ID: 984973533

View in Genome Browser
Species Human (GRCh38)
Location 4:185210285-185210307
Sequence CCGCCGGCCCTCCCCGCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 203}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984973522_984973533 15 Left 984973522 4:185210247-185210269 CCGCCGGGGGTAAGTACCCGACT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973517_984973533 26 Left 984973517 4:185210236-185210258 CCGCCCGCCGCCCGCCGGGGGTA 0: 1
1: 0
2: 1
3: 21
4: 174
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973525_984973533 -1 Left 984973525 4:185210263-185210285 CCCGACTCCTGGCCGCCCAGCTC 0: 1
1: 0
2: 1
3: 32
4: 375
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973520_984973533 19 Left 984973520 4:185210243-185210265 CCGCCCGCCGGGGGTAAGTACCC 0: 1
1: 0
2: 0
3: 3
4: 34
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973526_984973533 -2 Left 984973526 4:185210264-185210286 CCGACTCCTGGCCGCCCAGCTCC 0: 1
1: 0
2: 1
3: 46
4: 509
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973523_984973533 12 Left 984973523 4:185210250-185210272 CCGGGGGTAAGTACCCGACTCCT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973519_984973533 22 Left 984973519 4:185210240-185210262 CCGCCGCCCGCCGGGGGTAAGTA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973521_984973533 16 Left 984973521 4:185210246-185210268 CCCGCCGGGGGTAAGTACCCGAC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973518_984973533 23 Left 984973518 4:185210239-185210261 CCCGCCGCCCGCCGGGGGTAAGT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203
984973528_984973533 -8 Left 984973528 4:185210270-185210292 CCTGGCCGCCCAGCTCCGCCGGC 0: 1
1: 0
2: 4
3: 52
4: 508
Right 984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG 0: 1
1: 0
2: 2
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984973533 Original CRISPR CCGCCGGCCCTCCCCGCTTC CGG Intronic
900094084 1:933355-933377 CCACCTGCCCTCCCCGCCCCTGG - Intronic
900264874 1:1752326-1752348 CATCCAGCCCTCCCCGCTTGAGG - Exonic
900314908 1:2051650-2051672 CTGCCGGCCGTCCCTGCCTCTGG - Intronic
900349538 1:2228137-2228159 CGGCCCGCCCGCCCGGCTTCCGG - Intergenic
900513187 1:3069829-3069851 CCTCCGCCCCTCCCCGGCTCGGG - Intronic
900558313 1:3291061-3291083 GCACCGGCCCCACCCGCTTCCGG + Intronic
900577988 1:3393851-3393873 CCCCCGCCCCGCCCCGCCTCGGG + Intronic
901491877 1:9600940-9600962 CCACCGGCCCGCCTCACTTCTGG - Intronic
902729853 1:18362265-18362287 CTGCCGGACCACCCTGCTTCGGG + Intronic
903724539 1:25431014-25431036 CCGCTGGCCCGCCCCGCGTCGGG - Exonic
904720013 1:32500699-32500721 CGGCCGTCCCTCCCCGCGCCCGG + Intronic
908027765 1:59969926-59969948 CGGCCGGCCCTGCCCGCCCCGGG - Intergenic
908128049 1:61050226-61050248 CCCCCTGCCCTCCCCTCTCCAGG + Intronic
913274201 1:117121808-117121830 GCGGCGGCCCTCGCCGCTCCGGG + Intronic
915549861 1:156625548-156625570 CCGCCTCCCCTCCCCGCCGCCGG - Exonic
915977401 1:160400359-160400381 CCAGCGGCCCTCCCCGATCCTGG - Intergenic
