ID: 984971194

View in Genome Browser
Species Human (GRCh38)
Location 4:185192701-185192723
Sequence TCTGATCTTAAGAAGGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984971194_984971197 19 Left 984971194 4:185192701-185192723 CCTTTGACCTTCTTAAGATCAGA 0: 1
1: 0
2: 0
3: 19
4: 189
Right 984971197 4:185192743-185192765 TTTTTTTTTTTTTTTTGAGACGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984971194 Original CRISPR TCTGATCTTAAGAAGGTCAA AGG (reversed) Intronic
901352102 1:8606579-8606601 TTCCATCTTAAGAATGTCAATGG + Intronic
901801724 1:11712053-11712075 TCTGATCTTCAGATGTCCAAAGG + Intronic
904387808 1:30156615-30156637 ACTTATGTGAAGAAGGTCAATGG + Intergenic
908104111 1:60823807-60823829 TCTGTTCTCTAGAATGTCAAAGG + Intergenic
910245874 1:85137435-85137457 TCTCATATTAAGATGATCAAAGG - Intergenic
911404512 1:97420073-97420095 TCTGGTCTTAAGATGGTCCTGGG - Intronic
911591044 1:99748252-99748274 TATGATATCAAGAAGGACAAGGG + Intronic
916083606 1:161252388-161252410 TCTGATTTAAAGCAGATCAAGGG + Intergenic
916765676 1:167858197-167858219 TCTGTTCTTAAGAAGCTCACAGG + Intronic
918494425 1:185117611-185117633 TGTGATCTAAAGAAGGAAAATGG + Intergenic
918563577 1:185898673-185898695 TCTGATGACAAGAAGGTCCACGG + Intronic
918667860 1:187174347-187174369 CCTGATTTTAAAAAGGGCAAGGG + Intergenic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
922810697 1:228414100-228414122 TCTGCTCTTAGGAAGGCCGAGGG - Intronic
923128983 1:231058476-231058498 TCTGATCATAATAAAGTCACTGG + Intergenic
923757169 1:236802354-236802376 TTTGATATTTAGAAGGTCATTGG + Intronic
924129251 1:240888908-240888930 TCGGATTTTATGACGGTCAAAGG + Intronic
1064570442 10:16687252-16687274 CCTAATCCTATGAAGGTCAAAGG - Intronic
1064911909 10:20411461-20411483 TCTGTTCCTAAGAAGATAAAGGG - Intergenic
1065908410 10:30280005-30280027 TCTGATGTTAAAAATGTCAATGG - Intergenic
1068706500 10:60082018-60082040 TCAGGTCTTAAGTAGGTAAAAGG - Intronic
1069535981 10:69253424-69253446 TCTGACCTTAGGAAGGACACTGG - Intronic
1071174155 10:82904412-82904434 TCTCATTTTAAGGAGGGCAAAGG - Intronic
1071490732 10:86134795-86134817 TGGGATCATCAGAAGGTCAACGG - Intronic
1071888935 10:89981335-89981357 TCTCATCTTAAGATGCTCAGAGG - Intergenic
1073850552 10:107612364-107612386 GATGATCTTAAGAATCTCAATGG - Intergenic
1074664613 10:115706081-115706103 TCTGATCTTCAGAACTGCAAGGG - Intronic
1074812448 10:117119362-117119384 TCTGATTTTAAAATGGGCAAAGG + Intronic
1076288204 10:129322087-129322109 TCTGATGTCAAGAATGTGAAAGG - Intergenic
1077552544 11:3207438-3207460 TCAGATCTTATGAAGGACAGTGG + Intergenic
1079525584 11:21383850-21383872 TCTGATCTTGAGAAGCCAAAGGG - Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1082182998 11:49143267-49143289 TCTGTTATTAAGAAAGTAAATGG - Intergenic
1082259984 11:50071387-50071409 TTTGGTCCTAAAAAGGTCAACGG + Intergenic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1087301049 11:96435828-96435850 TCTGATTTTAAAATGGACAAAGG - Intronic
1087353170 11:97059789-97059811 TCAGGGCTTGAGAAGGTCAAGGG - Intergenic
