ID: 984973527

View in Genome Browser
Species Human (GRCh38)
Location 4:185210269-185210291
Sequence TCCTGGCCGCCCAGCTCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 198}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984973511_984973527 22 Left 984973511 4:185210224-185210246 CCGCGACCTCAGCCGCCCGCCGC 0: 2
1: 1
2: 3
3: 31
4: 330
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973510_984973527 30 Left 984973510 4:185210216-185210238 CCGGCTGGCCGCGACCTCAGCCG 0: 2
1: 0
2: 2
3: 10
4: 136
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973512_984973527 16 Left 984973512 4:185210230-185210252 CCTCAGCCGCCCGCCGCCCGCCG 0: 1
1: 9
2: 20
3: 124
4: 848
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973520_984973527 3 Left 984973520 4:185210243-185210265 CCGCCCGCCGGGGGTAAGTACCC 0: 1
1: 0
2: 0
3: 3
4: 34
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973522_984973527 -1 Left 984973522 4:185210247-185210269 CCGCCGGGGGTAAGTACCCGACT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973523_984973527 -4 Left 984973523 4:185210250-185210272 CCGGGGGTAAGTACCCGACTCCT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973517_984973527 10 Left 984973517 4:185210236-185210258 CCGCCCGCCGCCCGCCGGGGGTA 0: 1
1: 0
2: 1
3: 21
4: 174
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973521_984973527 0 Left 984973521 4:185210246-185210268 CCCGCCGGGGGTAAGTACCCGAC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973518_984973527 7 Left 984973518 4:185210239-185210261 CCCGCCGCCCGCCGGGGGTAAGT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973519_984973527 6 Left 984973519 4:185210240-185210262 CCGCCGCCCGCCGGGGGTAAGTA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984973527 Original CRISPR TCCTGGCCGCCCAGCTCCGC CGG Intronic
900146927 1:1162529-1162551 TCCCCACCCCCCAGCTCCGCAGG - Intergenic
900226317 1:1535078-1535100 TCCCTGCCCCCCAGCACCGCTGG + Intergenic
900396770 1:2456316-2456338 TCATGGCCGCTGAGCCCCGCAGG + Intronic
900613873 1:3555684-3555706 TCCAGCCCGCCCTGCCCCGCAGG + Intronic
901068353 1:6505316-6505338 TTCTGTCCGCTCAGCTCAGCTGG - Intronic
901404519 1:9037549-9037571 CCCTGGCAGACCAGCTCCACTGG + Exonic
901665716 1:10825034-10825056 TCCTGGGCGCTCAGGTCAGCAGG + Intergenic
903179900 1:21599858-21599880 TCCTGGCCTCCCATTTCCCCAGG + Intronic
904041938 1:27590281-27590303 GCCTCCCCGCCCAGCTCCCCAGG - Intronic
905300318 1:36982372-36982394 TCGTGTCCTCCCAGCTCCTCTGG - Intronic
906320644 1:44813446-44813468 TCCAGGGCGCTCAGCTCCGCCGG - Exonic
910183183 1:84506768-84506790 CCCCGCCCGCCCGGCTCCGCTGG - Intergenic
912354268 1:109042181-109042203 GCCTGGCCGCCCCGCGCGGCGGG - Intergenic
912682559 1:111738655-111738677 CCCTGGGCCCCCAGCTCTGCCGG - Intronic
