATGAGGGTAGAAGG - Intronic
1158638157 18:59179363-59179385 CTTGGGAGGCTGAGGTAAGAGGG + Intergenic
1159009798 18:63047754-63047776 TTTTGGAGGCTGAGGCGGGAGGG + Intergenic
1159395670 18:67852942-67852964 ATTTGAAGGTAGAGGGTAGAAGG - Intergenic
1160956494 19:1694895-1694917 CTCTGAAGGCTGATGCTGGAGGG + Intergenic
1161002264 19:1916698-1916720 TTTTGGAGGCTGAGGCAGGAGGG - Intronic
1161425521 19:4200627-4200649 CTTGGGAGGCTGAGGTTGGAGGG - Intronic
1161552304 19:4920659-4920681 CTTGGCAGACTGAGGCTGGAGGG - Intronic
1161691806 19:5739730-5739752 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1161693517 19:5751918-5751940 CTCAGGAGGCTGAGGCTGGAGGG + Intronic
1161933071 19:7354065-7354087 CTTTGGAGGCTGAGCCAGGAGGG + Intronic
1162004541 19:7768996-7769018 CAATGGAGGCTGAGGCTAGCAGG - Exonic
1162350083 19:10143321-10143343 CTTGGGAGGCTGAGGCTGAAGGG - Intronic
1162355367 19:10180202-10180224 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
1162380941 19:10331443-10331465 CTTTGGAGGCTGAGGCAGGCGGG + Intronic
1162525917 19:11206310-11206332 TTTGGAAGGCCGAGGCGAGAGGG + Intronic
1162663475 19:12190197-12190219 TTTAAGAGGCTGAGGCTAGAGGG - Intergenic
1162681132 19:12342663-12342685 CTTGGGAGGCTGTGGCAAGAGGG + Intergenic
1162755932 19:12859942-12859964 TTTGGAAGGCTGAGGCAGGACGG - Intronic
1162831801 19:13289387-13289409 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1162832697 19:13296865-13296887 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1162940906 19:14008476-14008498 CTCTGGAGGCTGAGGCTGGCAGG + Intergenic
1163002524 19:14376891-14376913 CTTGGGAGGCTGAGGCGGGAGGG + Intergenic
1163261575 19:16193731-16193753 CTCAGGAGGCTGAGGCTGGAGGG + Intergenic
1163608427 19:18288398-18288420 CTTTGGAGACTGATTCTAGATGG - Intergenic
1163717867 19:18882522-18882544 CTTGGGAGGCTGAGGCGAGGCGG + Intronic
1163758951 19:19122665-19122687 CTGTGAAGGCTGAGGTGGGAAGG + Intronic
1165088103 19:33365329-33365351 CTTGGAAGACTGAGGCGGGAGGG - Intergenic
1165204927 19:34175304-34175326 CTTGGAAGGCAGAGGTTACAGGG - Intronic
1165280768 19:34795380-34795402 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1165377484 19:35453062-35453084 CTTGGGAGGCTGAGGCGGGAGGG - Intergenic
1165794144 19:38508951-38508973 TTTTGAAGGCTGAGGCTGCTGGG + Intronic
1165885930 19:39078312-39078334 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1166045879 19:40230826-40230848 CTTGGAAGGCTGAGGTGAGGTGG - Exonic
1166095362 19:40535298-40535320 TTTGGAAGGCTGAGGCGGGAGGG - Intronic
1166289777 19:41855240-41855262 CTCAGGAGGCTGAGGCTGGAGGG - Intergenic
1166348367 19:42180834-42180856 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1166505821 19:43370924-43370946 CTGAGAAGGCTGAGTCCAGAAGG - Intergenic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
1166928060 19:46283024-46283046 TTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1167007171 19:46783676-46783698 CTGGGAAGGCTGAGGTGAGAAGG + Intronic
1167140129 19:47644606-47644628 CTCTGGAGGCTGAGGCAGGAGGG - Intronic
1167176543 19:47868383-47868405 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1167480807 19:49729841-49729863 CTTGGGAGGCTGAGGCCGGAGGG - Intergenic
1167626609 19:50594200-50594222 TTTGGAAGGCTGAGGCGGGAGGG - Intergenic
1168212719 19:54902406-54902428 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1168473364 19:56659006-56659028 CTGTGGAGGCTGAGGCAAAAGGG + Intergenic
925450749 2:3967468-3967490 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
926200074 2:10788546-10788568 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
926289728 2:11518990-11519012 CTTGGGAGGCTGAGGCAGGATGG + Intergenic
926290824 2:11528607-11528629 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
926895148 2:17678666-17678688 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
927133422 2:20079847-20079869 CTTGGAGGTCTGAGGCTAGCAGG + Intergenic
927207915 2:20621600-20621622 CATTGAAGGCTGAGGGTACCTGG + Intronic
927617091 2:24609507-24609529 CTCTGGAGGCTGAGACTAGGAGG + Intronic
928517708 2:32059749-32059771 CTCAGGAGGCTGAGGCAAGAGGG + Intergenic
929149849 2:38737766-38737788 CTTAGGAGGCTGAGGCTGGAGGG - Intronic
929477658 2:42268542-42268564 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
929754186 2:44750262-44750284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
929854898 2:45628647-45628669 TTTGGAAGGCTGAGGCAGGAGGG - Intergenic
930773348 2:55149631-55149653 CTTGGGAGGCTGAGGTGAGAGGG + Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931215459 2:60238426-60238448 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
931353983 2:61517831-61517853 CTCTCAAGGCTGAGGCAAGAGGG + Intronic
931420252 2:62120828-62120850 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
931719724 2:65058309-65058331 CTTGGGAGGCTGAGGTGAGAGGG - Intronic
931726214 2:65113396-65113418 CTTAGAAGGCTGAGGCAGGAGGG + Intronic
931901328 2:66791602-66791624 CTTTGAAGACAGAGGCTAGGTGG + Intergenic
932129555 2:69175514-69175536 CTGGGGAGGCTGAGGCTGGAGGG + Intronic
932134024 2:69212912-69212934 CTTAGGAGGCTGAGGTGAGAGGG - Intronic
932171229 2:69558233-69558255 CTTGGAAGGCTGAGGTGGGAAGG + Intronic
932428649 2:71659948-71659970 CCTTGAAAGGTGAGGCTACAGGG - Intronic
932549626 2:72754719-72754741 CTTAGGAGGCGGAGGCTAGAGGG - Intronic
932630280 2:73336023-73336045 CTTGGAAGGCTGAGGCAGGAAGG + Intergenic
932635337 2:73383350-73383372 CTCAGGAGGCTGAGGCAAGAGGG - Intergenic
932815727 2:74860158-74860180 CTTGGAAGGGTGAGGGTAGGAGG + Intronic
933481393 2:82861382-82861404 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
933507212 2:83192687-83192709 TTTGGAAGGCTGAGGCTAGGAGG - Intergenic
933665511 2:84961362-84961384 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
933688615 2:85162125-85162147 CTCTGGAGGCTGAGGCAGGAGGG + Intronic
933711489 2:85329253-85329275 CTCAGAAGGCTGAGGATGGAAGG + Intergenic
933730325 2:85451454-85451476 CTTGGGAGGCTTAGGCTGGAGGG - Intergenic
933792670 2:85895562-85895584 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
933898659 2:86833756-86833778 CTAGGAAGGCTGAGGCAAGAGGG - Intronic
934183947 2:89654751-89654773 CTTGGGAGGCTGAAGCAAGAGGG - Intergenic
934294237 2:91728916-91728938 CTTGGGAGGCTGAAGCAAGAGGG - Intergenic
934947294 2:98551061-98551083 CTTAGGAGGCTGAGGCAGGAGGG - Intronic