1087459007 11:98422747-98422769 TCTGATTTAAAGCAGATCAAGGG - Intergenic
1088803713 11:113331651-113331673 TCTGATCTGAAAAAGGCCAAAGG + Intronic
1088818952 11:113440813-113440835 TCTGATCTTGAGAATTTCAGAGG + Intronic
1089713057 11:120330988-120331010 TCTAATGTTCAGAATGTCAAAGG - Intronic
1091504953 12:1057974-1057996 TCTGATTTTAAAATGGGCAAAGG - Intronic
1098732449 12:74054821-74054843 TCTCATTTTAAAAAGGTAAATGG + Intergenic
1099126753 12:78769226-78769248 TCTGATTTTAAAATGGGCAAAGG + Intergenic
1099679579 12:85807708-85807730 TCTGTTCTATAGAAGGTCAAGGG + Intronic
1102269534 12:111521303-111521325 TGTGATCTCAAGAAGGTTACAGG - Intronic
1106500834 13:30327358-30327380 CCTGATCTTCATAAGTTCAATGG - Intergenic
1106606449 13:31233750-31233772 TCTAATCTTTAGAAGGGAAAGGG + Intronic
1108868664 13:54954093-54954115 TGAGATCTTAGGAAGATCAAAGG - Intergenic
1109298625 13:60566456-60566478 TATGTTATTAATAAGGTCAAAGG + Intronic
1109983021 13:69935764-69935786 TGTGATTTTAAAAATGTCAAAGG + Intronic
1110827027 13:79983491-79983513 ACTGATTTTAACAAGGTCACAGG - Intergenic
1112352149 13:98645039-98645061 TCTAATGCTAAGAAGATCAATGG - Intergenic
1113271338 13:108678296-108678318 AATGATCTTGAGAAGGTCAGAGG - Intronic
1115913625 14:38284783-38284805 TCTGATTTTAAAATGGGCAAAGG + Intergenic
1119186293 14:72645115-72645137 TCACATCTTAAGCAGGTCACTGG + Intronic
1122189001 14:100025114-100025136 TCTTATCTTAAAAAGGAAAATGG - Intronic
1124159723 15:27257229-27257251 ACTGATTTTAAAAAGGACAAAGG - Intronic
1125054965 15:35347967-35347989 TCTAATTTTAAAATGGTCAAAGG - Intronic
1125088038 15:35754293-35754315 TCTGATTTGAAGAGGGTCACTGG + Intergenic
1126218951 15:46189985-46190007 CCTGATCTTACCAAGGACAAAGG + Intergenic
1126356864 15:47805307-47805329 TTTGTTCTTAAGGAGGTCAAAGG - Intergenic
1126540971 15:49823521-49823543 TCTGTTTTTAGGAAGGTAAATGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1132341936 15:101084494-101084516 TCTGAGCTCAAGGAGCTCAAGGG + Intergenic
1134235822 16:12465069-12465091 TCTGATTTTAAAATGGGCAAAGG - Intronic
1135186430 16:20319884-20319906 TCTGAGCTCATGGAGGTCAAGGG + Intronic
1136089783 16:27910489-27910511 TGTGACCTTAAGCAAGTCAATGG - Intronic
1136712118 16:32247424-32247446 TCTGACCTTAGGGAGGTTAAAGG - Intergenic
1136755796 16:32681980-32682002 TCTGACCTTAGGGAGGTTAAAGG + Intergenic
1136812317 16:33188392-33188414 TCTGACCTTAGGGAGGTTAAAGG - Intergenic
1136818793 16:33298472-33298494 TCTGACCTTAGGGAGGTTAAAGG - Intronic
1136825356 16:33355005-33355027 TCTGACCTTAGGGAGGTTAAAGG - Intergenic
1136830422 16:33453776-33453798 TCTGACCTTAGGGAGGTTAAAGG - Intergenic
1137011259 16:35322742-35322764 TCTGACCTTAGGGAGGTAAAGGG + Intergenic
1137014620 16:35362747-35362769 TCTACTTTTATGAAGGTCAAAGG + Intergenic
1141236487 16:82222575-82222597 TCTGATCTTAAAACGGACACAGG - Intergenic
1142328319 16:89433110-89433132 TCTGTTCTAAAGAAGCTGAATGG - Intronic
1202990894 16_KI270728v1_random:11362-11384 TCTGACCTTAGGGAGGTTAAAGG - Intergenic
