ID: 984973533

View in Genome Browser
Species Human (GRCh38)
Location 4:185210285-185210307
Sequence CCGCCGGCCCTCCCCGCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 203}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984973520_984973533 19 Left 984973520 4:185210243-185210265 CCGCCCGCCGGGGGTAAGTACCC 0: 1
1: 0
2: 0
3: 3
4: 34
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973521_984973533 16 Left 984973521 4:185210246-185210268 CCCGCCGGGGGTAAGTACCCGAC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973526_984973533 -2 Left 984973526 4:185210264-185210286 CCGACTCCTGGCCGCCCAGCTCC 0: 1
1: 0
2: 1
3: 46
4: 509
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973519_984973533 22 Left 984973519 4:185210240-185210262 CCGCCGCCCGCCGGGGGTAAGTA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973525_984973533 -1 Left 984973525 4:185210263-185210285 CCCGACTCCTGGCCGCCCAGCTC 0: 1
1: 0
2: 1
3: 32
4: 375
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973522_984973533 15 Left 984973522 4:185210247-185210269 CCGCCGGGGGTAAGTACCCGACT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973528_984973533 -8 Left 984973528 4:185210270-185210292 CCTGGCCGCCCAGCTCCGCCGGC 0: 1
1: 0
2: 4
3: 52
4: 508
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973517_984973533 26 Left 984973517 4:185210236-185210258 CCGCCCGCCGCCCGCCGGGGGTA 0: 1
1: 0
2: 1
3: 21
4: 174
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973523_984973533 12 Left 984973523 4:185210250-185210272 CCGGGGGTAAGTACCCGACTCCT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973518_984973533 23 Left 984973518 4:185210239-185210261 CCCGCCGCCCGCCGGGGGTAAGT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984973533 Original CRISPR CCGCCGGCCCTCCCCGCTTC CGG Intronic