ID: 984973216

View in Genome Browser
Species Human (GRCh38)
Location 4:185209146-185209168
Sequence CCTTCCCTAAGGCGGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984973208_984973216 27 Left 984973208 4:185209096-185209118 CCATAGCTAGGAATTGCAGGCTT 0: 1
1: 0
2: 2
3: 11
4: 101
Right 984973216 4:185209146-185209168 CCTTCCCTAAGGCGGCAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 147
984973210_984973216 -7 Left 984973210 4:185209130-185209152 CCGCACGTGTCTGATTCCTTCCC 0: 1
1: 0
2: 1
3: 12
4: 185
Right 984973216 4:185209146-185209168 CCTTCCCTAAGGCGGCAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 147
984973209_984973216 -4 Left 984973209 4:185209127-185209149 CCACCGCACGTGTCTGATTCCTT 0: 1
1: 0
2: 0
3: 13
4: 195
Right 984973216 4:185209146-185209168 CCTTCCCTAAGGCGGCAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984973216 Original CRISPR CCTTCCCTAAGGCGGCAGGG TGG Intronic
900415158 1:2531408-2531430 CCTCCCCTAAGGACCCAGGGTGG - Intergenic
901801274 1:11709449-11709471 CCTTACCTGGGGCCGCAGGGAGG - Exonic
901937434 1:12636472-12636494 GCTTCCCTTGGGAGGCAGGGTGG - Intergenic
902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902700378 1:18168095-18168117 CCACCCCAAAGGCAGCAGGGTGG - Intronic
903774634 1:25784985-25785007 CCTACCCTACGGGGTCAGGGAGG + Exonic
905251574 1:36652257-36652279 CCTTCCCTAAGGCAGGAGCAGGG + Intergenic
907497140 1:54852670-54852692 CCTTCCCTAATGGAGCAGTGGGG + Intronic
912651670 1:111445281-111445303 CCTTCCCTGAGGCAGAAGGATGG + Intronic
914411976 1:147438274-147438296 GCTTCCCTAATGCTGCAGTGTGG + Intergenic
916776019 1:167965331-167965353 CCTTCCCCAATGCGGAAGGCTGG + Intronic
919969602 1:202565839-202565861 CCTGCCATAAGGCAGCGGGGTGG + Intronic
922992317 1:229924854-229924876 CCTTCCCTCAAGGGGAAGGGAGG - Intergenic
1063663672 10:8049807-8049829 CCTTCCCTATGGTGGGAGGAGGG - Intergenic
1063930079 10:11018854-11018876 CCTTTCCTAAGGTGGGAGAGGGG + Intronic
1065944095 10:30591474-30591496 CCATCCCTTAGGCAGCAGAGCGG - Intergenic
1067289267 10:44929526-44929548 CCTGCCCTGAGGCGGGAGGGTGG - Intronic
1067564642 10:47327685-47327707 CCCTTCCTAAGGAGGCAGAGGGG + Intergenic
1069158065 10:65053952-65053974 CAATCCCTAAGGCAGCCGGGCGG - Intergenic
1072296582 10:94014221-94014243 CCTTCCCTAAGGCAGCTAAGAGG + Intronic
1072548274 10:96457253-96457275 CTTTCCCTGAGGAGGCAGGGAGG - Intronic
1072728461 10:97829103-97829125 ACTTCCCTATGGCTCCAGGGTGG - Intergenic
1074533209 10:114310961-114310983 CCTTCCCAGAGGCGGGCGGGCGG - Intronic
1074757458 10:116635104-116635126 TCTTCCCCCAGGCAGCAGGGTGG + Intronic
1074825773 10:117214969-117214991 CACTCACTAAGACGGCAGGGAGG - Intergenic
1075068248 10:119303957-119303979 CCTACCCTAAAGCGCCAGGGTGG + Intronic
1075141927 10:119845548-119845570 GGTTCCCTAAGGAGGCTGGGTGG + Intronic
1075277844 10:121111070-121111092 CCTTCAATAAGGAGGTAGGGAGG - Intergenic
1077053254 11:577021-577043 CTCTCCCAAACGCGGCAGGGCGG - Intronic
1080196132 11:29611599-29611621 CCTTCCCCAAAGGGGCAGGTGGG + Intergenic
1080636684 11:34130637-34130659 CCTGTCCAAAGGAGGCAGGGTGG - Intronic
