ID: 984973489

View in Genome Browser
Species Human (GRCh38)
Location 4:185210134-185210156
Sequence CAGGATCCCCAGCAGGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 1, 2: 4, 3: 57, 4: 463}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984973489_984973492 -5 Left 984973489 4:185210134-185210156 CCGCCTTCCTGCTGGGGATCCTG 0: 1
1: 1
2: 4
3: 57
4: 463
Right 984973492 4:185210152-185210174 TCCTGTTTGCCCTCGTCTGCCGG 0: 1
1: 0
2: 2
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984973489 Original CRISPR CAGGATCCCCAGCAGGAAGG CGG (reversed) Intronic
900029883 1:363689-363711 CAGGCTCCCAAGCAGTAATGTGG + Intergenic
900050535 1:592753-592775 CAGGCTCCCAAGCAGTAAGGTGG + Intergenic
900346340 1:2212287-2212309 CAGGATCCGGAGCAGGAGGGTGG + Intronic
900510939 1:3060799-3060821 AGGGGTCCCCAGCAGGATGGGGG - Intergenic
900749229 1:4383822-4383844 CAGGCTCCCCAGCTTGAAGGTGG - Intergenic
901040043 1:6358305-6358327 CAGGCCCCCAAGCAGGACGGGGG + Intronic
901056932 1:6452760-6452782 CAGTATCGGCAGCTGGAAGGCGG - Intronic
901089637 1:6632745-6632767 CTGCATCACCAGCAGGAAGGCGG - Intronic
901371743 1:8804693-8804715 CATTCTCACCAGCAGGAAGGAGG - Intronic
901808002 1:11749967-11749989 CAGGATGCCCAGCCCGAGGGTGG + Intronic
902242859 1:15100319-15100341 CAGGACCCTCAGCAGGAGGGTGG + Intronic
902477443 1:16695735-16695757 CAGTATCGGCAGCTGGAAGGCGG + Intergenic
903180562 1:21602970-21602992 CAGGATCCCCAGAGGGGATGTGG - Intronic
903330186 1:22593237-22593259 CAGGATCCCCAGGTGGAACCTGG + Intronic
903460449 1:23516959-23516981 CAGCAACCCCAGTGGGAAGGGGG - Intronic
903502134 1:23806516-23806538 GCGGATCCCTAGCAGGGAGGGGG - Intronic
904276903 1:29390810-29390832 CCAGTTCCTCAGCAGGAAGGAGG - Intergenic
904372500 1:30058762-30058784 CAGGATCCAGGACAGGAAGGGGG + Intergenic
904478821 1:30781767-30781789 CAGAGTCCCCACCAGCAAGGAGG + Intergenic
905043171 1:34976851-34976873 CGCGAGCACCAGCAGGAAGGCGG + Intergenic
905106437 1:35565971-35565993 CTGGCTCCCCTGCAGGAGGGAGG + Exonic
906499148 1:46328339-46328361 CAAGATGCCCAGCAAGATGGCGG + Intergenic
906534298 1:46543303-46543325 CAGTATCCCCAGCGGGGGGGCGG + Intergenic
908303925 1:62791538-62791560 CAGAATCCCCACCAGCAAGAAGG - Intronic
908421132 1:63959526-63959548 CAAGATCCTTAGAAGGAAGGAGG - Intronic
909742710 1:79051438-79051460 CAGAATCCCCTGCAGGAATTTGG + Intergenic
910438722 1:87231056-87231078 GAGGAGGCCCAGCAGGGAGGAGG - Intergenic
910499851 1:87877691-87877713 CAGCATTCAAAGCAGGAAGGAGG + Intergenic
914444461 1:147738265-147738287 AAGTGTCCCCAGCAGCAAGGAGG - Intergenic
915030682 1:152878199-152878221 CAGACTCTCCAGCAGGCAGGGGG + Intergenic
915135556 1:153728717-153728739 CAGGAGCCCCAGGAGGGGGGAGG + Exonic
915658749 1:157383360-157383382 CAGAATCCCCACCAGCAAGAAGG + Intergenic
916579149 1:166092298-166092320 CAGCATCCCCCACTGGAAGGAGG - Intronic
917525526 1:175785013-175785035 CCGGAACCCCAGCAGGCTGGGGG + Intergenic
917747152 1:178021363-178021385 CAGGAGCCACAGCAGGGATGTGG - Intergenic
918454021 1:184688506-184688528 CAGGAACCACAGAAGGAAGGTGG + Intergenic
919132769 1:193472294-193472316 CAGGATTCCCAGCATGAAAGTGG - Intergenic
919510480 1:198457278-198457300 CAGAATCCCCACCAGCAAGAAGG - Intergenic
919518274 1:198554751-198554773 GAGAATCCCCAGGAGGAAAGGGG - Intergenic
919991498 1:202710665-202710687 CTGCTTCCCCAGCAGGAAGGCGG + Intergenic
920125882 1:203693370-203693392 CAGTATGCCCTGCAGCAAGGCGG - Intronic
920185210 1:204155170-204155192 TAGGATTCCTGGCAGGAAGGGGG + Exonic
920995874 1:210990545-210990567 CAGGCTCCCCATCAGTAAGATGG + Intronic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921161408 1:212474820-212474842 CAGGACTCCAAGCAGAAAGGGGG + Intergenic
922421867 1:225465831-225465853 CCCGAGGCCCAGCAGGAAGGGGG + Intergenic
922496467 1:226062132-226062154 AACGCTCCCCAGCAGGAAGCTGG - Intronic
923268980 1:232337712-232337734 CAGGATCCCCACTAGCAAGAAGG + Intergenic
924498560 1:244614040-244614062 CAGAGTCCCCACCAGGAAGATGG + Intronic
1062802747 10:392223-392245 CAGCTTCTGCAGCAGGAAGGCGG + Intronic
1063585348 10:7347263-7347285 CAGGTTGCCCAGCAAGAAAGAGG - Intronic
1064309065 10:14195669-14195691 CATGATTCCCAGCAGGAAGGTGG + Intronic
1064691968 10:17927567-17927589 CAGATTCACCAGCAGGAAGTGGG + Intergenic
1065620344 10:27574710-27574732 CATGATCTCCAGCAGGAAGATGG - Intergenic
1067016029 10:42756765-42756787 CAGGACCCCCAGCTGGCTGGTGG - Intergenic
1067782067 10:49215000-49215022 CTGGAACCCCAGAAGCAAGGGGG + Intergenic
1068939158 10:62664059-62664081 CAAGATTCACACCAGGAAGGAGG + Intronic
1070757352 10:79001641-79001663 CAGTGTCCCCAGCAGGCAGGAGG + Intergenic