935049404 2:99511496-99511518 CTTCGGAGGCTGAGGCAGGAGGG + Intergenic
935081590 2:99802553-99802575 CTCAGGAGGCTGAGGCAAGAGGG + Intronic
935186451 2:100738219-100738241 CTCTGGAGGCTGAGGCAGGAGGG + Intergenic
935309096 2:101765435-101765457 CTTGGGAGGCTGAGGCAAGGGGG - Intronic
935710274 2:105892591-105892613 TTTGGAAGGCTGAGGCTGGGAGG + Intronic
936056023 2:109262521-109262543 CTTTGAAGGATGAGGCCGCAAGG - Intronic
936171253 2:110177848-110177870 CTTGGGAGGCTGAGGCAAGGAGG - Intronic
936293810 2:111249493-111249515 CTTGGGAGGCTGAGGCCGGAGGG - Intergenic
936578640 2:113676235-113676257 CTTTGAAGGGTGAGAATAAATGG - Intergenic
936755033 2:115697875-115697897 CTCTGAAGGCTGAGGCAGAATGG + Intronic
937157122 2:119728919-119728941 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
937188084 2:120065219-120065241 TTTGGGAGGCTGAGGCGAGAGGG - Intronic
937209923 2:120261877-120261899 GGATGGAGGCTGAGGCTAGAGGG + Intronic
937844972 2:126569658-126569680 CTCCGGAGGCTGAGGCAAGAGGG + Intergenic
937922884 2:127144365-127144387 CTTTCAAGGCTGGGGCTTCAGGG + Intergenic
938014509 2:127856480-127856502 CTTGGGAGGCTGAGGCAGGATGG + Intronic
938054850 2:128207416-128207438 CTTGGGAGGCTGAGGCACGAGGG - Intergenic
939308351 2:140438122-140438144 CTCTGGAGGCTGAGGCTGGAGGG - Intronic
939524568 2:143276688-143276710 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
939983347 2:148806596-148806618 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
941082672 2:161079881-161079903 CTTTGGCGGTTGAGACTAGAAGG + Intergenic
941101233 2:161297836-161297858 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
941495467 2:166195938-166195960 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
941863252 2:170307133-170307155 CTTTGGAGGCTAAGGCAGGAAGG + Intronic
941986821 2:171518629-171518651 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
943204332 2:184873243-184873265 TTTTGAAGACTGAGGCTGGCGGG + Intronic
943831444 2:192468139-192468161 CTTGGAAGGCTAAGGCAAGAGGG - Intergenic
944605743 2:201350140-201350162 CTTTGAAGGCTGAGGAGGGCTGG + Intronic
944670482 2:201990236-201990258 CTTGGAAGGTTGAGGCAGGAGGG + Intergenic
944673043 2:202011964-202011986 CCTGGAAAGCTGAGGCCAGAGGG + Intergenic
944875018 2:203954479-203954501 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
944927272 2:204478273-204478295 CTCGGAAGGCTGAGGCAAGAGGG - Intergenic
945083567 2:206109516-206109538 CTCGGAAGGCTGAGGTAAGAAGG + Intergenic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
945474320 2:210263587-210263609 CTTGGGGGGCTGAGGCAAGATGG + Intergenic
945723260 2:213445552-213445574 CTTTGGAGGCTGAGGCAGGAGGG + Intronic
945991707 2:216401033-216401055 CTTAGGAGGCTGAGTCAAGAGGG - Intergenic
946214177 2:218170926-218170948 CATGGAAAGCTGAGGCAAGAGGG + Intergenic
946580364 2:221121682-221121704 CTTGGAAGGCTGAGGTGGGAGGG - Intergenic
946746929 2:222855402-222855424 CTTAGGAGGCTGAGGCAGGAGGG - Intergenic
946873771 2:224108166-224108188 CTTTGAAGGGTGAGGGTGAATGG + Intergenic
947073769 2:226319409-226319431 ATATGTAGGCTGAGGCTAGACGG - Intergenic
947467622 2:230367398-230367420 CTTGGACGGCTGAGGCAGGAGGG - Intronic
947719950 2:232364223-232364245 CTTAGGAGGCTGAGGCAGGAGGG - Intergenic
947787589 2:232837561-232837583 CTTAGGAGGCTGAGGCCAGGAGG - Intronic
948009750 2:234642032-234642054 CTTGGGAGGCTGAGGCATGAGGG + Intergenic
948114565 2:235484850-235484872 CTTGGAAGGCTGAGGTGGGAGGG + Intergenic
948427455 2:237896751-237896773 CTTGGGAGGCTGAGTCAAGAGGG - Intronic
948883294 2:240871088-240871110 CTGTGAGGGCTGTTGCTAGATGG - Intronic
948932481 2:241141035-241141057 TTTGGAAGGCTGAGGCAGGAAGG + Intronic
949003942 2:241634712-241634734 CTTGGGAGCCTGAGGCTTGAGGG + Intronic
949016752 2:241717311-241717333 TTTGGGAGGCTGAGGCGAGAGGG - Intronic
1168796782 20:615481-615503 CTCTGGAGGCTGAGGCAGGAGGG + Intergenic
1169068700 20:2708610-2708632 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1169127720 20:3142048-3142070 CTTGGAAGGCTGAGGCAAAAGGG + Intronic
1169153698 20:3311246-3311268 CTTGGAAGGCTGAGACTGGAGGG - Intronic
1169182416 20:3581142-3581164 CTTGGGAGGCTGAGGCAAGAGGG + Intronic
1169324022 20:4660753-4660775 CTCAGGAGGCTGAGGCTGGAGGG + Intergenic
1170035027 20:11981084-11981106 CTTGAAAGGCTGAGGTGAGAGGG - Intergenic
1170347035 20:15398923-15398945 TTTGGGAGGCTGAGGCGAGAAGG - Intronic
1170531328 20:17295655-17295677 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1170632377 20:18076570-18076592 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1170745997 20:19099401-19099423 CCCTGAAGGCTGAGGCTCCAGGG + Intergenic
1171225350 20:23437977-23437999 CCTGGGAGGCTGAGGCTAGGAGG - Intergenic
1171292948 20:23993097-23993119 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1172416318 20:34771375-34771397 TTTGGAAGGCTGAGGCCAGGAGG - Intronic
1172430264 20:34884814-34884836 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
1172555923 20:35841235-35841257 CTTGGGAGGCTGAGGCTGGAGGG + Intronic
1172875334 20:38160688-38160710 CATGGAAGGCTGAAGCTAGCTGG + Intronic
1172960335 20:38794616-38794638 CTTGGGAGGCTGAGGCAAGAAGG + Intergenic
1173204950 20:40985576-40985598 CTTTGGAGGCTGAGGCAGGTGGG - Intergenic
1173327590 20:42047954-42047976 GTTTGAAGGGTGAGGGTTGAGGG + Intergenic
1173529753 20:43760252-43760274 CTTGGGAGGCTGAGGCGGGAAGG + Intergenic
1173923346 20:46762233-46762255 CTTTGAGTGTTGAGGCCAGAAGG + Intergenic
1173930551 20:46814483-46814505 TTTTGAAGCCTGAGGCCAAAGGG - Intergenic
1174022594 20:47542852-47542874 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174270106 20:49362032-49362054 CTTGGAAGGCTGAGGCAAAAGGG + Intergenic
1174276453 20:49407956-49407978 CCTGGAAAGCGGAGGCTAGAGGG - Intronic
1174310102 20:49646089-49646111 CTCAGGAGGCTGAGGCAAGAGGG + Intronic
1174385830 20:50188141-50188163 TTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1174399106 20:50266393-50266415 CTCGGGAGGCTGAGGCTGGAGGG + Intergenic
1174488787 20:50877614-50877636 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174544107 20:51312403-51312425 CTTTGAAGGGTGAGGGGAAATGG + Intergenic
1174589751 20:51635627-51635649 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1174698707 20:52586159-52586181 CTCTGGAGGCTGAGGTGAGAGGG - Intergenic