1143354955 17:6320526-6320548 TCTCTGCTTTAGAAGGTCAAAGG - Intergenic
1148288755 17:46421243-46421265 TAAGATCTAAAGAAGGTAAATGG + Intergenic
1148310924 17:46638820-46638842 TAAGATCTAAAGAAGGTAAATGG + Intronic
1148953812 17:51337049-51337071 TCAGATCTTAAGAATGCCCAAGG - Intergenic
1149098675 17:52876215-52876237 TATGATCTTACAAAGGTCACAGG + Intronic
1153492419 18:5663318-5663340 TTAGATCTTGAGAAGGACAATGG - Intergenic
1155886596 18:31216459-31216481 TCTGATTTTAAAATGGGCAAAGG + Intergenic
1156577953 18:38340683-38340705 TGTGATCTTAAGAAGAGCCAAGG + Intergenic
1157398308 18:47362905-47362927 TCTGATTTAAAAAAGGGCAAAGG - Intergenic
1165347172 19:35255853-35255875 TCTGAACTCTAGAAGGGCAAGGG + Intronic
1165651206 19:37491873-37491895 TCTGATTTTAAGATGCGCAAGGG - Intergenic
925207743 2:2021545-2021567 TCTGATCTTAAGAAACTTAGAGG + Intronic
925477074 2:4229423-4229445 TCAGATCCTAACAAGATCAAGGG - Intergenic
926832349 2:16977530-16977552 TCTGATCTGTGGGAGGTCAAGGG - Intergenic
927438633 2:23092564-23092586 TCATCTCTTAAGAAGGTGAAAGG - Intergenic
928624409 2:33124930-33124952 ACTGATAATAAGAAGTTCAAAGG - Intronic
931801533 2:65763006-65763028 TATGATTTTAAGATAGTCAATGG + Intergenic
931879093 2:66547945-66547967 TCTGTTCTTCAGAAGGGTAAGGG - Exonic
933319406 2:80754721-80754743 TCTGATTTTAAAATGGGCAAAGG + Intergenic
934755350 2:96820659-96820681 TCTGCTCTTGCAAAGGTCAACGG - Intronic
937490468 2:122361897-122361919 TCTGATCACAAAAAGTTCAAAGG - Intergenic
938292081 2:130155722-130155744 TCTGTGCTGATGAAGGTCAAGGG + Intronic
939421090 2:141970101-141970123 TCTGATTTTAAAATGGGCAAGGG - Intronic
940247449 2:151634846-151634868 TATGCTCTTAATAAGGTCATGGG + Intronic
941338463 2:164274724-164274746 ACTGAACTTAATGAGGTCAAGGG - Intergenic
942776418 2:179587814-179587836 TCTGTTCATAAGAAGATCAAGGG + Intronic
942839572 2:180343428-180343450 TCACATATAAAGAAGGTCAATGG + Intergenic
942912963 2:181268386-181268408 CCTGACCTTAAGCAGCTCAAAGG + Intergenic
943413695 2:187571711-187571733 TTTTAATTTAAGAAGGTCAATGG - Intergenic
944195067 2:197043971-197043993 TCTGATCTTTTTAAAGTCAAGGG + Intronic
944781503 2:203022479-203022501 TCTGATCTTAAGGACCTAAAAGG + Intronic
944787846 2:203091798-203091820 TCTGATTTTAAAATGGGCAAAGG - Intronic
946755086 2:222936574-222936596 TCTGATTTTAAAATGGGCAAAGG - Intronic
946869535 2:224073368-224073390 ACAGATCTGAAGAAGGGCAATGG + Intergenic
1169304633 20:4477904-4477926 TCTGATTTAAAGATGGACAAAGG + Intergenic
1170094695 20:12633231-12633253 TCTGATTTCAAGTGGGTCAAGGG - Intergenic
1170187559 20:13608025-13608047 TCTCAGCTTTAGAAGGTTAAAGG - Intronic
1173405816 20:42763677-42763699 TGTGATCTTAAGAGAATCAATGG - Intronic
1174007502 20:47422102-47422124 TCTAATCTTAAGAAAATCAGAGG + Intergenic
1174802273 20:53574451-53574473 TCTGCTCTTAAGAAGTTTACAGG + Intronic
1177460550 21:21403118-21403140 TCTGATTTTAAAATGGGCAAAGG - Intronic
1177820528 21:26026341-26026363 TCTGAATTTAATAAGGTCAAAGG + Intronic
1178081887 21:29074495-29074517 TCTGATCTTAAAAGAGTAAAAGG - Intergenic
