ID: 984973519

View in Genome Browser
Species Human (GRCh38)
Location 4:185210240-185210262
Sequence TACTTACCCCCGGCGGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984973519_984973527 6 Left 984973519 4:185210240-185210262 CCGCCGCCCGCCGGGGGTAAGTA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973519_984973533 22 Left 984973519 4:185210240-185210262 CCGCCGCCCGCCGGGGGTAAGTA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984973519 Original CRISPR TACTTACCCCCGGCGGGCGG CGG (reversed) Intronic
901192984 1:7423533-7423555 TAATGACACCCGGCGGGGGGAGG - Intronic
918566658 1:185942105-185942127 CACTTACACCCGGGAGGCGGAGG + Intronic
1063731079 10:8697913-8697935 CACTTAACCCCGGGAGGCGGAGG - Intergenic
1064262776 10:13799239-13799261 TACTTGAACCCGGAGGGCGGAGG - Intronic
1081976939 11:47241431-47241453 CACTTACACCCGGGAGGCGGAGG + Intronic
1105013877 12:132774196-132774218 TCCTTGCTCACGGCGGGCGGTGG + Exonic
1114302470 14:21390692-21390714 TGCTTGAACCCGGCGGGCGGAGG + Intronic
1115354252 14:32430765-32430787 AACTTACCCCCAGAGGGCAGTGG + Intronic
1122735137 14:103834672-103834694 CACTTGCACCCGGAGGGCGGAGG - Intronic
1131473735 15:92718119-92718141 TGCTTACACCCGGGAGGCGGAGG + Intronic
1132687645 16:1168945-1168967 GACTCACCCCAGGCGGGCAGGGG - Intronic
1135337222 16:21613265-21613287 TACTTAAACCCGGGAGGCGGAGG - Intronic
1138583218 16:57955060-57955082 GACTTACCCCCAGAGGGCTGTGG - Intronic
1139408391 16:66738330-66738352 TACTTAAACCCGGCAGGTGGAGG - Intronic
1141418955 16:83899325-83899347 CACTGACCCTCGGCGGGCGCCGG - Exonic
1142701814 17:1667087-1667109 TACTTAAACCCGGGAGGCGGGGG + Intronic
1144846532 17:18222819-18222841 TGCTTGAACCCGGCGGGCGGAGG - Intergenic
1148559538 17:48597957-48597979 TATTACCCGCCGGCGGGCGGTGG - Exonic
1152182204 17:78829822-78829844 TGCTTAAACCCGGCAGGCGGAGG - Intronic
1161376391 19:3941200-3941222 GCCTTGCCCCGGGCGGGCGGGGG + Intronic
1163207751 19:15815846-15815868 GACTCACCCCTGGCAGGCGGGGG - Intergenic
1167519757 19:49947116-49947138 TACTTAAACCCGGGGGGCCGAGG - Intronic
935294044 2:101632801-101632823 TGCTTACACCCGGGAGGCGGAGG + Intergenic
944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG + Intergenic
945627778 2:212232696-212232718 TACTTACTCCCGGCCGGGTGTGG - Intronic
947626598 2:231622974-231622996 CACTTACACCCGGGAGGCGGAGG + Intergenic
1169082625 20:2806444-2806466 TACTTACCTCCTGCTGGGGGTGG - Intergenic
1179144231 21:38753047-38753069 TACCCACCCCTGGCGGGCGGTGG - Intergenic
954263670 3:49457687-49457709 TGCTTGACCCCGGGGGGCGGAGG - Intergenic
961530495 3:127537271-127537293 TCATTACCCCCGGCTGGCTGAGG - Intergenic
969571337 4:8010423-8010445 TTCTTACCTGCAGCGGGCGGCGG + Intronic
979335004 4:119453614-119453636 TACTTGAACCCGGGGGGCGGAGG - Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
984973519 4:185210240-185210262 TACTTACCCCCGGCGGGCGGCGG - Intronic
987100022 5:14582729-14582751 TGCTTGAACCCGGCGGGCGGAGG + Intronic
1006358837 6:33576245-33576267 TACTTGACCCCGGGAGGCGGAGG + Intronic
1011419320 6:87155346-87155368 TACTTACCCCGAGCGGGAAGTGG - Intronic
1015969721 6:138731533-138731555 TGCTTAAACCCGGCAGGCGGAGG + Intergenic
1018324283 6:162648463-162648485 CACTTGAACCCGGCGGGCGGAGG - Intronic
1037069365 8:14624652-14624674 TACTTGACCCCGGGAGGCGGAGG - Intronic
1037401942 8:18502621-18502643 TGCTTGACCCCGGCAGGCGGAGG + Intergenic
1039035989 8:33359920-33359942 TGCTTACACCCGGGAGGCGGAGG + Intergenic
1049608480 8:143541103-143541125 TAGTAACCCGCGGGGGGCGGCGG - Intronic
1060395170 9:123311462-123311484 TATTTACTCCCGGAGAGCGGGGG + Intergenic
1185600392 X:1335193-1335215 CACTTAAACCCGGCAGGCGGAGG - Intergenic
1187281651 X:17861568-17861590 TACTGCCTCCCGGCGGGCTGGGG + Intergenic
1187904605 X:24054419-24054441 TGCTGAGCCCCGGCGGGAGGTGG - Intergenic
1190520661 X:51276632-51276654 TAATCACCCACGGGGGGCGGGGG - Intergenic
1191101680 X:56736346-56736368 TGCTTGACCCCGGGGGGCGGAGG - Intergenic
1193723514 X:85015650-85015672 CACTTACACCCGGGAGGCGGAGG - Intronic
1201555180 Y:15259673-15259695 TACTTACTCCCGGTGAGTGGAGG + Intergenic