917565223 1:176206696-176206718 GCCTGGCCGCGCAGCTGTGCCGG + Exonic
919633695 1:199983491-199983513 ACCTGTCCTCCCAGCTCCTCAGG + Intergenic
919878927 1:201889438-201889460 TCCTCGCCGGCCAGCACTGCGGG - Exonic
922608005 1:226902827-226902849 TCCTGGCTGTCCATCTCTGCTGG - Intronic
924362398 1:243255176-243255198 TCCGGGGCCCTCAGCTCCGCTGG + Intronic
924778382 1:247126735-247126757 CGCTGCCCGCCCAGCTCTGCCGG - Intronic
924783276 1:247171685-247171707 CGCTGCCCGCCCAGCTCTGCCGG + Intronic
1062856627 10:783043-783065 TCTTGGGAGCCCAGCTCTGCGGG - Intergenic
1062986423 10:1773272-1773294 GCCTGCTCGCCCAGCTCCGGAGG - Intergenic
1064209007 10:13347889-13347911 TCCGGGCCGCCCGGGACCGCCGG - Intronic
1065709662 10:28503308-28503330 TCCTAGCAGCCCAGCCCAGCAGG - Intergenic
1066362003 10:34740203-34740225 TCCCAGCCGGCCAGCTCTGCTGG - Intronic
1067883562 10:50067984-50068006 TCCTAGCCGCCCGGCTCGGTGGG - Exonic
1069024197 10:63521864-63521886 GCCTGCCCACCCAGCGCCGCCGG - Intronic
1070971337 10:80569922-80569944 TCTTGGACGCCCACCCCCGCAGG + Intronic
1071041127 10:81309421-81309443 CCCTGGCCCGCCAGCACCGCAGG + Intergenic
1073345478 10:102779715-102779737 TCCATGCCGCCCAGCTCTGGAGG - Intronic
1074708639 10:116158614-116158636 TCCTGTCCTCCCAGCACTGCTGG - Intronic
1075643444 10:124081972-124081994 GCCGGGCCGCCCATCACCGCAGG + Intronic
1076158327 10:128221413-128221435 TCCTAGCCGCACACCTCCTCAGG + Intergenic
1076209749 10:128630841-128630863 ACCTGGCAGCCCAGCCCGGCGGG + Intergenic
1076721697 10:132396068-132396090 TCCTGGCGACCCAGCGCCGCCGG - Intergenic
1076737963 10:132467135-132467157 CCCAGGCCGCCCAGCTTCTCAGG - Intergenic
1077201626 11:1310184-1310206 TCCCCGCCGCGCCGCTCCGCAGG + Intergenic
1077350867 11:2092634-2092656 GCCTGGCCTCCCACCTCCCCTGG - Intergenic
1079451221 11:20601331-20601353 TCCTGGCCGCTCAGCCTCGCAGG - Exonic
1080668616 11:34357182-34357204 GCCTGGCCGGGCTGCTCCGCAGG - Exonic
1081528282 11:43942087-43942109 TCCTTGCCACCCCCCTCCGCAGG - Intronic
1083301979 11:61744331-61744353 TCCTTCCCGCTCAGCTCCTCGGG + Exonic
1083741350 11:64713113-64713135 CCCTGGCTGCCCAGCAGCGCGGG + Exonic
1084323804 11:68387771-68387793 TACTGACCTCCCAGCTCCTCTGG - Intronic
1086898097 11:92336410-92336432 TCTTGGCCACCCACCTCCGCTGG - Intergenic
1089040806 11:115447665-115447687 TCCTGGCTGCTCTGCTCTGCAGG - Intronic
1091393200 12:138519-138541 TCCCTGCCGCCCACCTTCGCAGG + Exonic
1091602732 12:1927878-1927900 TGCTGGCTGCCCACCTCCTCCGG - Intergenic
1091759430 12:3077326-3077348 CCCGGGCCGCCCCGCCCCGCAGG + Intergenic
1094460762 12:30695385-30695407 TCCTGGGAGCCCTGCTCCACTGG + Intronic
1094680084 12:32660088-32660110 TGCTGTCCACCCAGCTCCACAGG + Intergenic
1095529745 12:43172917-43172939 TCCTGGACTCCCAGCTACTCGGG - Intergenic
1096215521 12:49795873-49795895 TCCTGGCAGCACACCTCTGCGGG - Exonic
1097225624 12:57475551-57475573 TCCCCGGCGCTCAGCTCCGCGGG + Exonic