1178787812 21:35670175-35670197 TCTGATTTTAAAATGGTCAAAGG - Intronic
1178841378 21:36140198-36140220 TCTTAACCTAAGAAGGTGAATGG + Intronic
1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG + Intronic
950427939 3:12934768-12934790 TCTGCTCTCAGGATGGTCAACGG + Intronic
952682875 3:36116144-36116166 TCTGATTTTAAAATGTTCAAAGG + Intergenic
952987487 3:38799082-38799104 CCTGATATTAAGAAGGCAAAAGG - Intergenic
953247432 3:41207497-41207519 TCTGATGGTAACAAGGTGAAGGG - Intronic
954842489 3:53524157-53524179 TCTGCTCTTATCAAGTTCAAAGG - Intronic
954964273 3:54596726-54596748 TCTGGTTTTAAGAAGGTGCATGG - Intronic
957567274 3:81900663-81900685 TGTGATCTTGACAAGGACAAGGG + Intergenic
959154163 3:102646305-102646327 TCTGATTTTAAGGAGCTCAAGGG + Intergenic
963170893 3:142250265-142250287 TCTGATTTTAAAATGGGCAAAGG + Intergenic
963495543 3:146055503-146055525 TCTGATTTTAAAATGGGCAAAGG + Intergenic
963513071 3:146273899-146273921 TGTGACCATAACAAGGTCAATGG - Intergenic
964505045 3:157390341-157390363 TGTAATTTTAAGAAAGTCAAAGG + Intronic
964542747 3:157797966-157797988 TTTCCTCTTAAGAAGGTCAAAGG - Intergenic
964939359 3:162136361-162136383 TCTGATTTTAAGCAGGGCCAGGG + Intergenic
965544823 3:169904310-169904332 CCTGATCTTAAAATGGGCAAAGG + Intergenic
965700952 3:171459298-171459320 GCTGAACTTAAGCAGGTGAAAGG - Intronic
968398025 4:261522-261544 TCTGATCTGAAGAAGTGCCATGG - Intergenic
969353514 4:6611898-6611920 TCTGATCTACAGAAGCTCAGTGG - Intronic
970396907 4:15677591-15677613 TCTGATCATTGGAAGCTCAAGGG + Intronic
976120938 4:81780585-81780607 TATTATTTTAAGAAGGTGAAGGG - Intronic
976320806 4:83713139-83713161 TCTGATCTTAGCAAGTTAAATGG - Intergenic
977786774 4:101044645-101044667 TCAGAACTTAAAAAGGTGAAAGG - Intronic
982023183 4:151224583-151224605 TCCAATCTTCAGAATGTCAAAGG + Intronic
982540791 4:156667882-156667904 TATGTTCTTAAGAAGGACATAGG - Intergenic
983510721 4:168606866-168606888 TCTGATCTCAGGAAGGCCTAGGG - Intronic
984971194 4:185192701-185192723 TCTGATCTTAAGAAGGTCAAAGG - Intronic
986730226 5:10629913-10629935 TCTCATTGTAAGAAGGTCACTGG + Intronic
990696554 5:58424492-58424514 CCTGATTTTAAGAATGTTAATGG + Intergenic
991633178 5:68677431-68677453 AATGATCTTCAGGAGGTCAAGGG - Intergenic
992993331 5:82307661-82307683 TAAGATCTTAAGAAGGAGAATGG + Intronic
996907350 5:128616167-128616189 TCTTATTTTAAGTAGGTCAAAGG + Intronic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
1000073059 5:157759003-157759025 TCTGATCATAAGATGGTCCCTGG - Exonic
1001837137 5:174842018-174842040 TCTGATGTTGTCAAGGTCAAGGG - Intergenic
1005777468 6:29151452-29151474 GTGGATCTTATGAAGGTCAAGGG - Intergenic
1006189387 6:32198359-32198381 TCTGATTCTAATAGGGTCAAAGG + Intronic
1007138015 6:39541703-39541725 CCTAATCTGAAGAAGGTCAAGGG + Intronic
1007803194 6:44415652-44415674 TGTGTTCTTAAGAAGGGAAAGGG - Intronic
1008418341 6:51268821-51268843 TCTGATGTTGACGAGGTCAAGGG - Intergenic
1008999085 6:57692135-57692157 TCTGATTTTAAAATGGGCAAAGG + Intergenic
1009629653 6:66178693-66178715 TATGAGATTATGAAGGTCAAGGG - Intergenic