1174828214 20:53788447-53788469 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1176185387 20:63775616-63775638 TTTTGAAGGCTGAGGGTTGCAGG - Intronic
1176523466 21:7845999-7846021 CTCAGAAGGCTGAGGCAGGAGGG + Intergenic
1176802719 21:13447823-13447845 CTTAGGAGGCTGAAGCAAGAGGG - Intergenic
1177219990 21:18180258-18180280 CTTGGGAGGCTGAGGTGAGAGGG - Intronic
1177824607 21:26068465-26068487 CTTGGAAGGCTGAGACAGGAAGG - Intronic
1177837471 21:26200699-26200721 CTTGGGAGGCTGAGGCGGGAGGG - Intergenic
1177948605 21:27505103-27505125 CTTGGAAGGCTGAGACAGGAGGG + Intergenic
1177989808 21:28023457-28023479 CTTTGAAGACAAAGGCAAGAAGG - Intergenic
1178341424 21:31788570-31788592 CTTTGGAGGCTGAGACAAGAGGG + Intergenic
1178363213 21:31967241-31967263 CTTGGAAGGCTGAGGTGGGAAGG + Intronic
1178505115 21:33156132-33156154 CTAAGGAGGCTGAGGCTGGAGGG - Intergenic
1178540396 21:33444679-33444701 CTCGGGAGGCTGAGGCTGGAGGG + Intronic
1178657486 21:34476011-34476033 CTCAGAAGGCTGAGGCAGGAGGG + Intergenic
1178824973 21:36007155-36007177 CTCTGGAGGCTGAGGCAAGAGGG + Intergenic
1178831217 21:36058391-36058413 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1178909857 21:36665826-36665848 CTTGGAGGGCTGAGGCAGGAGGG - Intergenic
1178950808 21:36983941-36983963 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1179205970 21:39278975-39278997 CTAGGGAGGCTGAGGCTGGAGGG - Intronic
1179408729 21:41145828-41145850 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
1180318754 22:11301747-11301769 CTTGGGAGGCTGAGGCTACTTGG + Intergenic
1180616235 22:17129939-17129961 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1180682867 22:17640740-17640762 CTTGGAAGACTGAGGCGAGAGGG + Intronic
1180767709 22:18356062-18356084 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
1180778599 22:18506328-18506350 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1180811324 22:18763636-18763658 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1180824007 22:18850811-18850833 CTTGGCAGGCTGAGGCAGGAAGG + Intronic
1180990753 22:19934271-19934293 CTAGGGAGGCTGAGGCTGGAGGG + Intronic
1181124434 22:20693964-20693986 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1181145517 22:20843245-20843267 TTTGGAAGGCTGAGGCAGGAGGG + Intronic
1181188730 22:21123737-21123759 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181197476 22:21197891-21197913 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1181210468 22:21286756-21286778 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1181299821 22:21871717-21871739 CTTGGGAGGCTGAGGCGGGAAGG + Intergenic
1181312740 22:21954121-21954143 CTAGGAAGGCTGAGGCAGGAGGG - Intergenic
1181319437 22:21993201-21993223 CTTAGGAGGCTGAGGCGGGAGGG + Intergenic
1181399041 22:22640135-22640157 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181501771 22:23319481-23319503 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181650380 22:24255924-24255946 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1181665695 22:24394936-24394958 CTTTGGAGGCTGAGGTGGGAGGG - Intronic
1181707000 22:24654814-24654836 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1182098263 22:27640195-27640217 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1182168342 22:28200195-28200217 CTTAGGAGGCTGAGGCAAGGAGG - Intronic
1182207444 22:28643212-28643234 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1182279914 22:29212376-29212398 TTTTGGAGGCTGAGGCAAGGAGG - Intronic
1182480849 22:30607777-30607799 TTTGGAAGGCTGAGGCGGGAGGG + Intronic
1182544242 22:31064598-31064620 CTCTGGAGGCTGGGGCTGGAGGG - Intronic
1182596021 22:31421219-31421241 CTTAGAAGGCTGAGGCAGGAGGG - Intronic
1182655761 22:31888655-31888677 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1183457109 22:37928878-37928900 CTTTGGAGGCTGAGGCAGGCAGG + Intronic
1183478135 22:38047328-38047350 CTTGGAAGGCTGAGGTAGGAGGG + Intergenic
1183554016 22:38511024-38511046 CTTGGGAGGCTGAGGCGGGAGGG + Intergenic
1183899843 22:40996763-40996785 CTCTGCAGGCTGAGGCCAGGAGG + Intergenic
1183963954 22:41430120-41430142 CTTGGAAGGCTGAAGCCAGAAGG - Intergenic
1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG + Intronic
1184342825 22:43895487-43895509 CTTGAAAGGCTGAGGCGGGAGGG + Intergenic
1184509327 22:44923901-44923923 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1185265160 22:49898106-49898128 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185321945 22:50205474-50205496 CTTGGCAGGCTGAGGCGAGAGGG + Intronic
1203216478 22_KI270731v1_random:8674-8696 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1203229324 22_KI270731v1_random:96945-96967 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
1203274148 22_KI270734v1_random:76714-76736 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
949477773 3:4465365-4465387 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
949706726 3:6826934-6826956 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
949932538 3:9090168-9090190 CTTTGAAAGCTGATGCTTGGTGG - Intronic
950010829 3:9722620-9722642 CTTGGAAGGCTGAGGTGGGAGGG - Intronic
950150573 3:10683902-10683924 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
950646832 3:14382377-14382399 CTCTGGAGGCTGAGGCTTGTGGG + Intergenic
950814698 3:15688363-15688385 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
950834009 3:15902362-15902384 CTTAGGAGGCTAAGGCTGGAGGG - Intergenic
951722750 3:25718321-25718343 CTTGGAAGGCTGAGGTGAGAGGG + Intergenic
951916188 3:27803314-27803336 CTCAGGAGGCTGAGGCAAGAGGG - Intergenic
952475899 3:33710463-33710485 CTCAGAAGACTGAGGCCAGAGGG + Intronic
952528133 3:34234535-34234557 ATTTGGAGGGTGAGGCAAGAGGG - Intergenic
952723246 3:36555361-36555383 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
952952161 3:38533737-38533759 CTGAGAAGGCTGAGGCCACATGG - Intronic
953078843 3:39596726-39596748 CACTCAAGGCTGAGGCGAGAAGG + Intergenic
953137535 3:40195398-40195420 CTTGGGAAGCTGAGGCTGGAGGG - Intronic
953163276 3:40441916-40441938 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
953861772 3:46550497-46550519 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
954040214 3:47880571-47880593 CTTGGAAGGCTGAGGCATTAGGG - Intronic
954113325 3:48448285-48448307 CTTGGGAGGCTGAGGCTACTCGG - Intronic