917291733 1:173477722-173477744 CCTCCTGGCCTCCCCGCCTCCGG + Intronic
917854777 1:179091389-179091411 GCGCCGCCCCTCCCATCTTCAGG - Intronic
917944512 1:179955024-179955046 CGGCCTGGCCTCCCCGCTCCGGG - Exonic
919716441 1:200782460-200782482 CCGCAGCCCCACCCCACTTCAGG + Intronic
919892037 1:201982689-201982711 CCGCCGGGCCGCGCCGCTGCCGG - Exonic
1062819949 10:527279-527301 CTCCCGACCCTCCCCGCTTCTGG + Intronic
1063288532 10:4716129-4716151 ACCCCCGCCCTCCACGCTTCTGG + Intergenic
1065483515 10:26216311-26216333 CCGCCCGCACTTCCCGCCTCTGG + Exonic
1065588521 10:27242144-27242166 CCGCCGTTCCGCCGCGCTTCCGG + Intergenic
1066672836 10:37858005-37858027 CCGCCGCTCCTCGCCGCCTCCGG + Intronic
1069544688 10:69319553-69319575 TCGCCGCCCCTCCCCGTTCCGGG - Intronic
1069869353 10:71523817-71523839 CCGCCAGCCTTCCGGGCTTCTGG - Intronic
1075106541 10:119543145-119543167 CCGCGGGCGCACCGCGCTTCGGG + Intergenic
1076736663 10:132462103-132462125 CCCCCAGCCCGCCCCGGTTCCGG - Intergenic
1077006019 11:356375-356397 AGGCGGCCCCTCCCCGCTTCCGG + Intergenic
1077144055 11:1036984-1037006 GCCCGGGCCCTCCCCGCTGCTGG + Intergenic
1078453603 11:11458093-11458115 ACCCCTTCCCTCCCCGCTTCTGG + Intronic
1081927896 11:46846030-46846052 CCCCCGGCCCTGCCCGCCGCAGG + Intronic
1083317963 11:61828037-61828059 CCTCCGGCTCCCCCCGCCTCGGG - Exonic
1091122021 11:133064753-133064775 CTGCCGGCCCGCCCCGCGCCGGG - Intronic
1091754210 12:3041134-3041156 CCTCCTGCCCTCCCCGCTTCAGG - Intergenic
1091915840 12:4271443-4271465 CCGCCGGGGCTCCCAGCCTCTGG - Intergenic
1094718206 12:33034193-33034215 CGGCCGGCCCTGCCGGCTCCGGG - Intergenic
1097223266 12:57462417-57462439 CGGCCGGCCCGGCCCGCTCCCGG + Intronic
1099285140 12:80707867-80707889 CTGCTGTCGCTCCCCGCTTCCGG - Exonic
1100260519 12:92928874-92928896 CCACCCGCCCTCCCCGCCCCCGG + Intronic
1100406453 12:94276471-94276493 CCGCCCTCCCTCCCTCCTTCTGG - Intronic
1104376197 12:128267121-128267143 CCGCCGGCCCGCCCCGCCCCCGG - Intergenic
1104954928 12:132459663-132459685 CCCCCGACCCTCCCCACTGCTGG - Intergenic
1111841426 13:93455047-93455069 CGGCCGGCCCTGCCGGCTCCGGG - Intronic
1112290808 13:98143066-98143088 CCACCGCCCCTCCCCGGGTCTGG - Intronic
1113437801 13:110307037-110307059 CAGCCGTCCCTCGCCGCCTCGGG - Exonic
1113643052 13:111971956-111971978 CAGCCAGCCATCCCCGGTTCTGG - Intergenic
1113934010 13:113983861-113983883 CTGATGGCCCTACCCGCTTCAGG - Intronic
1114474915 14:22987488-22987510 TGGCCCGCCCTCCCCGTTTCCGG - Exonic
1115754777 14:36519855-36519877 CCTCCTGCCCTCCCCGCTCTCGG - Intronic
1116430129 14:44836277-44836299 CCGGTGTCCCTCCCCCCTTCTGG - Intergenic
1116905205 14:50396989-50397011 CCGGCCGCCCTCCCGGCTGCAGG + Intronic
1117920374 14:60722005-60722027 CAGCCCGCCCTTGCCGCTTCTGG - Intronic
1118644093 14:67820143-67820165 CCCCAGCCCCTTCCCGCTTCGGG + Intronic
1120167897 14:81220343-81220365 CCGCCGCCGCTTCCCGCCTCGGG - Intronic
1120953219 14:90061166-90061188 CCGCGAGCCAGCCCCGCTTCCGG - Intergenic