1071529543 10:86378098-86378120 CAAGATCCGAAGCAGGAAGAGGG + Intergenic
1071712983 10:88067865-88067887 CTGGAGCACCATCAGGAAGGGGG + Intergenic
1072788141 10:98298427-98298449 CAGGTCACCCAGCAGGAATGTGG - Intergenic
1072945641 10:99807752-99807774 CAGGATGCACAGCAAGAATGTGG + Intronic
1073903513 10:108250330-108250352 CAGCATGCCAAACAGGAAGGTGG - Intergenic
1074357771 10:112801156-112801178 CAGGATGGCCAGCAGGAGGTGGG + Intronic
1074776184 10:116769922-116769944 GAGCATACCCAGCTGGAAGGCGG - Intergenic
1075228786 10:120653668-120653690 CAGACTCACCAGCAGCAAGGAGG + Intergenic
1075452706 10:122563220-122563242 GAGGATCCACAGCAGGCAAGTGG - Intronic
1076381620 10:130027809-130027831 CAGGATCCCCCGTAGAGAGGAGG - Intergenic
1076446177 10:130515866-130515888 CAGTTTTCCCAGGAGGAAGGTGG - Intergenic
1076729400 10:132430977-132430999 CAGGGTCCCGAGAAGGAAGATGG + Intergenic
1077081073 11:724994-725016 CAGGATCCCCAGCCTGTTGGAGG + Intronic
1077294998 11:1822371-1822393 CAGGATGCTGAGCAAGAAGGAGG - Intergenic
1077476069 11:2791200-2791222 CAGGTGCCCGAGCAGGACGGTGG + Intronic
1078475412 11:11624986-11625008 AATGATCCCCAGCAGGAGGCAGG - Intergenic
1081197985 11:40184893-40184915 CAGGAAGCGCAGCAGAAAGGAGG - Intronic
1081660328 11:44884275-44884297 CAAGGTCCACAGCAGGCAGGCGG + Intronic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083198034 11:61102592-61102614 CAGCATCCCCAGCAGGTACAAGG - Exonic
1083572085 11:63766280-63766302 CAAGATCTTCAGCTGGAAGGGGG - Exonic
1083731520 11:64654936-64654958 TAGGATCCTGAGCAGGAAGTAGG + Intronic
1083756057 11:64792232-64792254 CAGGGCGGCCAGCAGGAAGGTGG + Exonic
1084213578 11:67634884-67634906 CAGGATCTTCACCTGGAAGGGGG + Exonic
1084407031 11:68980061-68980083 GAGGAGCCCGAGCTGGAAGGTGG - Exonic
1084568186 11:69943527-69943549 CAGCTTCCCCAGGAGGCAGGAGG - Intergenic
1084940362 11:72609370-72609392 CACTTTCCCCAGAAGGAAGGTGG + Intronic
1085199238 11:74691774-74691796 CAGGAACCGCTGTAGGAAGGTGG - Intergenic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085258971 11:75193473-75193495 CAGCATCCCCAGCAGGCAAAGGG - Exonic
1085530182 11:77187822-77187844 CAGTTTCCCCATCAGGAAAGTGG - Intronic
1085724615 11:78943209-78943231 CAGGAGGCCCTGGAGGAAGGGGG + Intronic
1088024171 11:105157449-105157471 CAGGATCCCAATCAAGAAAGAGG - Intergenic
1088895095 11:114072487-114072509 CAGGACCCCCATCAGTAAGGTGG - Intronic
1089344463 11:117781948-117781970 CAGGCTCCTCAAGAGGAAGGGGG - Intronic
1089608080 11:119653416-119653438 CAGTGTCCCCTGCAGGAGGGTGG + Intronic
1089622425 11:119729415-119729437 CCGGCTCCCCAGCTGGAAGGCGG - Intergenic
1089688860 11:120173589-120173611 CAGGAGCCACATCAGGACGGTGG + Intronic
1090033009 11:123223459-123223481 CAGGGTCCCCATCAGCAAGAGGG + Intergenic
1091103201 11:132894879-132894901 CAGGATCCCCAGCATGTAGATGG + Intronic
1091951521 12:4596865-4596887 CAGAATGCCCAGGAGCAAGGAGG + Intronic
1095369873 12:41454331-41454353 CAGGAACCTCAGGAGGAAAGAGG - Intronic
1096071441 12:48777577-48777599 GAGGATGCCCAGCAGGGCGGGGG - Intronic
1096154592 12:49334947-49334969 CTGGATGTCCAGCATGAAGGGGG - Intronic
1096263141 12:50105183-50105205 CAGGAACCCCAGCTGGGAAGGGG - Intronic
1096470466 12:51872212-51872234 CTGGATCCTCAGCAAGATGGGGG + Intergenic
1096497143 12:52045233-52045255 CAGGGTCCTCAGCTGGACGGGGG - Intronic
1097687918 12:62708438-62708460 CAGGTTTCCCAGCAGGAAATTGG - Intronic
1098231459 12:68375694-68375716 CAGGATCTCCAGCTTGAAGGGGG - Intergenic
1099154746 12:79160291-79160313 TGGGATCCCCAGCAGGCAGTTGG + Intronic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101034047 12:100687330-100687352 CAGGACAACCAGCAGGAAGGAGG - Intergenic
1101108109 12:101459793-101459815 GAGGAACCCCAGCAGGAAGTTGG + Intergenic
1101982826 12:109422404-109422426 CACGGTCCCCAGCAGGGAAGGGG - Intronic
1102391554 12:112552977-112552999 CGGGCTCCCCAGCAGGCATGGGG - Intergenic
1102426544 12:112848464-112848486 CAAGATCCACAGCAGGCAAGTGG - Intronic
1102478254 12:113202665-113202687 CAGTCTAGCCAGCAGGAAGGAGG - Intronic
1104684573 12:130776366-130776388 CTGGCTTCCCAGCTGGAAGGAGG + Intergenic
1106586830 13:31064628-31064650 CACGAGCCCCAGCAGTGAGGAGG - Intergenic
1109989222 13:70031637-70031659 CAGGATCCTGAGCAGGATGGGGG + Intronic
1110317288 13:74124896-74124918 CTGTAACCCCAGCAGCAAGGCGG + Intronic
1111347282 13:86974852-86974874 CAGGTTCCTAGGCAGGAAGGGGG + Intergenic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113817063 13:113179745-113179767 CAGGGTCCCCAGGAGGCAGTGGG + Intronic
1113956467 13:114102199-114102221 CAGGATCCACAGCGGGCGGGTGG + Intronic
1114483104 14:23047469-23047491 CAACATCCCCTGCAGGAGGGTGG + Exonic
1116585399 14:46697113-46697135 CTGGATCCCAGGCAAGAAGGAGG - Intergenic