954174665 3:48834616-48834638 CTTGGGAGGCTGAGGCAAGAGGG + Intronic
954214790 3:49118458-49118480 CTTGGGAGGCTGAGGCTACTTGG + Intronic
954307289 3:49735245-49735267 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
954311013 3:49767166-49767188 CTTGGAAGGCTGAGGCAGGCAGG + Intronic
954451958 3:50576509-50576531 CTCAGAAGGCTGAGGTGAGAGGG - Intronic
955526860 3:59829966-59829988 CTTGGGAGGCTGAGGTTGGAGGG + Intronic
955820025 3:62887012-62887034 CTTGGAAGGCTGAGGTGGGAGGG - Intergenic
955850892 3:63218653-63218675 TTTTGGAGGCTGAGGCGGGACGG - Intergenic
956089373 3:65649272-65649294 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
956154802 3:66284102-66284124 TTTGGGAGGCTGAGGCAAGAGGG + Intronic
956665058 3:71634179-71634201 CTTGGGAGGCTGAGGCAGGACGG - Intergenic
956834379 3:73083851-73083873 CTTTGGAGGCCGAGGCGAGCGGG + Intergenic
957333233 3:78793012-78793034 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
959075331 3:101743501-101743523 CTTGGAAGGCTGAGACAGGACGG - Intronic
959748539 3:109805951-109805973 CTTTGAAGGCTTACTTTAGATGG - Intergenic
960165946 3:114401432-114401454 CTTTGAAAGTTGAAGCTAGTTGG - Intronic
960812612 3:121638936-121638958 CTCAGAAGGCTGAGGCAGGAGGG + Intronic
960925346 3:122790444-122790466 CTTTGGAGGCTGAGAGGAGAAGG - Intronic
961604883 3:128086237-128086259 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
961818749 3:129564573-129564595 CTATGGTGGCAGAGGCTAGAGGG - Intronic
961902936 3:130231990-130232012 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
962072738 3:132048594-132048616 CTATGGAGGCTGAGGCAGGAGGG - Intronic
962946029 3:140171479-140171501 TTTTGAAGGATGAGGCAGGAAGG + Intronic
963136623 3:141911600-141911622 CTTGGAAGGCTGAGGCATGAGGG - Intronic
963517404 3:146325889-146325911 CTTGGGAGGCTGAGGCTGAATGG - Intergenic
963796839 3:149639309-149639331 CTTGGGAGGCTGAGGCAAGGGGG - Intronic
963915120 3:150852188-150852210 CTTTAATGGCTGATGCTTGATGG + Intergenic
964019361 3:151989629-151989651 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
964852827 3:161113320-161113342 TTTGGAAGGCTGAAGCCAGAGGG + Intronic
965151487 3:164982763-164982785 CATAGGAGGCTGAGGCTAGAGGG - Intronic
965895146 3:173566627-173566649 GTTTGCAGGGTGAGGGTAGAGGG - Intronic
966740790 3:183231560-183231582 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
966783535 3:183605379-183605401 CTTAGGAGGCTGAAGCTGGAAGG + Intergenic
966883174 3:184361267-184361289 CTTGGAAGTCTGAGGCTGCAGGG - Intronic
967138711 3:186534437-186534459 CTTTGAAGTTTGAGGCTTGAAGG + Intergenic
967180583 3:186899713-186899735 CTCTGGAGGCTGAGGCAAGAGGG - Intergenic
967208205 3:187143000-187143022 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
967327991 3:188261254-188261276 CTTAGAAGGCTGAGGTGGGAGGG - Intronic
967395540 3:189004571-189004593 CTCTGAAGGCTTAGGCAAGAGGG + Intronic
967716448 3:192767791-192767813 AATTGAAGTCTGAGGCTATAAGG - Intergenic
967993193 3:195146945-195146967 CTTGGAAGGCTGAGGCAGGGGGG - Intronic
969979736 4:11142291-11142313 CTTTGGAGGCTGAGGCAGGAGGG + Intergenic
970094150 4:12443573-12443595 TTCTGAAGGCTGAGGGAAGAAGG + Intergenic
970326770 4:14933658-14933680 CTTGTGAGGCTGAGGCAAGAGGG + Intergenic
971537892 4:27777401-27777423 CTCTGAAGGCTGAGGGAGGAGGG + Intergenic
971594363 4:28509851-28509873 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
972258897 4:37388289-37388311 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
972389207 4:38597282-38597304 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
972405382 4:38741559-38741581 CTTAGAAGGCTGAGGCAGGAGGG - Intergenic
972671651 4:41217751-41217773 CTGGGGAGGCTGAGGCAAGAGGG + Intergenic
973318768 4:48788600-48788622 CTCGGAAGGCTGAGGCAGGAGGG - Intergenic
973700740 4:53534394-53534416 TTTGGAAGGCTGAGGCAGGAGGG + Intronic
973903427 4:55501523-55501545 CTTGGGAGGCTGAGGCGGGAGGG - Intronic
974083372 4:57235057-57235079 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
974610974 4:64214877-64214899 CTTGGGAGGCTGAGTTTAGAGGG + Intergenic
975328440 4:73086694-73086716 CTCAGGAGGCTGAGGCAAGAGGG - Intronic
975462561 4:74671412-74671434 ATTTGAAGGCTGAGGGCAGAGGG + Intergenic
975713247 4:77181262-77181284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
976067731 4:81208527-81208549 CTCTGAAGGCTGAGGCAAGAGGG - Intronic
977049093 4:92104181-92104203 CTTAGGAGGCTGAGGTGAGAGGG - Intergenic
977734864 4:100401810-100401832 CTTTGAAGGCTGAAGAGTGAAGG - Intronic
978102222 4:104855799-104855821 ATTTGAAGACTGAAGCTAGAGGG - Intergenic
978798103 4:112728642-112728664 CTCTGAAGGTTGAGGTGAGAGGG + Intergenic
979281807 4:118877046-118877068 TTTTGGAGGCTGAGGCAGGAGGG - Intronic
979524639 4:121704343-121704365 CTCGGGAGGCTGAGGCTAGGAGG + Intergenic
979772697 4:124548512-124548534 ATTTGAAGTCTCTGGCTAGATGG - Intergenic
980040328 4:127932001-127932023 CTTAGAGGGCTGAGGCTGGAAGG + Intronic
980053160 4:128057856-128057878 CTTGGGAGGCTGAGGCTGGCAGG + Intergenic
980854204 4:138419739-138419761 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
981077978 4:140609551-140609573 GTTTGAAGGGTGATCCTAGAAGG + Intergenic
981302499 4:143204495-143204517 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
981364405 4:143885135-143885157 CTTTAAAGCCTCAGGCTATAGGG - Intronic
981374896 4:144003441-144003463 CTTTAAAGCCTCAGGCTATAGGG - Intronic
981478818 4:145214683-145214705 CTTGGGAGGCTGAGGCAAGAGGG - Intergenic
981491145 4:145340661-145340683 CTTTGAAGGGTGAGGAAAAATGG - Intergenic
981974228 4:150704104-150704126 CCTTGGAGGCTGAGGTGAGAGGG + Intronic
982080156 4:151781747-151781769 CTTTGTTTGCTGAGGCTGGAGGG + Intergenic
982222357 4:153135829-153135851 CTCAGGAGGCTGAGGCAAGAGGG + Intergenic
982235008 4:153243924-153243946 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
982781380 4:159494582-159494604 CTTTGGAGGCTGAGGCAGGAGGG + Intergenic
982973657 4:162023835-162023857 CTCTGAAGCCAGAGGCCAGAAGG - Intronic
983218889 4:165025907-165025929 CTCAGAAGGCTGAGGCGGGAGGG - Intergenic
983269431 4:165543949-165543971 CTTGGGAGGCTGAGGAAAGAGGG + Intergenic
983517835 4:168675946-168675968 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
983905882 4:173182784-173182806 CTCTGAATGATGAGGCTAGTAGG + Intronic
983905887 4:173182892-173182914 CTTTGAATGATGAGGCTAGCAGG + Intronic