1083708422 11:64532301-64532323 CCTTCCATGAGGCTGCAGGAGGG + Intergenic
1083942949 11:65907716-65907738 CTATCCCTAAGGCTGCAGGGTGG - Intergenic
1084780139 11:71402652-71402674 CATTCCCTTAGACGGCATGGTGG - Intergenic
1084965394 11:72741801-72741823 CCTTCCCTCTTGGGGCAGGGTGG - Intronic
1085464730 11:76715986-76716008 CCTTACCTAAGCAGGCAGGAGGG + Intergenic
1085765857 11:79280844-79280866 GCTTCCCTAAGGGAGCAGGCAGG - Intronic
1088388988 11:109292316-109292338 CCTTCCTCATGGCAGCAGGGTGG - Intergenic
1089671353 11:120059051-120059073 GGTTCCCTAAGAAGGCAGGGAGG + Intergenic
1091235270 11:134017950-134017972 CCTTCCCCCAGGAGGCAGGATGG - Intergenic
1093765459 12:22956928-22956950 CCTGCCCTAAGGCATCTGGGAGG - Intergenic
1094838668 12:34333982-34334004 CCAGCCCAAAGGGGGCAGGGAGG + Intergenic
1094847781 12:34368924-34368946 CCTAGCCCAAGGCGGCAGGAAGG - Intergenic
1095983369 12:47984925-47984947 CTTTCCCCAAGAGGGCAGGGAGG + Intronic
1103088070 12:118077336-118077358 CTTTTCCTAGGGTGGCAGGGAGG - Intronic
1106690282 13:32107756-32107778 CCTGCCCTGAGGAGCCAGGGAGG + Intronic
1107740127 13:43441655-43441677 CCTGCCCGAAGGCGGCACTGCGG + Intronic
1111948922 13:94694327-94694349 CCTTACATATGGCTGCAGGGAGG + Intergenic
1112494541 13:99894724-99894746 CCTTGCCTGAGGCGGGGGGGGGG + Exonic
1114788147 14:25624863-25624885 TCTTCCCTCAGGAGGAAGGGAGG + Intergenic
1118610041 14:67533001-67533023 TCGTCCCTGGGGCGGCAGGGAGG - Intronic
1118744410 14:68763334-68763356 CCATCCCTAGGGAGCCAGGGAGG - Intergenic
1119952335 14:78758027-78758049 CATCCTCTAAGGCTGCAGGGAGG - Intronic
1120710211 14:87785697-87785719 CCTTCCCTAGGGCTGGGGGGTGG - Intergenic
1122112087 14:99510170-99510192 CCTCACCTAAGGCAGCAGCGAGG - Exonic
1122422983 14:101589112-101589134 CCTTGCCCAAGGCCACAGGGGGG + Intergenic
1125504870 15:40261876-40261898 TCTTCCCAGAGGCAGCAGGGAGG - Intronic
1126950353 15:53873704-53873726 CCTTCCATGAGGCGGAAAGGGGG + Intergenic
1127800280 15:62471816-62471838 TCTTCCCAAAGGCTGCAGGCAGG + Intronic
1128058588 15:64718909-64718931 CTTTCTCTCAGGCGTCAGGGCGG - Intergenic
1128306351 15:66601363-66601385 TCATCCCTCAGGCTGCAGGGAGG - Intronic
1129607264 15:77030995-77031017 CCAGCCCTGAGGCTGCAGGGAGG - Intronic
1129755395 15:78094977-78094999 GCTTCCCTAAGTAGGGAGGGAGG + Intronic
1132666252 16:1082587-1082609 CCTTCCCTGGGGCAGCATGGGGG - Intergenic
1133790958 16:9008839-9008861 CCTTCCCTAGGGGCGCAGGGAGG + Intergenic
1134729265 16:16447149-16447171 CCTTATCTAAGGAGGCAGCGAGG - Intergenic
1136576418 16:31127892-31127914 ACTTTCCTAAGGCTGCTGGGAGG + Intronic
1138082366 16:54102757-54102779 CCTTCTCCAAGGCAGCAGGATGG + Intronic
1139557095 16:67719229-67719251 CCTTCCTTAAGGCGGATGGGTGG - Exonic
1142509448 17:385119-385141 CCTGCCCTCAGGCTGCCGGGAGG + Intronic
1142613822 17:1123908-1123930 CCTGCCCTAAGACGGGAGGCGGG - Intronic
1144606181 17:16667182-16667204 CAATCCCTAAGGCAGCCGGGCGG + Intergenic
1145006500 17:19341577-19341599 CCTTAGCTAAGCTGGCAGGGAGG + Intronic
1145089788 17:19977495-19977517 CTTTCCCCAAGGCGGCAGCAAGG - Intronic
1145250888 17:21296484-21296506 CCCTCCCTGAGGCGGAAGGAGGG - Intronic
