ID: 984973519

View in Genome Browser
Species Human (GRCh38)
Location 4:185210240-185210262
Sequence TACTTACCCCCGGCGGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984973519_984973527 6 Left 984973519 4:185210240-185210262 CCGCCGCCCGCCGGGGGTAAGTA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973519_984973533 22 Left 984973519 4:185210240-185210262 CCGCCGCCCGCCGGGGGTAAGTA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984973519 Original CRISPR TACTTACCCCCGGCGGGCGG CGG (reversed) Intronic