983905893 4:173182998-173183020 CTTTGAATGGTGAGGCTAGCAGG + Intronic
984003577 4:174281578-174281600 CTCTGAAGGCTGAGGTGGGAGGG + Intronic
984151876 4:176143419-176143441 CTTCGGAAGCTGAGGCCAGAGGG + Intronic
984251951 4:177346272-177346294 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
984553886 4:181191663-181191685 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
984605728 4:181783805-181783827 CTCTGGAGGCTTAGGCTTGAGGG - Intergenic
984722317 4:182986011-182986033 CTCAGGAGGCTGAGGCGAGAAGG + Intergenic
984955546 4:185042149-185042171 TTTGGAAGGCTGAGGCAGGAGGG + Intergenic
984970818 4:185188261-185188283 CTTTGAAGGCTGAGGCTAGAGGG - Intronic
986392176 5:7297431-7297453 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
986931592 5:12830704-12830726 CAAGGAAGGCTGAGGGTAGAAGG - Intergenic
987071294 5:14339127-14339149 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
987202510 5:15591534-15591556 CTAGGAAGGCTGAGGGTAAATGG + Intronic
987556960 5:19464918-19464940 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
987710316 5:21495860-21495882 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
987791239 5:22571037-22571059 CTTTGAAGGCTGAGAGAAGGAGG - Intronic
988506692 5:31829938-31829960 CTCTGGAGGCTGAGGCAAGAGGG + Intronic
988708112 5:33745214-33745236 CTTTGCAGGATGAAGCCAGAAGG + Intronic
989058293 5:37385410-37385432 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
989591087 5:43113504-43113526 CTTGGGAGGCTGAGGCAAGGGGG + Intronic
990212298 5:53493671-53493693 CTTGGGAGGCTGAGGTTGGAGGG + Intergenic
991017804 5:61950073-61950095 TTTGGAAGGCTGAGGCAGGAAGG + Intergenic
991250266 5:64552817-64552839 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
991396839 5:66213050-66213072 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
991737550 5:69641509-69641531 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991760644 5:69914916-69914938 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991786688 5:70203185-70203207 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991789126 5:70221235-70221257 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991813876 5:70496341-70496363 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991817007 5:70517625-70517647 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991839875 5:70789966-70789988 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991879133 5:71203570-71203592 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991881573 5:71221599-71221621 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991968774 5:72118251-72118273 CTTGGAAGGCTGAGGTGGGAGGG - Intronic
992060894 5:73046171-73046193 CTTGGAAGGCTCAGGCAGGAAGG - Intronic
992320056 5:75605060-75605082 CTTTACAGGCTGAGGTTAGAAGG - Intergenic
992598153 5:78366876-78366898 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
992979412 5:82152565-82152587 CAATGAAGGGTGAGGGTAGAGGG + Intronic
992991979 5:82293000-82293022 TTTTGGAGGCTGAGGCAGGAGGG + Intronic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
994206676 5:97043658-97043680 CTCTGATTACTGAGGCTAGAGGG - Intergenic
994402648 5:99300875-99300897 CTTCAAAGGCTGAGGCTGGGAGG - Intergenic
994415093 5:99459676-99459698 CTTGGAAGGCGGAGGTTACAGGG - Intergenic
994422269 5:99535961-99535983 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
994460101 5:100061570-100061592 CTTGGAAGACTGAGGCAAGAGGG + Intergenic
994484250 5:100374999-100375021 CTTGGAAGACTGAGGCAAGAGGG + Intergenic
994899785 5:105757077-105757099 CCTGGAAGGCTGAGGCAGGATGG + Intergenic
995188357 5:109294783-109294805 TTTTGAGGGCTGAGGCTATGGGG - Intergenic
995245574 5:109931590-109931612 CTTTGAAGATTGAGCCTTGAAGG + Intergenic
995260965 5:110104087-110104109 CTTTGAAGGGTGAGAATAAATGG + Intergenic
995506548 5:112866452-112866474 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
995561943 5:113391608-113391630 CTTGGAAGGCTAAGGCAGGAAGG + Intronic
996720047 5:126621294-126621316 CTAAGGAGGCTGAGGCAAGAGGG - Intronic
997704429 5:135933749-135933771 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
997964408 5:138346007-138346029 CTGTGAGGGCTGAAGCAAGATGG + Intronic
998008365 5:138672719-138672741 CTTGGAAGGCTGAGCCTGGGAGG + Intronic
998230142 5:140356571-140356593 CTTAGGAGGCTGAGGCAGGAGGG + Intergenic
998241646 5:140451614-140451636 CTTGGGAGGCTGAGGGCAGAGGG - Intronic
998742561 5:145221428-145221450 CTGTGAAGGATGAGGTTGGAAGG + Intergenic
999324432 5:150634711-150634733 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
999721133 5:154400028-154400050 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
999791154 5:154940589-154940611 CTTGGGAGGCTGAGGTAAGAGGG + Intergenic
1001190514 5:169626360-169626382 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1002030187 5:176422764-176422786 CTCAGAAGGCTGAGGCAGGAGGG - Intergenic
1002448744 5:179307258-179307280 CCCTGAAGGCTGAGGCTTGCAGG - Intronic
1002631821 5:180587117-180587139 CTTTGGAGGCTTAGGTGAGAGGG - Intergenic
1202773756 5_GL000208v1_random:40386-40408 CTTTGAAGCCTAAGGCAAAAAGG - Intergenic
1003221892 6:4167566-4167588 TTTTGAAGGCGGAGACTGGAGGG - Intergenic
1003481741 6:6540616-6540638 CTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1003532182 6:6946938-6946960 ATTTGAAGTCTGAGACTACAAGG - Intergenic
1003539425 6:7005076-7005098 CTCGGGAGGCTGAGGCAAGAGGG + Intergenic
1004226675 6:13791145-13791167 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004366361 6:15016438-15016460 CTCTGGAGGCTGAGGCAGGAGGG + Intergenic
1004515101 6:16315922-16315944 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1004534257 6:16484324-16484346 CTCTGAAGGCTGAGGTGGGAGGG + Intronic
1004707524 6:18138372-18138394 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004904355 6:20222616-20222638 CTTGCAAAGCTGAGGCTGGAGGG + Intergenic
1004929065 6:20444097-20444119 CTTGGAAGGCTGAGCCCAGGAGG + Intronic
1004957701 6:20748400-20748422 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1004965171 6:20841075-20841097 TTTGGGAGGCTGAGGCAAGAGGG - Intronic
1005155889 6:22805955-22805977 CTCTGAAGCCTAAGGGTAGATGG - Intergenic
1005301730 6:24477620-24477642 CTCAGAAGGCTGAGGCAGGAGGG + Intronic
1005423090 6:25673005-25673027 ATGTGAAGGCTGAGACAAGAAGG - Intronic