1116802679 14:49459582-49459604 AAGGATCTCCAGCAGGATGAGGG + Intergenic
1117745604 14:58866387-58866409 CAGGTTTCCCAGCAGGGAGAAGG - Intergenic
1117917395 14:60692088-60692110 CAGGATCCCAGGCAGGCAGTTGG - Intergenic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119417472 14:74482869-74482891 CAGGAGCCGCAGCTGGGAGGAGG + Intronic
1119614054 14:76086722-76086744 CCAGCTCCCCACCAGGAAGGAGG + Intergenic
1120225462 14:81786727-81786749 CTGGTTCCCAGGCAGGAAGGGGG - Intergenic
1120887392 14:89462571-89462593 CAGAGTCCCCATCAGGAAGAAGG - Intronic
1120971713 14:90213473-90213495 AAGGAGCCCCAGCAGGGAGAGGG - Intergenic
1121117965 14:91356886-91356908 GGGGAGCACCAGCAGGAAGGTGG + Intronic
1121740837 14:96251346-96251368 CAGGATGGCCAGCGAGAAGGTGG + Intronic
1122262833 14:100532865-100532887 CAAAATCACCATCAGGAAGGTGG - Intergenic
1122307550 14:100775515-100775537 CAGGCTTCCCAGCAGGTACGTGG + Intergenic
1122722558 14:103730434-103730456 CAGGCTCCCCAGGAGGAGGCAGG - Intronic
1122790669 14:104182960-104182982 CAGGCTCCCCAGCAAGAAGCAGG - Intergenic
1122883308 14:104699704-104699726 CAGGACCCCCTGCAGGGAGGAGG + Intronic
1122937746 14:104967745-104967767 CAGGAACACAAACAGGAAGGGGG + Intronic
1123501871 15:20893665-20893687 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123519026 15:21054967-21054989 CCAGAGCCCCAGCAGGAAGAGGG + Intergenic
1123559124 15:21467364-21467386 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123595355 15:21904645-21904667 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1124488841 15:30141593-30141615 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124543924 15:30610557-30610579 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124588068 15:31028349-31028371 CAGGTTCACCAGCAGGATGTTGG + Exonic
1124640465 15:31393206-31393228 CAGTAGCCCCAGCAGGGTGGGGG - Intronic
1126377064 15:48007279-48007301 AAGGATTCCCTGGAGGAAGGAGG - Intergenic
1126665745 15:51075142-51075164 CAGGACCCACACCTGGAAGGAGG + Intronic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1129037893 15:72662006-72662028 CAGGGTCCCCATCAGCAAAGAGG + Intronic
1129198713 15:73986011-73986033 CAGCATCCACAGCAGCCAGGAGG - Intronic
1129211996 15:74075221-74075243 CAGGGTCCCCATCAGCAAAGAGG - Intronic
1129398407 15:75265864-75265886 CAGGGTCCCCATCAGCAAAGAGG + Intronic
1129402015 15:75290139-75290161 CAGGGTCCCCATCAGCAAAGAGG + Intronic
1129729122 15:77919542-77919564 CAGGGTCCCCATCAGCAAAGAGG - Intergenic
1130025193 15:80265051-80265073 CAGGCTCTCCAGCAGGGGGGTGG + Intergenic
1130078723 15:80712374-80712396 GAGGAACCTCAGCAGGAAGCTGG - Intronic
1130093228 15:80838283-80838305 CAGGGTCCCTGCCAGGAAGGAGG - Intronic
1130312837 15:82770168-82770190 AAGCATCCCCAGCAGCAAGAGGG - Intronic
1130557570 15:84933555-84933577 CAGAATCCCCAGCAGCAAGAAGG - Intronic
1131466072 15:92655709-92655731 CAGGATCCGCACCAGCACGGAGG + Exonic
1131880119 15:96853375-96853397 CAGGACCCTCAGAAGGAAAGTGG + Intergenic
1131885863 15:96912024-96912046 GAGGATCCCCAGCAGCAAGAAGG + Intergenic
1132207141 15:99993927-99993949 CAGGATTCCCAGCAGCAAGAAGG + Intronic
1132403867 15:101530592-101530614 CAGAATGCCAAGGAGGAAGGGGG - Intergenic
1132458797 16:39185-39207 CAGGCTCCCTAGCAGGACTGGGG - Intergenic
1132639347 16:970651-970673 CCCGGGCCCCAGCAGGAAGGAGG + Intronic
1132730042 16:1356658-1356680 CTGGCTCCCCAGCTGGGAGGAGG - Intronic
1132988964 16:2783359-2783381 CTGGCTCCCCAGGAGGAAAGGGG + Intergenic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1135998073 16:27268522-27268544 CAGTTTCCCCATCAAGAAGGGGG + Intronic
1136518171 16:30780305-30780327 CTGGATCCCCACCAGGGAGGAGG + Exonic
1136568792 16:31084813-31084835 CACGCTCCCCATCAGGCAGGTGG + Exonic
1136612756 16:31377211-31377233 CGGGAGCTCCAGCTGGAAGGTGG - Exonic
1136619479 16:31418510-31418532 CGGGAGCTCCAGCTGGAAGGTGG - Exonic
1138132096 16:54488998-54489020 CAGGAACCCCAGGAGGCAGTAGG - Intergenic
1140450049 16:75063449-75063471 CTGGATGCCAAGCAGGATGGAGG - Intronic
1141096381 16:81165895-81165917 CAGTTTTCCCAGCAGGAGGGTGG + Intergenic
1141664471 16:85458749-85458771 CAGGATCCCCAGCAGTGCTGGGG - Intergenic
1141669784 16:85485744-85485766 CAGGCTCCCCAGGAGCGAGGCGG - Intergenic
1141673001 16:85502686-85502708 CAGGCTCCCCTGCAGGTCGGCGG - Intergenic
1142019107 16:87769539-87769561 CACGTTTCCCAGCAGGAAAGTGG + Intergenic
1142029420 16:87831157-87831179 GAGGACCACCAGCAGGCAGGTGG - Exonic
1142153644 16:88523547-88523569 CAGGGTCCCCAGCCTGGAGGTGG - Intronic
1142478923 17:206115-206137 TTGGTTCCCCAGCAGGAAGGAGG - Intergenic
1142496620 17:309592-309614 CTGGACCCCCAGCAGGAGGCTGG - Intronic
