ID: 984973527

View in Genome Browser
Species Human (GRCh38)
Location 4:185210269-185210291
Sequence TCCTGGCCGCCCAGCTCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 198}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984973510_984973527 30 Left 984973510 4:185210216-185210238 CCGGCTGGCCGCGACCTCAGCCG 0: 2
1: 0
2: 2
3: 10
4: 136
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973520_984973527 3 Left 984973520 4:185210243-185210265 CCGCCCGCCGGGGGTAAGTACCC 0: 1
1: 0
2: 0
3: 3
4: 34
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973522_984973527 -1 Left 984973522 4:185210247-185210269 CCGCCGGGGGTAAGTACCCGACT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973512_984973527 16 Left 984973512 4:185210230-185210252 CCTCAGCCGCCCGCCGCCCGCCG 0: 1
1: 9
2: 20
3: 124
4: 848
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973519_984973527 6 Left 984973519 4:185210240-185210262 CCGCCGCCCGCCGGGGGTAAGTA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973517_984973527 10 Left 984973517 4:185210236-185210258 CCGCCCGCCGCCCGCCGGGGGTA 0: 1
1: 0
2: 1
3: 21
4: 174
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973511_984973527 22 Left 984973511 4:185210224-185210246 CCGCGACCTCAGCCGCCCGCCGC 0: 2
1: 1
2: 3
3: 31
4: 330
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973523_984973527 -4 Left 984973523 4:185210250-185210272 CCGGGGGTAAGTACCCGACTCCT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973521_984973527 0 Left 984973521 4:185210246-185210268 CCCGCCGGGGGTAAGTACCCGAC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198
984973518_984973527 7 Left 984973518 4:185210239-185210261 CCCGCCGCCCGCCGGGGGTAAGT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 984973527 4:185210269-185210291 TCCTGGCCGCCCAGCTCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984973527 Original CRISPR TCCTGGCCGCCCAGCTCCGC CGG Intronic