1005547374 6:26884650-26884672 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1006462459 6:34169811-34169833 TTTTGGAGGCTGAGGCAAGTGGG - Intergenic
1006818326 6:36869224-36869246 CTTTGGAGGCTGAGGCGGGAGGG - Intronic
1007609021 6:43136894-43136916 CTTTGGAGGCTGAGGTGAGAGGG + Intronic
1007798503 6:44371189-44371211 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1008519764 6:52351959-52351981 TTTAGGAGGCTGAGGCGAGAGGG + Intergenic
1008600639 6:53090786-53090808 CTCAGGAGGCTGAGGCAAGAGGG - Intronic
1009018134 6:57925722-57925744 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1009021890 6:57955286-57955308 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1009879220 6:69544405-69544427 TTTGGGAGGCTGAGGCAAGAAGG + Intergenic
1010043656 6:71417023-71417045 TTTTGAAATCTGAGGCTTGAAGG + Intergenic
1010213655 6:73382942-73382964 CTTGGAAGGCTGAGCCTGGGAGG - Intronic
1010230864 6:73534032-73534054 CTTCGGAGGCCGAGGCAAGAAGG + Intergenic
1010463264 6:76137727-76137749 TTGTGAAAGCTGAGGATAGAAGG - Intergenic
1011041721 6:83036839-83036861 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1012375679 6:98559375-98559397 GTTAGAAGGGTGAGGCTAGAAGG - Intergenic
1013085482 6:106853393-106853415 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1013136007 6:107283216-107283238 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1013434314 6:110086810-110086832 GTTGGAAGGCTGAGGCTGGAGGG - Intergenic
1013530217 6:111012412-111012434 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
1013582090 6:111545559-111545581 TTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1014048370 6:116921713-116921735 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1014067468 6:117144325-117144347 CTCAGGAGGCTGAGGCTAGAGGG + Intergenic
1014102243 6:117524307-117524329 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1014400281 6:120980597-120980619 AGTTGAAGGCTGAGGCAGGAGGG + Intergenic
1014930127 6:127325806-127325828 CTTGGGAGGCTGAGGCGGGAAGG - Intronic
1015120441 6:129695518-129695540 GCTTGAAGCCTGAGGCTTGAAGG - Intronic
1015284215 6:131466553-131466575 GTTGGAAGGCTGAGCCTAGCAGG + Intergenic
1015539056 6:134296562-134296584 TTTAGGAGGCTGAGGCAAGAGGG - Intronic
1015912173 6:138179915-138179937 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1015964048 6:138680722-138680744 ATTGGGAGGCTGAGGCTGGAGGG - Intronic
1016318764 6:142819124-142819146 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1017495514 6:154979725-154979747 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1018131900 6:160739651-160739673 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1018221589 6:161586121-161586143 CTCTGGAGGCTGAAGCTGGAGGG - Intronic
1018734502 6:166677466-166677488 CTCGGAAGGCTGAGGCAAGAGGG - Intronic
1019230782 6:170560395-170560417 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
1019337018 7:490222-490244 CTCAGAAGGCTGAGGCTGGAAGG + Intergenic
1020416782 7:7955445-7955467 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1021083218 7:16388089-16388111 CTTGGGAGGCTGAGGCTGGCAGG - Intronic
1021259556 7:18437160-18437182 CTTTAAGGTCTGAGGGTAGAAGG + Intronic
1022129753 7:27394310-27394332 CATTGAAGGATGAGGCTGAATGG + Intergenic
1022241406 7:28516104-28516126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1022295001 7:29042495-29042517 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
1022408556 7:30117594-30117616 CTCAGGAGGCTGAGGCGAGAGGG + Intronic
1023133624 7:37028688-37028710 CTTGGGAGGCTGAGGCGGGACGG - Intronic
1023246091 7:38205811-38205833 ATTAGAAGGCAGAGGGTAGAGGG - Intronic
1023383550 7:39632573-39632595 TTTGGGAGGCTGAGGCTAGCAGG + Intronic
1023963033 7:44943644-44943666 TTTCCAAGGCTGAGGCTGGAAGG + Intergenic
1024300317 7:47882575-47882597 CTCTGAAGACTAAGACTAGAAGG + Intronic
1024407168 7:48995102-48995124 CTTTGAAGCCAGAAGCAAGAGGG + Intergenic
1024522774 7:50321143-50321165 CTTGGAAGACTGATGGTAGAAGG + Intronic
1024852971 7:53743137-53743159 CTTGGGAGGCTAAGGCGAGAAGG + Intergenic
1025170409 7:56751518-56751540 TTTGGGAGGCTGAGGCTAGGAGG + Intergenic
1025321413 7:58098059-58098081 CTTGGGAGGCTGAGGCTGCAGGG - Intergenic
1025701478 7:63824188-63824210 TTTGGGAGGCTGAGGCTAGGAGG - Intergenic
1025825548 7:65007726-65007748 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1025898554 7:65725538-65725560 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1026162099 7:67878541-67878563 CTTGGGAGGCTGAGGCTGGCGGG + Intergenic
1026164655 7:67899286-67899308 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1026326860 7:69318044-69318066 CTTGGGAGGCTGAGGCAAGAGGG - Intergenic
1026399819 7:69998287-69998309 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1026489000 7:70846509-70846531 ATTGGAAGGCGGAGGCTGGATGG - Intergenic
1026489257 7:70848629-70848651 ATTGGAAGGCGGAGGCTGGATGG - Intergenic
1026530800 7:71195653-71195675 CTTAGGAGGCTGAGGAGAGAGGG - Intronic
1026780056 7:73260257-73260279 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1026851662 7:73727717-73727739 CTCTGGAGGCTGAGGTGAGAGGG - Intergenic
1027020911 7:74813675-74813697 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1027067114 7:75132249-75132271 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1027176468 7:75906962-75906984 CTTTGGAGGCTGAGGCAGGCAGG + Intronic
1027469465 7:78555029-78555051 CTCAGAAGGCTGAGGTGAGAGGG + Intronic
1027589700 7:80102164-80102186 TTTGGGAGGCTGAGGCAAGAAGG + Intergenic
1027765295 7:82332889-82332911 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1027809873 7:82881883-82881905 TTTGGAAGGCTGAGGCAAAAGGG - Intronic
1028159743 7:87472316-87472338 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1028406125 7:90475849-90475871 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1028841712 7:95435568-95435590 CTCAGGAGGCTGAGGCTGGAGGG - Intergenic
1029128387 7:98311434-98311456 CTTGGAAGGCTGAGGCAGAATGG + Intronic
1029317819 7:99730394-99730416 CTTTGAAGGCTGCGTCTTGTGGG - Intronic
1029416057 7:100443880-100443902 CTTTGTTGGCTGAGGCAGGAGGG + Intergenic
1029520113 7:101054869-101054891 TTTGGGAGGCTGAGGCTAGTGGG + Intronic
1029548798 7:101225587-101225609 CTCAGAAGGCTGAGGCATGAGGG - Intergenic