1010605320 6:77882562-77882584 TCTGATGGTAAGAAGGTCAGAGG - Intronic
1011978335 6:93336701-93336723 TCTGTTCTTAAAAGGGTAAAAGG - Intronic
1013705136 6:112824183-112824205 TCTGATTTTAAAATGGCCAAAGG + Intergenic
1016789790 6:148056074-148056096 TACGATCTTAAGAAGATCTAAGG - Intergenic
1016851869 6:148628234-148628256 TCTGATTTGAAGAAGGGTAAAGG + Intergenic
1017237123 6:152128307-152128329 TCTAATTTTAAGAAGTTCTAGGG + Intronic
1019225540 6:170504575-170504597 TCTGATCTCATGAAGCTTAATGG + Intergenic
1021541412 7:21763004-21763026 TCTGATTTTAAAATGGGCAAAGG + Intronic
1021727687 7:23565372-23565394 TCTGATTTTAAAATGGTCAAAGG - Intergenic
1025958391 7:66200028-66200050 TTTGCTCTTAAGAAGGACACAGG - Intergenic
1026624586 7:71980970-71980992 GCTGATCTTAAGAAGGCCACAGG + Intronic
1027518058 7:79167349-79167371 TCTCATATTAAGAAGGAAAAAGG - Intronic
1035277458 7:157756574-157756596 GCTGAGCTTTAGAAGGTTAAAGG - Intronic
1035884575 8:3278065-3278087 TCTGATCTTTAGAGTTTCAAGGG + Intronic
1037221790 8:16532322-16532344 ACTGGTTTTAAGAAGGTCACAGG - Intronic
1038559182 8:28555810-28555832 TCCTATCATAAGAAAGTCAAGGG + Exonic
1043114935 8:76238917-76238939 TATGATCTTAAGAATATCAGTGG + Intergenic
1043743572 8:83844592-83844614 TCTGAACTTCAGAATGTGAAGGG - Intergenic
1044690440 8:94871640-94871662 TCTTTTCTTCAGAATGTCAAAGG - Intronic
1046842663 8:118877419-118877441 TCTGTTCTTATGAATTTCAAAGG + Intergenic
1046853026 8:118997112-118997134 TCTGATTTTAAAATGGGCAAAGG - Intronic
1048262052 8:132953379-132953401 TCTGTTCTTAAGGAGCTCACAGG + Intronic
1052542573 9:29829252-29829274 TCTGATTTTAACCCGGTCAATGG + Intergenic
1053108605 9:35437117-35437139 TCTGATCTCAAGATGTTCACAGG - Intergenic
1055037607 9:71835165-71835187 TCTGATTTTAAAAAGGGCAAAGG + Intergenic
1056001774 9:82225383-82225405 TCTTACCATAAGAAGGTTAAGGG - Intergenic
1057511445 9:95682914-95682936 TCTGATGGAAAAAAGGTCAAAGG + Intergenic
1059665888 9:116446319-116446341 TCTGATCTCAAGAAACTCAGAGG - Intronic
1060222620 9:121772731-121772753 CCTGATCTTCAGATGGCCAACGG + Exonic
1061458944 9:130720695-130720717 TATGATCTGAAGGAGGACAAGGG + Intronic
1185860771 X:3577227-3577249 ACTAATCTTAGGAAGGGCAAAGG - Intergenic
1186010721 X:5129296-5129318 TCTGATGTGATGAATGTCAAAGG + Intergenic
1187011084 X:15280605-15280627 TCTGATTTTAAAATGGGCAAAGG + Intergenic
1188800565 X:34524738-34524760 TCTTATCTTGAGCAGGTAAAAGG - Intergenic
1189059921 X:37742423-37742445 TCTGATTTTAAAAAGGGCAAAGG + Intronic
1191021143 X:55861494-55861516 TCTGATTTTAAGATGTTCAAAGG + Intergenic
1192032199 X:67525578-67525600 CCTGCTCTTCAGAAGCTCAAAGG + Intergenic
1192147197 X:68689601-68689623 TCTGAGCTTAGGGAGGGCAAGGG + Intronic
1193180870 X:78455039-78455061 TCTGATCATAAAAAGGAGAAGGG - Intergenic
1195449693 X:104997495-104997517 TCTGATCTTTTGAAGATCACAGG + Intronic
1197781217 X:130162342-130162364 TCTGATCATATGAATGTCAAGGG + Intronic
1200314135 X:155113802-155113824 TCTGATTTTAAAATGGGCAAAGG + Intronic
1201947226 Y:19524361-19524383 TCTTATCTTCAGAAAGACAAAGG - Intergenic