1142496660 17:309705-309727 CTGGACCCCCAGCAGGAGGCTGG - Intronic
1143682983 17:8491441-8491463 TAGGAGACCCAGCAGAAAGGTGG + Intronic
1145907089 17:28522138-28522160 CAGCATCCTCATCTGGAAGGTGG + Intronic
1146574672 17:33980627-33980649 CAGCATCCCCAGCAGGTAGCAGG - Intronic
1146585432 17:34077937-34077959 CAGGATGTCCTGGAGGAAGGAGG - Intronic
1147224670 17:38967446-38967468 CAAGAGCCCCCGCGGGAAGGAGG + Intergenic
1147224692 17:38967544-38967566 CAGAAGCCCTAGCGGGAAGGAGG + Intergenic
1147425045 17:40342282-40342304 CCGGATCCCCGGCTGGGAGGAGG + Intronic
1147590528 17:41680282-41680304 CAGGCAGCCCAGCAGGAAGAGGG + Intergenic
1147982072 17:44280819-44280841 AAGGAACCCCAGCATTAAGGAGG + Intergenic
1148218336 17:45846033-45846055 CAGCAGGGCCAGCAGGAAGGAGG - Exonic
1148862820 17:50613416-50613438 CAAGAGGCCCAGAAGGAAGGCGG - Intronic
1149232924 17:54555611-54555633 CAGGATCAGCAGCAGGGAAGAGG - Intergenic
1149601787 17:57898197-57898219 CTGCATCCCCAGCAGGAGGCAGG - Intronic
1151382250 17:73733991-73734013 CTGGAGCCCCAGGAGCAAGGAGG - Intergenic
1151578555 17:74964735-74964757 CTGGGACCCCAGCAGGTAGGGGG - Intronic
1152054899 17:78016948-78016970 CAGGATCCCCAGCAAAGAAGTGG + Intronic
1152241065 17:79161418-79161440 CAGCATCCCCAGCTGGTATGCGG - Intronic
1152271828 17:79329376-79329398 CAGGATCACCGGCAGGAGTGTGG - Intronic
1152676745 17:81645212-81645234 CAGCAGCCCCAGCAGGGAGAAGG - Exonic
1152783724 17:82237558-82237580 CAGGATGGTGAGCAGGAAGGCGG - Exonic
1152949874 17:83222871-83222893 CAGGCTCCCAAGCAGTAATGTGG - Intergenic
1152962444 18:87940-87962 CAGGATCTGCCCCAGGAAGGTGG + Intergenic
1154071027 18:11151157-11151179 CAAGATTCCCAGCAGGTGGGTGG + Intergenic
1154306464 18:13234230-13234252 GAGGAGCCTCAGCAGGAGGGAGG - Intronic
1155916017 18:31557762-31557784 AAGAATCCTCAGCTGGAAGGAGG + Intergenic
1157288562 18:46393932-46393954 CAGGATCCCCACCAGGCAGTGGG - Intronic
1158692951 18:59677630-59677652 CAGGATACTCAGGAGGCAGGAGG + Intronic
1159001983 18:62982543-62982565 CTGGATTTCCAGCAGGAAGCAGG - Intergenic
1160234182 18:77072809-77072831 CAGTATCCCCAGGAGGACAGTGG + Intronic
1160773993 19:846484-846506 CAGTCTCCCCACCTGGAAGGTGG + Intronic
1160785118 19:896732-896754 CTGGACCCCCAGCATAAAGGAGG + Exonic
1160974245 19:1784897-1784919 CAGGACCACCAGCAGGATGGAGG + Exonic
1161168543 19:2801717-2801739 CAGAGTCCCCACCAGGAAGAAGG - Intronic
1161697443 19:5777381-5777403 CAGAATCCACGGCAGGGAGGGGG - Intronic
1161759277 19:6159366-6159388 CAGCATTCCCAGCTGGAAGAAGG - Intronic
1162142130 19:8591388-8591410 CAGGTTCCCCAGGAGGCAGCAGG + Intronic
1162143008 19:8595956-8595978 CAGGAGCCTCAGCTGGATGGGGG + Intronic
1162158983 19:8697994-8698016 CAGCATCTCCGCCAGGAAGGCGG + Exonic
1162297259 19:9821806-9821828 CAGGAACCCAAGAAGCAAGGGGG + Intronic
1162495208 19:11019589-11019611 AGGGATCCCCAGCAGCAAGACGG + Exonic
1162608030 19:11726646-11726668 CAGAGTCCCCACCAGCAAGGAGG + Intronic
1163210489 19:15836614-15836636 CAGGATCCCCAGGCCGGAGGCGG + Intergenic
1163635355 19:18434796-18434818 CAAGAACCCCAGGTGGAAGGAGG + Exonic
1163786452 19:19277273-19277295 CAGGGTCCCACACAGGAAGGAGG + Intronic
1164399043 19:27890333-27890355 CTGTGTCCCCAGCAGGAATGAGG + Intergenic
1164599008 19:29548705-29548727 CAGGAGCCCCATCAGGAAGCCGG + Intronic
1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG + Intronic
1166599589 19:44082223-44082245 CAGGACAACCAGCAGGAAGGAGG - Intronic
1166798817 19:45443790-45443812 TAGGATCCCCAGGGAGAAGGAGG - Intronic
1167125275 19:47544943-47544965 CAGGAGGCCCAGAAGGCAGGCGG - Exonic
1167209911 19:48127716-48127738 CAGCATCCCAAGTAGGAAGAGGG - Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167655166 19:50759029-50759051 CAGGAAGCCCAGCAGGAAGTGGG - Intergenic
1168309397 19:55452898-55452920 CGGGGTCCCCAGCAGGTGGGGGG - Intergenic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1168607388 19:57770775-57770797 CAGAATCCACAGTAGGAAGTAGG + Intronic
1202711462 1_KI270714v1_random:21561-21583 CAGTATCGGCAGCTGGAAGGCGG + Intergenic
925190229 2:1876487-1876509 CAGGAGCCCCAGATGGACGGGGG - Intronic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
925912545 2:8583094-8583116 CAGCCTCCCCAGGTGGAAGGAGG + Intergenic
926145249 2:10393373-10393395 CAGGCTTCCTAGCAGGAAGGGGG - Intronic
926229254 2:10990388-10990410 CAGCAGCCCCAGGAGGCAGGTGG + Intergenic
927066638 2:19478295-19478317 GAGGGTCCCCACCAGCAAGGAGG - Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
927527430 2:23758482-23758504 CTGGATTTCCACCAGGAAGGTGG + Intronic
928105691 2:28469286-28469308 CATGGTCCCCAGCAAGCAGGAGG - Intronic