1029626781 7:101724788-101724810 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1029636209 7:101785938-101785960 CTTGGGAGGCTGAGACAAGAGGG + Intergenic
1029672960 7:102046682-102046704 CTCAGGAGGCTGAGGCTGGAGGG - Intronic
1029923200 7:104287851-104287873 TTTGGAAGGCTGAGGCTGGAGGG - Intergenic
1030287141 7:107838291-107838313 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1030625639 7:111842830-111842852 CTTTGACAGCTGAGGCAAGAGGG - Intronic
1030951239 7:115792660-115792682 CTTGAGAGGCTGAGGCCAGAAGG + Intergenic
1031054026 7:116974397-116974419 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1031563621 7:123267447-123267469 CTTGGGAGGCTGAGGCGGGAGGG - Intergenic
1031725523 7:125233247-125233269 TTTTGGAGGCTGAGGCAAGCAGG - Intergenic
1032161960 7:129517685-129517707 CTCAGGAGGCTGAGGCCAGAGGG + Intergenic
1032177193 7:129640408-129640430 CTCTGGAGGCTGAGGCAGGAGGG + Intronic
1032203414 7:129840292-129840314 CTTGGAAGACTGAGGCTGGGAGG - Intronic
1032341879 7:131081498-131081520 TTTGGGAGGCTGAGGCGAGAGGG + Intergenic
1032717628 7:134524111-134524133 CTCAGGAGGCTGAGGCCAGATGG - Intergenic
1032811715 7:135426104-135426126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1033192730 7:139296780-139296802 CTTAGAAGGCTAAGGCAGGAGGG + Intronic
1033201787 7:139379257-139379279 CTTTGGAGGCTGAGGTGGGAAGG + Intronic
1033737413 7:144236520-144236542 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1033745643 7:144314427-144314449 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1033993620 7:147318332-147318354 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1034163497 7:149009036-149009058 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1034252277 7:149701892-149701914 CTTTCAAGCCTGAGGGTACATGG + Intergenic
1034964668 7:155383808-155383830 CTGTGCAGGCTGGGGCCAGATGG + Intronic
1036942953 8:13068937-13068959 CTTGGAAGGCTGAGGTGGGAGGG - Intergenic
1037084540 8:14831722-14831744 CTTTGAAAGCTGGTGTTAGAAGG + Intronic
1037314924 8:17591804-17591826 CTCGGAAGGCTGAGGCAGGAGGG + Intronic
1037333427 8:17767588-17767610 CTCTGAAGGCTGAGGGCAGGAGG + Intronic
1037710702 8:21353274-21353296 CTCTGAGGGATGAGGATAGATGG - Intergenic
1038150271 8:24937219-24937241 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1038157658 8:25005935-25005957 GTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1038782015 8:30576025-30576047 CCTTGAACGCTGGGGCTGGAAGG + Intergenic
1039047934 8:33466995-33467017 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1039143049 8:34414771-34414793 CATTGAAGACTGAAGCTACAGGG - Intergenic
1039217566 8:35289874-35289896 CTTGGAAGGCTGAGACAGGAGGG + Intronic
1039300713 8:36205736-36205758 CTGTGAAGGTAGAGGCAAGATGG + Intergenic
1039567049 8:38559310-38559332 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1039591714 8:38755594-38755616 CTGAAAAGGCTGAGGCAAGAGGG + Intronic
1039802391 8:40970665-40970687 CTTTGAAGGGTGAGGGGAAATGG + Intergenic
1040033527 8:42846718-42846740 CTTGGGAGGCTGAGGCAAGGAGG + Intergenic
1040363356 8:46688882-46688904 TTTGGAAGGCTGAGGCTAGGAGG - Intergenic
1040655868 8:49506772-49506794 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1040666204 8:49636491-49636513 TTGGGAAGGCTGAGGCGAGAGGG + Intergenic
1041308564 8:56489749-56489771 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1041478695 8:58294567-58294589 TCTAGAAGGCTGAGGCAAGAGGG - Intergenic
1041770291 8:61465767-61465789 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1042256827 8:66813144-66813166 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
1042659408 8:71137115-71137137 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1042855084 8:73258736-73258758 CTCAGGAGGCTGAGGGTAGAAGG - Intronic
1043086511 8:75841550-75841572 CTTAGGAGGCTGAGGCAGGAGGG + Intergenic
1044537367 8:93372874-93372896 TTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1045087628 8:98703683-98703705 CTTAGAAGGATGGGGCTATAGGG - Intronic
1045268132 8:100638060-100638082 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1045359313 8:101417743-101417765 TTTGGGAGGCTGAGGCGAGAGGG + Intergenic
1045460677 8:102422763-102422785 CTCAGGAGGCTGAGGCTGGAGGG + Intergenic
1045527153 8:102950804-102950826 CTTGGGAAGCTGAGGCAAGAGGG - Intronic
1047020635 8:120771975-120771997 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1047210211 8:122834600-122834622 CTTTGAAGGCTAAATTTAGAAGG + Intronic
1047312125 8:123700928-123700950 CTCAGGAGGCTGAGGCTGGAGGG - Intronic
1047388211 8:124428975-124428997 TTTGGGAGGCTGAAGCTAGAAGG + Intergenic
1047528132 8:125651097-125651119 TTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1047764059 8:127976007-127976029 GTAGGAAGGCTGAGGCTAGCAGG + Intergenic
1049014295 8:139908570-139908592 CTTTGAAGCCTGAGACTCGGGGG + Intronic
1049879115 8:145050075-145050097 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1050014365 9:1218475-1218497 CTTTGAAAACAGAAGCTAGAAGG - Intergenic
1050197357 9:3100718-3100740 CTTGGGAGGCTGAGGTTGGAGGG - Intergenic
1050677140 9:8069183-8069205 CTTAGGAGGCTGAGGCGGGAGGG - Intergenic
1050739420 9:8802942-8802964 CTTGGGAGGCTGAGGTTAGGAGG + Intronic
1050827983 9:9973362-9973384 CTTGGAAGGCTGAAGCCGGAGGG + Intronic
1050927200 9:11279273-11279295 CTTAGGAGGCTGAGGCAGGAGGG - Intergenic
1051360803 9:16280014-16280036 CTGTGAAGGCTTTGGCTACATGG - Intergenic
1051623437 9:19075847-19075869 CTCAGGAGGCTGAGGCAAGATGG + Intronic
1051782807 9:20708665-20708687 CTTGGAAGGCTGAGGATGGGCGG + Intronic
1052361930 9:27571561-27571583 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1052391262 9:27881243-27881265 CTTGGAAGACTGAGGGTAGAAGG - Intergenic
1052657852 9:31387043-31387065 CTTGGGAGGCTGAGGTGAGACGG - Intergenic
1052912098 9:33891923-33891945 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1052919499 9:33952975-33952997 CTTGGGAGGCTGAGGTTGGAGGG - Intronic
1053213784 9:36254282-36254304 TTTGGGAGGCTGAGGCAAGAAGG + Intronic
1053282943 9:36832829-36832851 CTTGAGAGGCTGAGGCAAGAGGG + Intergenic
1053491360 9:38506660-38506682 CTAGGAAGGCTGAGGCAGGAGGG + Intergenic
1054352828 9:64033014-64033036 CTTAGGAGGCTGAGGTGAGAGGG - Intergenic
1054925343 9:70583321-70583343 CTTTGCGGGCTCAGGCTACATGG + Intronic
1055461217 9:76522165-76522187 CTCAGAAGGCTGAAGCAAGAGGG + Intergenic