1102080129 12:110091118-110091140 TCATAGCCGCCCAGATCCCCTGG - Intergenic
1102423463 12:112822357-112822379 CCCTGCCAGCCCAGCCCCGCTGG + Intronic
1103521315 12:121538141-121538163 CCCTGGCGGCCCCGCGCCGCGGG - Intronic
1104935073 12:132360135-132360157 ACCTGGCCGCCCTTCTCCTCTGG - Intergenic
1104974795 12:132547671-132547693 TCATGGCCGCCCTGCTCTGAGGG + Intronic
1110356737 13:74575807-74575829 GCCTGGCCGCGCGCCTCCGCGGG + Intergenic
1113435939 13:110291064-110291086 TCCTGCCCGCCCCTCTCCTCAGG + Intronic
1114473971 14:22981590-22981612 TCCTGGCAGCCGAACCCCGCGGG + Exonic
1114626852 14:24135973-24135995 TCCAGGCTCCCCACCTCCGCTGG - Intergenic
1115664915 14:35535166-35535188 ACCTGGCCTCCCATCGCCGCTGG + Exonic
1119601548 14:75980321-75980343 TCCTGGCCTCCCAGAAGCGCCGG + Intronic
1121309336 14:92926732-92926754 TCCTAGCCTCCCAGCCCAGCAGG - Intronic
1121438684 14:93935232-93935254 TCCTGGCCTCTCAGCACCACTGG - Intronic
1122767439 14:104081956-104081978 TCCTGGCCCCCTGGCTCCCCAGG - Intergenic
1122910689 14:104826483-104826505 CCCAGGGCGCCCAGCGCCGCGGG - Intergenic
1123464615 15:20506120-20506142 GCCCGGCCGCCCCGCCCCGCCGG + Intergenic
1125482203 15:40088649-40088671 TCCTGGCAGCCCAGCCCCATCGG - Exonic
1125503295 15:40252670-40252692 TCCTGGGCTTCCCGCTCCGCAGG + Exonic
1125652941 15:41332401-41332423 TCCTCGCCGCTCGGCCCCGCAGG - Exonic
1126320074 15:47412312-47412334 TCCTGTCTGCCCAGCACTGCCGG - Intronic
1126407117 15:48332303-48332325 TGCATGCCGCCCACCTCCGCAGG - Exonic
1126849916 15:52790508-52790530 CCCTGGCCATCCAGCGCCGCAGG - Intronic
1128752349 15:70158580-70158602 TTCTGGCAGCTCAGCTCAGCTGG - Intergenic
1129109178 15:73327826-73327848 TCCTTGCCTCCCAGCTCTGTAGG + Intronic
1129540295 15:76342684-76342706 ACCTGGCGGCCCAGGCCCGCGGG + Intergenic
1130516897 15:84632736-84632758 TCCTGGCCACCCAGCTCTCTGGG - Intergenic
1131257605 15:90872165-90872187 TCCTGGCCGCACAGGTGTGCGGG - Intronic
1132973161 16:2698721-2698743 GCCTGGCCGCTCAGGGCCGCTGG + Intronic
1132975447 16:2709107-2709129 TCCAAGCCGCCCAGCCCCACTGG + Intergenic
1132976269 16:2712624-2712646 TTCTGGCCGCCCAACCTCGCTGG + Exonic
1133015403 16:2937309-2937331 TCCAGGCCGCCCAGGTCCGGTGG - Exonic
1133183898 16:4081367-4081389 TCCTGTGCGGCCAGCTCCTCTGG - Intronic
1134086280 16:11359590-11359612 TCCTGGCCTCCCAGGGCCTCAGG - Intergenic
1135743807 16:24998657-24998679 TCATGGCCTCCAAGCTCAGCTGG - Intronic
1135752555 16:25068645-25068667 TCATGGCCTCCAAGCTCAGCTGG + Intergenic
1136374813 16:29859151-29859173 TCCTGGCTGCCCACCTGCCCTGG - Exonic
1136402299 16:30025264-30025286 TCCTGGCCCCTCAGCTCTACTGG - Exonic
1136402573 16:30026580-30026602 CCCCGCCCGCCCAGCTCCCCGGG + Intronic
1139323633 16:66134995-66135017 TCCTGCCTGCCCAGGTCCACAGG + Intergenic
1139705394 16:68737581-68737603 TCCAGGCCGCTCCGCTCCTCAGG - Intronic