1121330499 14:93046587-93046609 CCGCCGCCCCCCCCCGCCCCCGG - Intronic
1121740737 14:96250672-96250694 CCACCGGCCCTGCTCTCTTCTGG + Intronic
1122505149 14:102227362-102227384 CCCCCAGCCCTCCCTGCTGCTGG + Intronic
1122870266 14:104635211-104635233 CCCCAGCCCCTCCCCGATTCAGG - Intergenic
1123777938 15:23599022-23599044 CCACTGGCTCTCCCAGCTTCAGG - Intronic
1125093703 15:35826674-35826696 CCTCTTGCCCTCCCCACTTCTGG - Intergenic
1126134665 15:45378532-45378554 GCGCCCGCCCACCCCGCTCCGGG - Exonic
1130319947 15:82833278-82833300 CCGCCGGCACTTCCACCTTCCGG - Exonic
1131063290 15:89417485-89417507 CCGCCGCCCCTGCCCACTCCTGG + Intergenic
1131075112 15:89490649-89490671 CCAACTCCCCTCCCCGCTTCTGG - Intronic
1132150103 15:99453051-99453073 CCACCAGCCCTGCCTGCTTCTGG + Intergenic
1132748416 16:1446489-1446511 CCGCCTGCCCGCCCAGCTGCAGG + Exonic
1132849737 16:2019686-2019708 CCTCCGTCCCTCCCCCCATCTGG + Exonic
1133241313 16:4416128-4416150 CCGCCTGCCTTCCCAGCTTCCGG - Intronic
1133282697 16:4676209-4676231 GGGCCGGCCCTCCCTGCTACAGG - Intronic
1136285398 16:29237546-29237568 TCCCCGGCCCTTCCAGCTTCTGG + Intergenic
1137617358 16:49855820-49855842 CCGCCGCCCCCCGCCGCTCCGGG + Intronic
1137645098 16:50066571-50066593 CCGCTGGCCTCCCCCGCGTCTGG + Intronic
1141538408 16:84699759-84699781 CTGCCTGCCCTCTCCCCTTCCGG + Intergenic
1142090723 16:88207678-88207700 TCCCCGGCCCTTCCAGCTTCTGG + Intergenic
1142112183 16:88338831-88338853 CTGCTGCCCCTCCCTGCTTCTGG - Intergenic
1143174235 17:4947521-4947543 CCGCTCCCCCTCCCCACTTCCGG + Intronic
1143539812 17:7562242-7562264 CCGCCCGGCTTCCCCGCTCCCGG + Exonic
1144828941 17:18121242-18121264 CCGCCGGCCCCGCTCGCTGCAGG + Exonic
1146132557 17:30291724-30291746 CCCCCGGCCTTCCCCGCCGCCGG + Intronic
1146403720 17:32519663-32519685 CCGCCTGCCCGCCCTCCTTCCGG + Intronic
1147006421 17:37407174-37407196 CCGGGGGCCCGCCCCGCGTCTGG + Intronic
1148323790 17:46771938-46771960 CCGCCGCGCCTCGCCCCTTCCGG + Intronic
1149534880 17:57425136-57425158 ACCCTGGCCCTCCCCTCTTCAGG - Intronic
1152026784 17:77815106-77815128 CCTCCCTCCCTCCCCACTTCTGG + Intergenic
1152264763 17:79287816-79287838 CCGCCTGGCCTCCCTGCTTCTGG + Intronic
1152363244 17:79841976-79841998 CCCCCGGCCACCCCCGCTCCTGG + Intergenic
1152458995 17:80431616-80431638 CCTCAGGCCCTCCATGCTTCAGG + Intronic
1158498634 18:57979861-57979883 CTGCGGGTCCTCCCCACTTCCGG + Intergenic
1159040525 18:63319874-63319896 CCACCGGCGCACCCCGCCTCCGG + Exonic
1160408515 18:78659337-78659359 GCCCCTGCCCTCCCCGCTCCAGG - Intergenic
1160816600 19:1038894-1038916 CCCCCAGCCCTCCTCCCTTCTGG + Exonic
1160930137 19:1566570-1566592 CCGCCACCCCTCCCCGCTCCTGG - Intronic
1160991830 19:1863298-1863320 CCGCCGCCCCCCGCCGCTTCTGG - Exonic
1161250373 19:3276669-3276691 CCGCAGCCCCGCCCCTCTTCAGG - Intronic
1161281718 19:3449154-3449176 CCGCCGCCCCTCCCCGCCAGGGG - Intronic
1161422316 19:4182592-4182614 TCCCCGCCCCGCCCCGCTTCCGG - Exonic
1161779135 19:6279691-6279713 CGCCCGGCCCTCCCCGGTCCCGG - Intronic