1145900109 17:28485119-28485141 CCTTCCCCAGGCCAGCAGGGTGG - Intronic
1147419044 17:40312923-40312945 CCTTCCCTACTGCAGCAAGGAGG + Intronic
1148437741 17:47695886-47695908 TTTTCCCCAAGGCGGCAGAGAGG + Exonic
1148572142 17:48678585-48678607 CCTTCCCTCGGGCGGCCGGCAGG + Intergenic
1148684734 17:49495182-49495204 CCCACCCCGAGGCGGCAGGGCGG + Intergenic
1148784702 17:50140407-50140429 CCTTCCCAAGGGAGGCAGGAAGG + Intronic
1149660632 17:58332464-58332486 CCTTACCTGAGGCTGCAGGGCGG + Intergenic
1151348836 17:73519584-73519606 ACTCCCCTAAGGAGGCTGGGAGG - Intronic
1152255609 17:79237656-79237678 CCCTCCCTGATGCGGCTGGGAGG - Intronic
1152461662 17:80445150-80445172 CCTTCCCCAGGGAGTCAGGGAGG + Intergenic
1152872838 17:82767151-82767173 CCTTGCCTCAGACGGCAGCGGGG + Intronic
1153815274 18:8785435-8785457 CCTCCCCAGCGGCGGCAGGGCGG - Intronic
1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG + Intronic
1160920963 19:1520382-1520404 CCTTCCGGCAGGCGCCAGGGTGG - Intergenic
1160991238 19:1861145-1861167 CGGTCCCTAAGCCAGCAGGGAGG - Intronic
1161188457 19:2939030-2939052 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188465 19:2939065-2939087 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188474 19:2939100-2939122 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188483 19:2939135-2939157 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188492 19:2939170-2939192 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188501 19:2939205-2939227 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188510 19:2939240-2939262 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161852193 19:6743437-6743459 CCATCCCAAAGACAGCAGGGTGG - Intronic
1162145231 19:8609289-8609311 CCTCCCCGAAGGCAGGAGGGAGG + Intronic
1162689186 19:12414508-12414530 CCTTCCCTCCTGCTGCAGGGTGG - Intronic
929246564 2:39709206-39709228 GGTTCCTTAAGGCTGCAGGGTGG - Intronic
932498471 2:72159621-72159643 CGTTCCCTAAGGAGGCTTGGAGG + Intergenic
934713246 2:96528948-96528970 CCCTCCCTATGGCTGCAGGCTGG - Intergenic
935523637 2:104140352-104140374 CCTTCCCTGAGGCATCAGGGAGG - Intergenic
936253687 2:110889502-110889524 TCTTGTCTAAGGCTGCAGGGAGG - Intronic
948892983 2:240916132-240916154 CCTTCCCCACGGCTCCAGGGTGG - Intergenic
1168755039 20:310423-310445 CCTTTCCGGAGGGGGCAGGGCGG - Intergenic
1171414504 20:24968485-24968507 CTTTCCCTGAGGAGGCAGAGAGG + Intronic
1173229811 20:41185352-41185374 CATTCCCTCAGGCTGGAGGGTGG - Intronic
1174367580 20:50065697-50065719 CCTTCCCAAAGGCCCCAAGGTGG - Intergenic
1178152114 21:29807267-29807289 CCTTCCCTGTGGCGGCTGTGGGG + Intronic
1179416006 21:41199316-41199338 CCCTCCAGAAGGAGGCAGGGAGG - Intronic
1179545378 21:42109711-42109733 TCTTCCCAGAGTCGGCAGGGGGG - Intronic
1180137340 21:45870455-45870477 CCCTTCCTAGGGCAGCAGGGAGG + Intronic
1183349162 22:37325048-37325070 CCCTCCCGGCGGCGGCAGGGAGG - Intergenic
1185281926 22:49975937-49975959 CCTTCCCTAAGGAGGCCGGAGGG + Intergenic
953194665 3:40721074-40721096 CCTTCCCTGATGCTGCAGAGAGG - Intergenic
954163440 3:48738369-48738391 AATTCCCTAAGGAGGGAGGGAGG + Intronic