1140601245 16:76477486-76477508 TCCTGGGCTCCCAGCTCTGGGGG + Intronic
1142162622 16:88566523-88566545 TCTGGGCAGCCCAGCTCTGCAGG + Intergenic
1142417017 16:89948750-89948772 GCCCGGCCGCCCCGCTACGCTGG - Intronic
1142987376 17:3704329-3704351 TCTGGGCCACCCAGCTCCTCAGG - Intergenic
1143140636 17:4740054-4740076 TCCCGGCCGCCCCACTCCTCCGG - Intronic
1143524241 17:7463087-7463109 TCCTCTCCGCTCAGCTCCCCAGG + Exonic
1146797810 17:35795286-35795308 TCCTGGCCTCCGCGCTCCGCGGG + Exonic
1147239174 17:39079350-39079372 TCCTTCCCACCCAGCTCCCCAGG + Intronic
1147646239 17:42035888-42035910 TACTGGCCCCCCACCTCCCCTGG - Intronic
1148018115 17:44536751-44536773 TCGTGGCCACCCAGCTGCCCTGG - Intergenic
1151246146 17:72796462-72796484 TCCTGGAAGCCCAGCTCCACGGG - Intronic
1151362249 17:73595843-73595865 GCCTGTCCTCCCAGCTCCCCTGG - Intronic
1151570075 17:74921625-74921647 TCCTGGCCGCCAAGTCCTGCAGG + Intronic
1152266212 17:79296550-79296572 TCCTGGGAGCCCGGCTCCCCGGG - Intronic
1152677278 17:81648155-81648177 TGCTGGCCGCCCGGCTACTCGGG + Exonic
1152778895 17:82217844-82217866 TCCTGTCCGGCCAGGACCGCAGG - Intergenic
1157294586 18:46433466-46433488 TCCTGGAAGCCCAGCACCGCAGG + Exonic
1158649442 18:59273031-59273053 CCCCGGGCGCCCCGCTCCGCCGG + Exonic
1159387315 18:67742627-67742649 TCCCGGTCGTCCAGCTCAGCTGG - Intergenic
1160025263 18:75211120-75211142 TCCTGGCGGCCAAGCCCCCCGGG + Exonic
1160235941 18:77087244-77087266 TCCTCCCCGCCAGGCTCCGCGGG - Intronic
1160793241 19:932614-932636 TCCTGGCCCCCCAGCACCCTGGG - Exonic
1160947337 19:1649885-1649907 TCCTGGGCCCCCAGCTTGGCTGG - Intronic
1162029741 19:7912230-7912252 TCCTGGCCTCGCGCCTCCGCAGG - Intronic
1164722639 19:30443810-30443832 TCCTGGCCAACCAGCTGGGCCGG + Exonic
1167110407 19:47457374-47457396 CCCAGGCCGCCCAGCTCACCTGG + Exonic
1167349830 19:48967700-48967722 TCCTGGCTGCTCAGCTCCACTGG - Intergenic
1167932203 19:52874986-52875008 TCCTGGGAGCCCAGATCTGCAGG + Intronic
924988392 2:290002-290024 GCCTCCCCGCCCAGCTCTGCCGG - Intergenic
925786036 2:7431904-7431926 GCCTGGCCGTCCATCCCCGCAGG + Intergenic
926048125 2:9725024-9725046 TCCTGGCCGCACTGCTTCCCTGG - Intergenic
926163779 2:10505512-10505534 TCCTGGCCACCCACCCCTGCAGG + Intergenic
930320950 2:49854137-49854159 TCCTGCCGTCCCAGCTCCTCAGG + Intergenic
933723688 2:85414035-85414057 TCCTGGCCGCGCACCTCCAGGGG - Intronic
933777723 2:85780968-85780990 TTCTGGCCTCCAAGCTCCCCAGG - Intronic
935666672 2:105518457-105518479 CCCTGGCCGGCCAGCACCCCGGG - Intergenic
938228272 2:129636366-129636388 TCCTGTACTCCCAGCTCCTCGGG - Intergenic
938863982 2:135399191-135399213 ACCTGGTCTCCCAGCTCCCCAGG + Intronic
943940569 2:193989026-193989048 TCCTGGCCCCATAGCTCTGCAGG - Intergenic
944278686 2:197870032-197870054 TCGTGGCCGCCCAGATACACGGG - Intronic