928138945 2:28710925-28710947 GAGCATCCTGAGCAGGAAGGTGG + Intergenic
929834718 2:45384900-45384922 CTGCATTCCAAGCAGGAAGGAGG + Intergenic
930028864 2:47046250-47046272 CAGGATCCCCAGGTGAAAGTGGG + Intronic
930923202 2:56782683-56782705 CAACATGCCCAGCAGGAAAGGGG + Intergenic
931217457 2:60260003-60260025 CAGGAGACCCAGGAGGAAGCTGG - Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931515025 2:63045301-63045323 TTGGATCCCCAGCGGGAATGGGG - Intronic
932072555 2:68635753-68635775 TTGGGTCCCCATCAGGAAGGAGG + Intergenic
932343716 2:70982347-70982369 CTGGCTCCTCAGCAGGAGGGTGG + Intronic
932571049 2:72938564-72938586 CAGGAGTCCCAGCAGGAAACTGG - Intergenic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
933748099 2:85585222-85585244 CAGGATCTGCAGCAGGAGTGGGG - Intronic
934105934 2:88694382-88694404 CACAGTCCCCAGCAGGCAGGTGG - Intronic
934564301 2:95329978-95330000 CAGGATCTGCAGCAGAAATGGGG - Intronic
934949638 2:98567489-98567511 CTGGAGCCCCAGCAGGGAGGTGG + Intronic
935367803 2:102313384-102313406 CGGGATCCCCAGCAGGATCTGGG + Intronic
936174291 2:110205238-110205260 CAGGTATCCCAGCAAGAAGGTGG - Intergenic
938401372 2:130994652-130994674 AAGGATCCCCGACAGGAAGGTGG - Intronic
942247484 2:174021102-174021124 CAAGAACCCCATAAGGAAGGAGG + Intergenic
943851099 2:192724090-192724112 CAGAGTCCCCACCAGGAAGAAGG - Intergenic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
946416985 2:219544632-219544654 CTGGGTCCCCACCAGGATGGGGG - Intronic
946606930 2:221415622-221415644 CAGTCTCCCTAGGAGGAAGGAGG - Intergenic
947403602 2:229752330-229752352 TAAAATCACCAGCAGGAAGGAGG + Intergenic
947478446 2:230473548-230473570 CTGGATCACCAACAGGAAGTGGG + Intronic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
948403457 2:237701109-237701131 CAGGATCCCCTGAAGGAGTGTGG + Intronic
948422635 2:237869932-237869954 CAGGCTCCCCAGCACGCAGTGGG + Intronic
948553869 2:238794246-238794268 CAGAATCCCCGGGAGGAGGGGGG + Intergenic
948681035 2:239634848-239634870 CAGGGACCCCAGCAGGGAGGTGG + Intergenic
1169208384 20:3752535-3752557 GAGGAGCCGCAGGAGGAAGGAGG + Exonic
1169729981 20:8776294-8776316 AAGGATCCACAACTGGAAGGTGG + Intronic
1170273957 20:14562735-14562757 CAAGAGACCCAGCAAGAAGGAGG - Intronic
1170581793 20:17704908-17704930 TAGCAACCCCAGCAAGAAGGGGG + Intronic
1170827705 20:19810449-19810471 CAGGGCCCCCAGGAGGGAGGTGG + Intergenic
1172179324 20:32991244-32991266 CTGGATCCCCAGCACGCAGTAGG + Intronic
1172289035 20:33762018-33762040 CCTGAACCCCAGCAGGCAGGAGG + Exonic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1172463124 20:35135043-35135065 CAGGATACCCAGGAGAAAGAGGG - Intronic
1172904624 20:38359893-38359915 CAGGAGTACCAGCAGGAATGGGG + Intronic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173395892 20:42679020-42679042 CAGCAGACCCAGCAGGAATGAGG + Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1174398848 20:50264937-50264959 CCGGATCCCCAGCGGGAGGAGGG + Intergenic
1174940196 20:54918520-54918542 CTGGTTCCCAGGCAGGAAGGAGG + Intergenic
1175201029 20:57277773-57277795 CAGGGGCCCCAGCTGGAAGTTGG - Intergenic
1175466432 20:59193360-59193382 CCGGACCCCAAGCTGGAAGGAGG + Exonic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175850783 20:62091251-62091273 CAGGTTCCCCACCAGCAAGAGGG - Intergenic
1175872839 20:62216559-62216581 CAGCAGCCCCAGCAGCCAGGCGG + Exonic
1175898472 20:62350642-62350664 CTGGACCCCCAGCAGGGAGCTGG - Intronic
1175948401 20:62569458-62569480 CAGGACCTCGGGCAGGAAGGTGG - Intronic
1176271905 20:64239698-64239720 GAGGACCCCCAGGAGGATGGGGG + Intronic
1177062059 21:16388442-16388464 CAGGATCTCCAGCTTGCAGGTGG - Intergenic
1177666104 21:24161719-24161741 CAGAGTCCCCATCAGGAAGAAGG + Intergenic
1179169555 21:38962414-38962436 CAGGATGCCCAGCAGGAAGTGGG - Intergenic
1179297901 21:40079629-40079651 CAGGAACTCCAGAAGGAAGGAGG - Intronic
1179594250 21:42431334-42431356 CAGGCTCCCCAGAAAGAGGGCGG + Intronic
1179937159 21:44613083-44613105 CAGGGGACCCAGCAGGCAGGTGG - Intronic
1180127649 21:45803206-45803228 CACTACCCCCAGCAGAAAGGTGG - Intronic
1181668920 22:24416746-24416768 CAGGATCTTCTGGAGGAAGGTGG + Exonic
1181673039 22:24434740-24434762 AGGGTGCCCCAGCAGGAAGGAGG + Intronic
1181684093 22:24516579-24516601 CAGTGTCCCCAGCAGGACAGGGG + Intronic
1181760746 22:25057243-25057265 CAGGATCCCCAGGTGGAAGAAGG + Intronic
1182021241 22:27083397-27083419 CAGAATCCCCTGCAGAAGGGAGG - Intergenic
1182062183 22:27406185-27406207 CAGTTTCCCCACCTGGAAGGAGG - Intergenic
1182131003 22:27850700-27850722 CATGATGCCCAGCTGTAAGGTGG - Intergenic
1182464492 22:30505878-30505900 CGGGAGCCCCCGCAGTAAGGAGG - Intergenic
1183235052 22:36610685-36610707 CACAATCCCCAGGAGGAATGGGG + Intronic