1161784091 19:6312290-6312312 CCGCCTGCCCTTGCCGCTGCAGG - Exonic
1162111859 19:8403832-8403854 CCGCCCGTCCTCCTCGCCTCTGG - Exonic
1164270601 19:23668788-23668810 CGGCCGGCCCTGCCCGCCCCGGG - Intronic
1164713431 19:30375258-30375280 CAGCCGGCCCTGCCCGCGCCCGG + Intronic
1165333762 19:35155279-35155301 CCGCCGGCCCTTGCAGCTGCTGG + Exonic
1165348127 19:35261802-35261824 CCCCAGCCCCTTCCCGCTTCAGG + Intronic
1165744739 19:38224097-38224119 CCGCCGGCCCGCACCACCTCAGG + Exonic
1165951566 19:39476395-39476417 CCACCGGCCCTGCCTGCTTCAGG - Exonic
1165994286 19:39833398-39833420 CCGCTTGCCCTCCCCGCCGCGGG - Exonic
1167058871 19:47131020-47131042 GCGCCGGCCCTGACCGTTTCTGG - Exonic
1167151586 19:47713386-47713408 CCTCCCGTCCTCCCCGCTCCGGG + Exonic
1167341907 19:48921394-48921416 CCACAGGCCTTCCCAGCTTCTGG - Intronic
1167378987 19:49127896-49127918 CCGCCGGCCATCCTCGCTGATGG - Exonic
1167477150 19:49707630-49707652 CGGCCAGCCCTCCCTGGTTCTGG + Intronic
1167486670 19:49767003-49767025 CAGCCAGCCCTCCCCGCGGCCGG + Intronic
1168332463 19:55578485-55578507 CCGCCGGGGAGCCCCGCTTCTGG - Exonic
1168339210 19:55614101-55614123 ACGCGGGCCCTCCTCGCTTCAGG - Exonic
925098988 2:1229860-1229882 CAGCCGGCCCTGCCGGCCTCGGG - Intronic
925537822 2:4935575-4935597 CGGCCGGCCCTGCCGGCTCCGGG - Intergenic
928398376 2:30960611-30960633 CCTCAGGCCCTCCCAGCTGCAGG - Intronic
932699890 2:73985185-73985207 CCGCCGCCCCTCCCCCACTCCGG - Intergenic
938939937 2:136161303-136161325 CTGACGGCTCTCCCAGCTTCGGG - Intergenic
942360626 2:175168209-175168231 CCGCCCGCTCGCCCCGCTCCCGG + Intronic
1168771854 20:420792-420814 CCCCTGGCCCTTCCCCCTTCGGG + Intronic
1170794972 20:19539303-19539325 CCTCCTGCCCTCCCCACCTCTGG + Intronic
1172117918 20:32583177-32583199 CCGCCCGCCCTCCGCGCTCGCGG + Intronic
1172118270 20:32584041-32584063 CCGCCGGGCCTCCCAGCGCCAGG - Intronic
1172249039 20:33465929-33465951 CCGCCTGCCCTCCCTTGTTCTGG - Intergenic
1172320604 20:33993264-33993286 CCTCCTCCCCTCCCTGCTTCCGG + Intergenic
1173596868 20:44264203-44264225 CAGCCAGCCCTCCCAGCATCTGG + Intronic
1173933363 20:46840145-46840167 CCCCCAGCCCTGCCTGCTTCAGG - Intergenic
1173939123 20:46894944-46894966 CCGCCCGCCCGCACCGCGTCGGG + Exonic
1175718311 20:61269944-61269966 CGGCCGGCCCTCTCCACATCTGG - Intronic
1175992648 20:62797088-62797110 CCGCCGCCCCTCCTCCCCTCAGG + Exonic
1176199907 20:63855527-63855549 CCGCCGCCCAGCCCAGCTTCAGG + Intergenic
1179505020 21:41834528-41834550 CCGCCGGGCCCCCCCTCTCCAGG + Intronic
1179529829 21:42010745-42010767 CCGCCAGTAGTCCCCGCTTCCGG + Intergenic
1179939007 21:44626425-44626447 CCGCCAGCCCTCGCCACTGCTGG - Intronic
1180071873 21:45440712-45440734 CCGCAGGCCCTGACTGCTTCCGG - Intronic
1180559147 22:16601746-16601768 CGGCCCGCCCTCCCCGCGCCGGG + Intergenic
1180960092 22:19758667-19758689 CCCCCGGCCCTCCCTGCGCCCGG + Intronic
1181109242 22:20591674-20591696 CTGCCAGCCCTCCCCTCTCCAGG - Intergenic
1181236688 22:21451213-21451235 CCGGTGTCCCTCCCCCCTTCTGG - Exonic