944480486 2:200152749-200152771 TCCTGACCTCCCAGCTCAGCTGG + Intergenic
947634174 2:231671824-231671846 TCCTGCCCACTCAGCTCAGCCGG - Intergenic
947942635 2:234071735-234071757 ACCTGGCCGCTCAGCTCCTGAGG + Intronic
948103279 2:235392400-235392422 TCAGGGCCGCCCAGGGCCGCCGG - Intergenic
1172760252 20:37316425-37316447 CCCTGCCCGCCCAGCTCCTCAGG - Exonic
1174467770 20:50731017-50731039 GCCTGGTTGCCCGGCTCCGCCGG - Intergenic
1179453037 21:41478396-41478418 TCCTTGCCTCCCAGGTCCCCAGG - Intronic
1179482238 21:41685678-41685700 TCCTGGCTGCTCAGCACAGCAGG - Intergenic
1179529825 21:42010731-42010753 TACTGGCGGCCCAGCTGGGCAGG - Intergenic
1179639302 21:42736738-42736760 TCCTGGCTGCCCTCCTCCCCTGG + Intronic
1180070005 21:45431417-45431439 TCCTGCCTGCCCACCTCCCCTGG - Intronic
1181174959 22:21030063-21030085 TCTTCCCCGCCCAGCTCCCCAGG - Exonic
1182123385 22:27800641-27800663 TCCGGGACGCTCAGCACCGCGGG + Exonic
1182449216 22:30408769-30408791 TCCTGCATCCCCAGCTCCGCAGG - Intronic
1182550262 22:31097094-31097116 GCCTGTCCGCCCACCTCCTCCGG + Intronic
1183343050 22:37292623-37292645 TCCCCGCTGCTCAGCTCCGCGGG - Exonic
1183583990 22:38741485-38741507 TCCGGGCCTCCCAGGTCAGCGGG - Exonic
1184697289 22:46147187-46147209 TCCTGGCCCCACAGCTCCAGGGG - Intergenic
1184938122 22:47739914-47739936 TCCTCCCCACCCAGCTCCGGGGG + Intergenic
950069645 3:10141980-10142002 TCCTCGGCGCCCAGTTCCTCCGG - Exonic
960586245 3:119323326-119323348 TCCAGGCCGCCCAGCACCTCGGG + Intronic
961502034 3:127343009-127343031 TCCTGGCAGCCCCGTTCCTCTGG - Intergenic
962367668 3:134796684-134796706 TCCTGGGAACACAGCTCCGCGGG + Intronic
969323499 4:6427146-6427168 TCCTGGCCTCCCAGCCCAGTGGG - Intronic
969559854 4:7939908-7939930 CCCTGGGCGCCCGGCTCCGCTGG - Exonic
983577162 4:169271454-169271476 TCCAGGGCTCCCAGCCCCGCCGG - Intergenic
984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG + Intronic
985585111 5:727336-727358 CCCTGGCATCCCAACTCCGCTGG - Intronic
985598614 5:811651-811673 CCCTGGCATCCCAACTCCGCTGG - Intronic
986543380 5:8870413-8870435 TCCGGGCCGCCCAACTCCAGGGG - Intergenic
995748739 5:115431302-115431324 TCTTTGCTGCCCAGCTCCCCAGG - Intergenic
997611468 5:135218514-135218536 CCCTGCCCTCCCAGCTCCTCAGG - Intronic
999362051 5:150993447-150993469 ACCTGGTCCCCCACCTCCGCAGG - Intergenic
1001433993 5:171685507-171685529 TCCTTGCCGCCCAGCACCCGTGG + Intergenic
1001933855 5:175691115-175691137 CCCTGCCCGCCCAGCTTCTCAGG + Intergenic
1002182119 5:177436059-177436081 TGCCGCCCGCCCAGCTCCGGAGG + Exonic
1002199732 5:177520976-177520998 TCCTGGACCCTCAGCTCCCCAGG - Intronic
1006027623 6:31157633-31157655 TCCAGGCCGCCTAGATCCCCAGG + Exonic
1007341238 6:41192648-41192670 GCCTGGCCGCCCTCCTCCCCAGG + Intronic
1007566337 6:42853717-42853739 TCCTGGCCATCCAGCTGTGCAGG + Exonic
1017090329 6:150753489-150753511 TGCTGGGCGGCCAGCTCGGCAGG - Intronic