1183316037 22:37137385-37137407 CTGGATCCCCAGGATTAAGGGGG + Intronic
1183484298 22:38081153-38081175 CACGATGGACAGCAGGAAGGCGG + Exonic
1184403265 22:44286118-44286140 CAGGGGCACCTGCAGGAAGGAGG - Intronic
1184516059 22:44963532-44963554 CATCATCCCCAGCAAGAAGTGGG + Intronic
1184639039 22:45859255-45859277 CAGGTGCCCCAGCAGGACAGCGG + Intergenic
1184707527 22:46224735-46224757 CAGCAGCCCCTGCAGGGAGGAGG - Intronic
1184730259 22:46367789-46367811 CAGCAGCCCCAGCAGCCAGGTGG + Exonic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184759251 22:46535661-46535683 CAGCATCCTCAGCGGGAACGTGG - Exonic
1184843013 22:47063526-47063548 CCGGACCCCCAGCAGGCACGAGG - Intronic
1184956200 22:47888154-47888176 CAGGAGCCCAAGCAGAGAGGAGG + Intergenic
1185082644 22:48718359-48718381 GAGGCCCCCAAGCAGGAAGGTGG + Intronic
1185267285 22:49911016-49911038 CAGGCTCCCAGGCAGGAAGGGGG + Intronic
1185357730 22:50384637-50384659 CAGTGTCCCCAGCAGCAAGAAGG - Intronic
950424877 3:12919749-12919771 CAGGGTCCCCGGAAGGAAGGAGG - Intronic
950500100 3:13358332-13358354 CAGGCTCCACCGCAGGAAAGGGG + Exonic
950589596 3:13927165-13927187 GAGGATACTCAGCAGGCAGGTGG - Intergenic
950840528 3:15964187-15964209 CAAGCTCACTAGCAGGAAGGAGG - Intergenic
951528045 3:23672253-23672275 CAGGATCCCCAGCAGGTCTCTGG - Intergenic
952382937 3:32818415-32818437 CAGGTTGCTAAGCAGGAAGGCGG - Exonic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
956738216 3:72255452-72255474 CAGGAGCCCCACAAGGAAGGGGG + Intergenic
956929652 3:74028603-74028625 CAGCATCCCTAGAGGGAAGGTGG + Intergenic
957876606 3:86155011-86155033 CTGGATCCTCAGCAGGGAGTAGG - Intergenic
957997659 3:87710748-87710770 CAGAGTCCCCAGCAGCAAGTAGG + Intergenic
959283448 3:104377732-104377754 TAGATTCCCCAGAAGGAAGGTGG + Intergenic
959978788 3:112491520-112491542 CAAGATCACCAGCTGGTAGGAGG + Intronic
961105179 3:124234815-124234837 CACGACCCCCTGCAAGAAGGAGG - Exonic
961430081 3:126875205-126875227 CAGAATCCAGAGCAGGAAGAGGG + Intronic
963083163 3:141413271-141413293 GAGGACCTCCTGCAGGAAGGTGG - Intronic
963117020 3:141738672-141738694 CAGGAGCCGCAGCAGGAGCGTGG - Intronic
963941631 3:151101686-151101708 CTGGAGCCCCAGCAGGTTGGGGG + Intronic
964530298 3:157660523-157660545 CAGTTTCTCCACCAGGAAGGTGG + Intronic
964739284 3:159948675-159948697 CAGAATCCCCACCAGCAAGAAGG + Intergenic
965422787 3:168482800-168482822 CAGGAAAGCCAGCAGGAATGTGG - Intergenic
967403472 3:189089580-189089602 CAGAGTCCCCACCAGCAAGGAGG - Intronic
967596402 3:191329961-191329983 CAGCAGCCCCAGCAAGTAGGTGG + Intronic
968986966 4:3880747-3880769 CCGGCTCCCGCGCAGGAAGGCGG + Intergenic
969261308 4:6035896-6035918 CAGCAGGCCCAGCAGGTAGGCGG - Exonic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
969707305 4:8818977-8818999 CAGCCTCCCCAGTAAGAAGGTGG + Intergenic
969707332 4:8819074-8819096 CAGCCTCCCCAGTAAGAAGGCGG + Intergenic
971371605 4:26023875-26023897 GAGGGTCCCCAGCAGGATTGAGG - Intergenic
972381684 4:38525415-38525437 CAGGAACTGCAGCAGGGAGGTGG - Intergenic
973176743 4:47215109-47215131 AAGGATCCCTAAAAGGAAGGGGG + Intronic
974384472 4:61187118-61187140 GAGGATCCCCATCAGCAAGAAGG + Intergenic
977607357 4:98996024-98996046 CAGGGACCCCAGGAGGCAGGAGG - Intronic
978189332 4:105895154-105895176 CAGGGTGCCCAGCAGGAAAGGGG - Intronic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
985478158 5:91470-91492 CTGAATTCCCAGCAGGAAGCTGG + Intergenic
985624351 5:977309-977331 CAAGAGCCCCAGCTGGAGGGTGG - Intergenic
985849274 5:2376683-2376705 CAGGAAGCCCAGCAGGATGGGGG + Intergenic
986024956 5:3842078-3842100 CCAGTTCCCCAGAAGGAAGGAGG - Intergenic
986276630 5:6280958-6280980 CAGGTTCTCCATCAAGAAGGTGG + Intergenic
992102807 5:73423540-73423562 CAGGGTCCCCAGTAGGTAGGTGG + Intergenic
995592018 5:113709143-113709165 CAGGCTCCTCAGCTGTAAGGAGG - Intergenic
996102578 5:119459639-119459661 CAGAGTCCCCACCAGAAAGGAGG - Intronic
998025837 5:138815479-138815501 CAGGGCACCCAGCAGGAAAGAGG - Intronic
998059872 5:139111526-139111548 GAGGACCCCCTACAGGAAGGTGG - Intronic
998166339 5:139846554-139846576 CAGGTTCCCCAGCAGCCAGTGGG + Intergenic
998474567 5:142409417-142409439 CAGTTTGCCCAGCAGGCAGGAGG - Intergenic
999325610 5:150641547-150641569 GAGGATCCACAGGAGGGAGGTGG - Intronic
1000351764 5:160357980-160358002 CAGGCTCCACAAGAGGAAGGCGG + Intronic
1000927928 5:167216308-167216330 AAGGATCACCAGGAGGAAGAAGG + Intergenic
1001323774 5:170704599-170704621 AAGGTTCCTCAGCAGGAAGGTGG + Intronic
1001435072 5:171693738-171693760 CAGGTCCCCCAGCAGGAGGCTGG - Intergenic
1002065683 5:176650602-176650624 CAGCAGACCCAGCAGGCAGGAGG + Intronic