1055776343 9:79770461-79770483 CAGTCAAAGCTGAGGCTAGAAGG + Intergenic
1056450745 9:86714433-86714455 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1056628246 9:88271921-88271943 CTTGGGAGGCTGAGGGTAGGAGG + Intergenic
1057671663 9:97095849-97095871 CTAGGAAGGCTGAGGCAGGAGGG + Intergenic
1057721985 9:97539528-97539550 CATGGAATGCTGAGGCAAGAGGG - Intronic
1057783397 9:98068703-98068725 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1057865577 9:98677786-98677808 CTGTGAAGGTCGAGGCTGGAGGG - Intronic
1058672416 9:107371153-107371175 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1059323781 9:113489629-113489651 CTCAGGAGGCTGAGGCTGGAGGG - Intronic
1060382170 9:123186097-123186119 TTTGGAAGGCTGAGGCCAGGAGG + Intronic
1060395888 9:123316233-123316255 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060400039 9:123343197-123343219 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060539985 9:124422869-124422891 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1060680109 9:125554686-125554708 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1061090890 9:128425423-128425445 CTTGGGAAGCTGAGGCTGGAGGG + Intronic
1061344768 9:130014357-130014379 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1061685395 9:132272557-132272579 CTTGGGAGGCTGAGGCAAGGAGG - Intronic
1061745817 9:132739649-132739671 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1061995807 9:134182204-134182226 CTCTGGAGGCTGAGGCAGGAGGG + Intergenic
1062505420 9:136872275-136872297 TTTGGAAGGCTGAGGCAAGGTGG + Intronic
1203428647 Un_GL000195v1:67048-67070 CTTTGAAAGCTAAGGCAAGAGGG - Intergenic
1185553369 X:1001657-1001679 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185666319 X:1768199-1768221 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185832888 X:3318248-3318270 CTTAGAAGGCTGAGTCCAGGAGG - Intronic
1185943065 X:4342640-4342662 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1186092711 X:6066999-6067021 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
1186490833 X:9970700-9970722 CTTGGAAGGCTAAGGCGGGAGGG - Intergenic
1187084717 X:16029863-16029885 CTTTGAAGGGTGAGAGTAAATGG - Intergenic
1187275053 X:17809873-17809895 CTTAGGAGGCTGAGGCAGGAGGG - Intronic
1187424206 X:19162513-19162535 CTTTGGAGGCCGAGGCAGGAGGG - Intergenic
1187477707 X:19626673-19626695 CTTGGGAGGCTGAGGCGGGAGGG - Intronic
1188541446 X:31254935-31254957 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1188924776 X:36025389-36025411 TTTGGGAGGCTAAGGCTAGAGGG + Intergenic
1188968203 X:36580573-36580595 CTTGGAAGGCTGAGGCAGGCAGG + Intergenic
1189172976 X:38926925-38926947 TTTTGAAGGCTGCTGTTAGAAGG - Intergenic
1189788299 X:44579484-44579506 CTTGGGAGGCTGAGGCGAGAGGG + Intergenic
1189820513 X:44866301-44866323 TTTGGAAGGCTGAGGCTGGTGGG - Intergenic
1190717069 X:53114004-53114026 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1191741828 X:64444418-64444440 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1193123656 X:77849182-77849204 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1193265607 X:79464574-79464596 CATCGAAGCCTGAGCCTAGAGGG - Intergenic
1193667627 X:84341837-84341859 CTTGGAAAGCTGAGGCGAAAAGG - Intronic
1194413814 X:93586215-93586237 TTTGGGAGGCTGAGGCTGGAAGG - Intergenic
1194619291 X:96149072-96149094 TTTGGGAGGCTGAGGCAAGAAGG + Intergenic
1195050177 X:101089638-101089660 CTTAGGAGGCTGAGGCAAGGTGG + Intronic
1195612712 X:106887068-106887090 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1195664433 X:107416042-107416064 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1195681652 X:107551545-107551567 CTTGGAAGGCTGGGGCTACCTGG - Intronic
1195696052 X:107668367-107668389 TTTTGGAGGCTGAGGCAGGAGGG + Intergenic
1195766332 X:108299754-108299776 CTTATAAGGCTGAGGATAAAAGG + Intronic
1196310334 X:114156771-114156793 CTCGGGAGGCTGAGGCAAGAGGG - Intergenic
1196798909 X:119524633-119524655 CTTCGGAGGCTGAGGTTGGAAGG + Intergenic
1196847756 X:119910053-119910075 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
1196891895 X:120299419-120299441 CTTAGGAGGCTGAGGCAAGGGGG - Intronic
1197333937 X:125188223-125188245 CTTTGGAGGCTGAGGTGGGAGGG + Intergenic
1197592901 X:128430391-128430413 CACTGAGGGCTGAGGCTAGTAGG - Intergenic
1198186326 X:134257269-134257291 CTTGGAAGGCTGAGGCAGGCAGG - Intergenic
1198249711 X:134868210-134868232 CTTGGGAGGCTGAGGTGAGAGGG - Intergenic
1198485908 X:137087334-137087356 CACTGGAGGCTGAGGCAAGAAGG - Intergenic
1198798203 X:140422216-140422238 CTATGAAGGCTGATGCTTAAAGG - Intergenic
1199728960 X:150612085-150612107 CTTGGGAGGCTGAGGTGAGAGGG + Intronic
1199753144 X:150840091-150840113 CTCTGGAGGCTGAGGCTGGGGGG + Intronic
1199969593 X:152849686-152849708 ATTTCTAGGCTGAGGCAAGAAGG + Intronic
1200180832 X:154149848-154149870 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
1200186475 X:154186962-154186984 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1200192127 X:154224100-154224122 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
1200197882 X:154261904-154261926 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
1200427733 Y:3040015-3040037 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1200687280 Y:6267760-6267782 CTGGGAAGACTGAGGCTAGAGGG + Intergenic
1200766558 Y:7085083-7085105 TTTGGGAGGCTGAGGCCAGAGGG + Intronic
1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG + Intergenic
1201011222 Y:9549272-9549294 CCAGGAAGACTGAGGCTAGAGGG + Intergenic
1201047993 Y:9906950-9906972 CTGGGAAGACTGAGGCTAGAGGG - Intergenic
1201063343 Y:10067943-10067965 CTGGGAAGACTGAGGCTAGAGGG - Intergenic
1201243207 Y:11978644-11978666 CTTAGAAGGCTGAGTCCAGGAGG + Intergenic
1201269310 Y:12239108-12239130 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1201379013 Y:13352414-13352436 CTTGGGAGGCTGAGGTGAGAGGG - Intronic
1201727986 Y:17174576-17174598 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1202116013 Y:21469325-21469347 CCGGGAAGACTGAGGCTAGAGGG + Intergenic
1202263917 Y:22998311-22998333 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202416908 Y:24632053-24632075 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202453879 Y:25038033-25038055 CTTTGAAGGCAGAGCCACGATGG + Exonic