954633165 3:52057651-52057673 CTTTCCCTACGGAGCCAGGGTGG + Intergenic
956239512 3:67114007-67114029 CCTTCCACTAGGGGGCAGGGTGG + Intergenic
956894725 3:73648417-73648439 CCTTCCCAAAGGCCCCAGTGGGG + Intergenic
962702130 3:138010191-138010213 GCTTCTCGCAGGCGGCAGGGCGG + Exonic
965863701 3:173178818-173178840 CCTTCCCTGAGGCTGGAGTGTGG + Intergenic
970487865 4:16542465-16542487 CCTTCCCATAGGCCGGAGGGAGG + Intronic
980130250 4:128811240-128811262 CCTGCCCGAAGGCGGGCGGGGGG - Intronic
981295653 4:143127813-143127835 CCTTCCCTAGGGGGACAGGTTGG - Intergenic
984973216 4:185209146-185209168 CCTTCCCTAAGGCGGCAGGGTGG + Intronic
998413749 5:141930289-141930311 CCTGCCCCAAGGCAGGAGGGTGG + Intronic
999743578 5:154575003-154575025 CCCTCCCCAAGGCAGCAGTGGGG - Intergenic
1000794574 5:165648993-165649015 CCTTCCCTAATGTGGTAGGGTGG - Intergenic
1001638483 5:173229363-173229385 CCATGCCTAGGGCGCCAGGGAGG - Intergenic
1005465674 6:26109984-26110006 CCTTGCCTAAGGGGACAGTGTGG + Intergenic
1007813152 6:44500486-44500508 CCTTTCCTAAGGTGGGTGGGAGG - Intergenic
1013467635 6:110431129-110431151 CCCTCCCCAAGGGGGCACGGAGG - Intronic
1015568187 6:134595269-134595291 CCTTGCCTGAGGAGGCTGGGCGG + Intergenic
1018824850 6:167401361-167401383 CCTTTGCTAATGCGTCAGGGTGG + Intergenic
1019910521 7:4097713-4097735 CCTTCCATAAGGAGGGAAGGAGG - Intronic
1022467889 7:30663634-30663656 CCTTCCCAAAGGAGGCAGGGAGG + Intronic
1023819086 7:43970449-43970471 CCTCCCCTAGGGCTGCTGGGAGG + Intergenic
1023819135 7:43970713-43970735 CCTCCCCTAGGGCTGCTGGGAGG + Intergenic
1024027936 7:45430111-45430133 CCTTCCCCAAGGTGAGAGGGTGG - Intergenic
1029744139 7:102507408-102507430 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029744186 7:102507676-102507698 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029762130 7:102606571-102606593 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029762177 7:102606838-102606860 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1034346171 7:150386638-150386660 CCCTCCCTGAGGCAGCAGGAAGG + Intronic
1042867208 8:73366535-73366557 TCCTCCCTGAGGCGGCAGTGTGG + Intergenic
1048581635 8:135733807-135733829 CCTTCTCTCAGGCTGCAGTGAGG + Intergenic
1049187429 8:141264695-141264717 TCTCCCCGAAGGCGTCAGGGTGG - Intronic
1049561076 8:143310587-143310609 CTTTCCCTAAGGAGGCAGGAAGG - Intronic
1049769852 8:144374712-144374734 CCTGCCCTGAGGCGGCGGGCGGG + Intronic
1050704092 9:8376199-8376221 TCTTCCCAAAGGCTACAGGGTGG - Intronic
1056722418 9:89083119-89083141 CCTTCCCCATGGAGGCAGGGTGG - Intronic
1056752352 9:89361888-89361910 CCTTGGCTAAGTCTGCAGGGAGG + Intronic
1057501570 9:95600826-95600848 CCTTCCCCAAAGGGTCAGGGAGG + Intergenic
1059387896 9:113979255-113979277 CAGGCCCTAAGGCGACAGGGTGG - Intronic
1062301866 9:135878137-135878159 CCTTTCCTCAGACGGCAGGGAGG + Intronic
1185484377 X:471045-471067 CCTTCCAGAGGGCGGCAGTGGGG + Intergenic
1190115025 X:47620524-47620546 CCTTGCCCAAGGTGGCAAGGGGG + Intergenic
1198026785 X:132714815-132714837 CCTTCCCTGAGGAGCCAGTGTGG - Intronic
1202137112 Y:21676920-21676942 CATTGCCCAGGGCGGCAGGGCGG + Intergenic