1002591699 5:180295152-180295174 CAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1002744106 5:181456683-181456705 CAGGCTCCCAAGCAGTAATGTGG - Intergenic
1002764615 6:228204-228226 CAGGCTGCCCCGCAGGATGGTGG + Intergenic
1002792875 6:448503-448525 CAGAATCCCCACCAGCAAGAAGG + Intergenic
1003233599 6:4276261-4276283 GAGGCTCCCCAGCCAGAAGGAGG + Intergenic
1003378976 6:5605232-5605254 CAGGATCGCTAGCCGGGAGGTGG + Intronic
1003400421 6:5786037-5786059 CAGGTTTCCCATCAGTAAGGTGG + Intergenic
1003498915 6:6687811-6687833 CAGGGACCCCAAAAGGAAGGAGG - Intergenic
1003638920 6:7860157-7860179 CAGGTTCCCCAGCTGTAAGGTGG + Intronic
1004202355 6:13560935-13560957 TAGGATCCCCAGTGGGAAAGAGG + Intergenic
1004813161 6:19282031-19282053 CAGGATCACCAGCATGTGGGTGG + Intergenic
1005083457 6:21980603-21980625 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005083482 6:21980747-21980769 CTGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005083515 6:21980909-21980931 CAGTTTCCAGAGCAGGAAGGAGG - Intergenic
1005083529 6:21980967-21980989 CAGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005083549 6:21981076-21981098 CAGTTTCCAGAGCAGGAAGGAGG - Intergenic
1005083557 6:21981131-21981153 CAGGTTCCAGAGCAGGAAGAAGG - Intergenic
1005083622 6:21981545-21981567 CAGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005083637 6:21981623-21981645 CAGGTTCCAAAGCAGGAAGGAGG - Intergenic
1005083649 6:21981675-21981697 TGGGATCCAGAGCAGGAAGGAGG - Intergenic
1005083681 6:21981831-21981853 CAGGTTCCAGTGCAGGAAGGAGG - Intergenic
1006638491 6:35476344-35476366 CAGGAGCCGCAGCCGGGAGGAGG + Exonic
1006778932 6:36618683-36618705 CAGTCTCCCCAGCTGGAAGTAGG + Intergenic
1006914407 6:37585222-37585244 CAGGATCCCAGAGAGGAAGGTGG - Intergenic
1007665793 6:43512308-43512330 CAGGATCCCTGGAAGGAAGATGG + Exonic
1007702205 6:43771867-43771889 CAGGTGGCCCAGCAGGGAGGGGG - Intronic
1007913510 6:45538920-45538942 CCAGATCCACTGCAGGAAGGAGG - Intronic
1008481616 6:51992042-51992064 CAGGACCCACAGCTGGAAAGTGG - Intronic
1011368695 6:86609220-86609242 CAGGATGACCAGCAGGTTGGGGG - Intergenic
1013181258 6:107718695-107718717 CAGGATTTCCAGCAGTAAGAGGG - Intronic
1013817968 6:114121937-114121959 CAGGACTTCCAGCAGGAAGAAGG - Intronic
1016094444 6:140018950-140018972 CAGGTTCCATAGCAGAAAGGAGG - Intergenic
1017232524 6:152088679-152088701 CAGAGTCCCCAGCAGAAAGAAGG + Intronic
1017324185 6:153128372-153128394 CAGGATTCTCAGCAGAAATGTGG + Intronic
1017655331 6:156622224-156622246 CTGGACTCCGAGCAGGAAGGTGG + Intergenic
1018365005 6:163110987-163111009 CAGAATGTCCAGCAGGAAGAGGG - Intronic
1018604638 6:165584333-165584355 CAGGCCCCCCAGTAAGAAGGCGG - Intronic
1018926882 6:168212808-168212830 CCAGAACCCCAGCAGGAGGGTGG - Intergenic
1019063083 6:169271232-169271254 CAGGCCCCAGAGCAGGAAGGCGG + Intergenic
1019248965 6:170729912-170729934 CAGGCTCCCAAGCAGTAATGTGG - Intergenic
1019416898 7:932005-932027 CAGAGTCCCCAGCAAGAAGCCGG + Intronic
1019552282 7:1608999-1609021 CACTGTCCCCAGCAGCAAGGAGG - Intergenic
1019576793 7:1741459-1741481 CAGGCTCCCCAGCCTGATGGAGG + Intronic
1019958385 7:4435563-4435585 CAGGACCCCAAGCAGGGAGATGG + Intergenic
1020031777 7:4938378-4938400 CAGCATCCTCAGCAGCAAGAAGG - Intronic
1020131694 7:5562527-5562549 CAGGTGCCCCGGCGGGAAGGAGG + Intronic
1020379445 7:7527275-7527297 CAGCAACCCGAGTAGGAAGGAGG + Intronic
1020650873 7:10874618-10874640 GAGGATCCGCAGCTGGGAGGTGG - Intergenic
1020746968 7:12090849-12090871 CAGGATGCCAGGCAGGGAGGAGG + Intergenic
1021407164 7:20285058-20285080 CAAGATCCCCAGCACAAATGGGG - Intergenic
1024000086 7:45184129-45184151 GAGGAGCCCCTGTAGGAAGGAGG - Exonic
1024240607 7:47432380-47432402 CAGAATCCCCAACAGCAAGAAGG + Intronic
1024331504 7:48159988-48160010 CAGGAAGGCCAGCAGGAAGAAGG - Intergenic
1024480268 7:49855445-49855467 CAGGACTCTCAGCAGGGAGGAGG + Intronic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1025606110 7:63041209-63041231 CAGGTTCTGCAGCAGGGAGGAGG - Intergenic
1028882638 7:95897196-95897218 CAGGTTCCTAAGCAGGAAGCAGG + Intronic
1029458877 7:100684359-100684381 CAGTGCCCCCAGCAGGGAGGAGG + Intronic
1029524894 7:101088429-101088451 CAGCAGCCCCAGAAGGATGGTGG + Exonic
1029705058 7:102271687-102271709 CTGGGTCCCTGGCAGGAAGGTGG - Intronic
1031744979 7:125484331-125484353 CAGAATCCCCACCAGCAAGAAGG - Intergenic
1032467463 7:132155260-132155282 CAGGTTACACAGCAGGGAGGTGG - Intronic
1033825484 7:145185070-145185092 CAATATCCCCAGCAGAAATGGGG + Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1035457246 7:159016592-159016614 CAGGGTGCCAAGCAGGAGGGTGG - Intergenic