1017977961 6:159374859-159374881 TCCTGGCAGCCCAGCACAGTAGG - Intergenic
1018400579 6:163415446-163415468 TCCTGGCCTCCCAGTCCCCCCGG - Intronic
1019203655 6:170341279-170341301 TCCTGGCCTCCCAGCACTGTTGG + Intronic
1020275467 7:6622159-6622181 TGCTGGGCGCCTAGCTCCACCGG - Exonic
1020288848 7:6706841-6706863 TCTTCGGCGCCCAGCCCCGCAGG + Exonic
1022923247 7:35037152-35037174 GCCTGGCCGCCCGGCTGCGCTGG - Intronic
1024579944 7:50793329-50793351 TCCCGGGCGCCCCGCGCCGCCGG + Intronic
1024801798 7:53087674-53087696 CACTGGCCGCCCAGCCCCACGGG - Intergenic
1025715708 7:63953503-63953525 TCCTGGGCCCCCAGCTCTCCTGG - Intergenic
1027226478 7:76247091-76247113 ACCTGGCCTCCCAGTTCCTCTGG - Intronic
1028913013 7:96228941-96228963 TCCTGACAGCCCTGCCCCGCCGG - Intronic
1032198706 7:129804521-129804543 TCCGGGCCGCCCAGCTAGGGAGG + Intergenic
1033607707 7:142939629-142939651 CCCTGGCCCCCCAGCTCTGCAGG + Exonic
1034285420 7:149880530-149880552 TCCTGGCTGGCCAGCTGCTCAGG + Exonic
1035063740 7:156090636-156090658 TCCTGGCCTTCCAGGTTCGCTGG + Intergenic
1035092694 7:156327641-156327663 GCCTGGCCAGCCAGCTCTGCAGG - Intergenic
1036755067 8:11466392-11466414 CCCTGGCTGCCCGGCTCCTCTGG + Intronic
1037837208 8:22221325-22221347 CCCTCGCCCCCCAGCTCCCCAGG + Exonic
1038454923 8:27666946-27666968 TCATGGCCGCCCCCCTCCACCGG + Intronic
1041656176 8:60352582-60352604 TCCTGGACACCCATCTCCACAGG - Intergenic
1048200976 8:132373805-132373827 TCCTCCCTGCCCAGCTCCCCAGG + Intronic
1048980301 8:139699850-139699872 TCGTGGCCGCCCAGCACCAGCGG + Intronic
1048986295 8:139736902-139736924 TCCTTGCAGCCCTGCTCAGCAGG - Intronic
1049452541 8:142669893-142669915 GCCCGGCCGCCCAGCGCCTCAGG + Intronic
1049479688 8:142815966-142815988 TCCTGGCTGACCAGATCAGCTGG - Intergenic
1049729378 8:144168038-144168060 TCCTGGCCAGGCAGCTCCTCAGG + Intronic
1049754357 8:144302695-144302717 TCCTGTGGGCCCAGCTACGCGGG + Intronic
1049788372 8:144462169-144462191 TCCCGGCCGCCGGGCCCCGCAGG + Intronic
1057436484 9:95045264-95045286 TCCCGGCAGTGCAGCTCCGCAGG + Intronic
1057744628 9:97741401-97741423 TCCTGCCCGCCCGCCTCTGCCGG + Intergenic
1059426203 9:114222392-114222414 TCCTGGCCCCCCAGCCCCTCTGG - Intronic
1060820997 9:126661607-126661629 TCCTGGTGGCCCAGCTGAGCTGG - Intronic
1062521921 9:136961508-136961530 CCAGGGCCGCCCAGCTCAGCTGG + Intergenic
1185714099 X:2327489-2327511 TCCTGGCCACCCTGCTCAGTTGG + Intronic
1187031612 X:15493609-15493631 TCCGTGCCGCCAAGCTCCGCCGG - Intronic
1187143896 X:16620107-16620129 CCCTCGCCGCCCATCTCCTCTGG + Intronic
1189915491 X:45851612-45851634 CCCTGCCCGCCCATCCCCGCCGG + Intergenic
1190050306 X:47144593-47144615 TCCCGGCCGCCCGCGTCCGCTGG - Exonic
1191185572 X:57607642-57607664 TCCTCGCTGCCCAGCACAGCAGG - Intergenic
1200108397 X:153726615-153726637 GCCTGGCCAGCCAGCTCTGCTGG - Intronic