1035499082 8:77423-77445 CAGGCTCCCAAGCAGTAAGGTGG + Intronic
1035569981 8:666514-666536 GAGGGGCCCCAGCAGGAAGGTGG - Intronic
1035879776 8:3233370-3233392 CAGAATCCCCACCAGCAAGAGGG + Intronic
1036754251 8:11461898-11461920 CAGGACCCCCAGCCCGAACGTGG - Intronic
1038651384 8:29406927-29406949 CAGGATCCCTTGCAGTTAGGTGG - Intergenic
1039744079 8:40408057-40408079 CAAGGTCCCCAGCAGGGAAGTGG - Intergenic
1039880818 8:41624508-41624530 CGGGATGCACAGCAGGCAGGTGG - Exonic
1039912523 8:41836206-41836228 CGGGATCTGCAGCAAGAAGGAGG - Intronic
1040946767 8:52893043-52893065 CGGGTTGCCCAGCAGGAAGACGG + Intergenic
1042159514 8:65877939-65877961 CAGGTTCCCCAGGAGAGAGGCGG + Intergenic
1042443209 8:68851952-68851974 CATGAGGCCCAGCAAGAAGGAGG + Intergenic
1046097548 8:109579060-109579082 AGGGATGCCCAGCAGGAAGAAGG + Intronic
1047248559 8:123165046-123165068 AAGGAGACCCAGGAGGAAGGCGG + Intergenic
1047511611 8:125520256-125520278 GAGGAGCCACAGGAGGAAGGAGG + Intergenic
1049010351 8:139883240-139883262 CAGAGTCCCCAGCAGCAAGAGGG + Intronic
1049302806 8:141880493-141880515 CATGATGCCCAGCAAGGAGGGGG - Intergenic
1049343833 8:142128047-142128069 CACCATCCCCCACAGGAAGGAGG - Intergenic
1049348456 8:142151638-142151660 CACGATCTAGAGCAGGAAGGGGG - Intergenic
1049537248 8:143188120-143188142 CAAGATCCCCCGCAGGACAGGGG - Intergenic
1049749643 8:144277130-144277152 CAGGAACCCCAGAGCGAAGGCGG + Intronic
1049945111 9:586861-586883 CTGCACCCCCAGCAGGAAAGTGG + Intronic
1051210063 9:14731878-14731900 AACCAACCCCAGCAGGAAGGAGG - Intergenic
1051596892 9:18832903-18832925 CATGTTTCCCAGCAGTAAGGGGG + Intronic
1051666311 9:19469951-19469973 CAGTATCTACATCAGGAAGGTGG - Intergenic
1052415513 9:28172060-28172082 CAGTAGCCACAGCAGGAAAGTGG - Intronic
1055402661 9:75941125-75941147 CAGGAGCGCCCGCTGGAAGGAGG - Intronic
1055658142 9:78472921-78472943 GAGGATTTCCAGAAGGAAGGTGG + Intergenic
1055828895 9:80358116-80358138 CGGGGTCCCCAGCAGGAAGCAGG - Intergenic
1056956290 9:91084321-91084343 CAGAATTCCCGACAGGAAGGGGG - Intergenic
1057423490 9:94930033-94930055 CAGGACCTTCAGCAGGAAGGTGG + Intronic
1058528647 9:105885054-105885076 CAGGGTCCCTGGCAGGAAGCTGG - Intergenic
1058714246 9:107709263-107709285 GAGGATGCTCAGGAGGAAGGTGG + Intergenic
1058954707 9:109935001-109935023 GAGGAACCACAGCAGGAAGTGGG + Intronic
1059461330 9:114432320-114432342 CAGGAGCCCCAGGAGGAGAGGGG + Intronic
1059972072 9:119678350-119678372 CAGGATCCCAGGGAGGCAGGTGG + Intergenic
1060375983 9:123115390-123115412 GAGGATCCCTAGCAGGGAGGGGG + Intronic
1060376450 9:123118827-123118849 CAGGAGCCTCTGCAGAAAGGTGG - Intronic
1060989633 9:127841004-127841026 GAGGTTCCCCAGCAGGACAGGGG - Intronic
1060992496 9:127857005-127857027 GAGGAACCCCAGCTGGAGGGTGG + Intergenic
1061120218 9:128637302-128637324 CAGGGGCTGCAGCAGGAAGGTGG + Intronic
1061281259 9:129598663-129598685 CAAGAACCCCAGCTGGGAGGTGG + Intergenic
1061586795 9:131574884-131574906 CAGTTTCCCCAGCTGGAAGTGGG - Intergenic
1061675104 9:132211171-132211193 CAGGAACCCAAGCATGAAGTGGG - Intronic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062728996 9:138097929-138097951 CTGGATCCTCACTAGGAAGGTGG - Intronic
1062735698 9:138136177-138136199 CAGGATCTGCCCCAGGAAGGTGG - Intergenic
1203609920 Un_KI270748v1:87176-87198 CAGGCTCCCAAGCAGTAATGTGG - Intergenic
1185910622 X:3977356-3977378 CAGGAACCCCAACTCGAAGGTGG + Intergenic
1187058921 X:15767182-15767204 AAGGATCCCCAGAAGAAAGCAGG - Intronic
1187285245 X:17898372-17898394 CCAGACCCCAAGCAGGAAGGAGG - Intergenic
1187607076 X:20896748-20896770 CAGGAAAGCCAACAGGAAGGTGG - Intergenic
1189470346 X:41309017-41309039 CAGTGCCCCCAGCAGGAAAGAGG - Intergenic
1190174806 X:48139428-48139450 CAGCAGCCCCATCAGGGAGGTGG + Intergenic
1190505066 X:51119215-51119237 CAGCAACCCCACCAGGGAGGTGG - Intergenic
1190583702 X:51915562-51915584 CAGTGTCCCCAGCAGCAAGAGGG + Intergenic
1190879338 X:54481846-54481868 AAGGCTCCACAGCAGGAAGAAGG + Intronic
1194666207 X:96680371-96680393 GAGGATCCACATCAGGAAGGAGG + Intergenic
1196791472 X:119468642-119468664 CAGGAGCCCAACCAGGAAGTGGG + Intronic
1198460974 X:136862687-136862709 CAGCGTCCCCACCAGCAAGGAGG - Intronic
1198518686 X:137431314-137431336 CAGAATCCCAAGCAGGAATGTGG + Intergenic
1199967922 X:152835071-152835093 AATGTTCCCCAGCAGGAAGGAGG + Intronic
1200002865 X:153071294-153071316 CAGCATCTCCACCAGGCAGGTGG - Intergenic
1200004858 X:153078715-153078737 CAGCATCTCCACCAGGCAGGTGG + Intergenic
1200397626 X:156000532-156000554 CAGGCTCCCCAGCGGGACTGGGG + Intronic
1201220967 Y:11769921-11769943 AAGTTTCCCCAGCAGGGAGGAGG + Intergenic
1201265181 Y:12199409-12199431 AGGGGTTCCCAGCAGGAAGGTGG + Intergenic