1181381464 22:22508247-22508269 CCCCAGGCCCTCCCCAGTTCTGG - Intronic
1182664191 22:31945060-31945082 CGACCGGCCCGCCCCCCTTCCGG - Intronic
1183153507 22:36055970-36055992 CCCCCGTCCCTCCCCTCTTGTGG + Intergenic
1183856018 22:40635908-40635930 CAGTCCACCCTCCCCGCTTCGGG - Intronic
1184373934 22:44099867-44099889 CCTCCCGCCTTCCCCTCTTCTGG - Intronic
951728134 3:25782967-25782989 CCTCCGCCCGGCCCCGCTTCCGG + Intronic
952393698 3:32902893-32902915 CCGCCGGCCCTGCCCGCCCCGGG + Intergenic
952593621 3:34988475-34988497 CCGCCGGCCCTACCGGCCCCAGG + Intergenic
954466295 3:50657005-50657027 CAGGCAGCCCTCCCAGCTTCAGG - Intergenic
957371470 3:79300318-79300340 CCGCCGGCCCTGCCGGCCCCAGG + Intronic
963939417 3:151085328-151085350 CCGCCCTCGCTCCTCGCTTCGGG - Intergenic
966912932 3:184569367-184569389 CCGCCGGCCATCCCGGCTGTCGG + Intronic
968183670 3:196616031-196616053 CCTCCCACCCTCCCCCCTTCTGG + Intergenic
968584147 4:1408125-1408147 TCCCCCGCCCTCCCCGCTGCTGG + Intergenic
968652760 4:1766728-1766750 TCTCCGGCCATCCCCGCCTCAGG + Intergenic
969343465 4:6556907-6556929 CCACCTGCCCTCCCAGCTCCTGG + Intronic
969360118 4:6658036-6658058 CCGCCGCCCCTTCCCGCCCCGGG - Intergenic
969689376 4:8695872-8695894 CCGCCTGCCCTGCCCGCCCCAGG - Intergenic
970333325 4:15004764-15004786 TCGCCGCGCCTCCCCGCGTCGGG - Intronic
975596379 4:76050918-76050940 CCGCCGGCCCTGCCGGCCCCAGG - Intronic
975883553 4:78939234-78939256 CCGCCGCCGCTCCCCGGCTCGGG + Exonic
977231164 4:94452307-94452329 CTGCCGGCCCTCGCCACCTCCGG - Intronic
977717360 4:100196781-100196803 CGGCCGGCCCTGCCGGCTCCGGG - Intergenic
979637956 4:122978538-122978560 CAGCCTGCCCTCCATGCTTCAGG + Intronic
984973533 4:185210285-185210307 CCGCCGGCCCTCCCCGCTTCCGG + Intronic
985129218 4:186724439-186724461 CCCCAGGCCCTCCCCGCCGCGGG + Intronic
985841231 5:2307570-2307592 CCACAGGCCCACCCGGCTTCAGG + Intergenic
987415391 5:17656240-17656262 CCCCCCGCCCACCCCGCTCCCGG - Intergenic
991587626 5:68216090-68216112 CCACCGGCCCTCCCCGCCTCCGG + Intronic
993555038 5:89325918-89325940 CCTCCATCCCTCCCCGCTTTTGG + Intergenic
997561035 5:134846244-134846266 CCGCCGCCCTACCCCGCTCCCGG - Intronic
998406645 5:141878160-141878182 CCGCCGGCCATGACCGCTTCGGG + Intronic
998560348 5:143165711-143165733 CCACCGACCCTCCCCACTTTTGG + Intronic
999300126 5:150485908-150485930 CCGCCGGCCGCCCCGGCCTCCGG + Intronic
1002291575 5:178204309-178204331 GCGCCGTCCCGCCCGGCTTCGGG + Intergenic
1002643838 5:180643450-180643472 CCTCCTCCCCTCCCCGCTGCTGG + Intronic
1005987688 6:30884583-30884605 CCGCCGGCGCCTCCCGCTCCCGG + Intronic
1006512146 6:34527219-34527241 CCGCCCCGCCTCCCCGCTTACGG - Intronic
1007418925 6:41707642-41707664 TCCCCAGCCCTCCCAGCTTCAGG - Intronic
1007558138 6:42783258-42783280 CCGCCGGTCCTCCGCGCGGCTGG - Intronic
1007794925 6:44339604-44339626 CCACCGCCCCTCCCTGCATCAGG + Intronic
1012211278 6:96521716-96521738 CCGCCCGCCCCCCGCGCCTCGGG + Intronic
1014788456 6:125644552-125644574 CCGCCGGCCCTGCCGGCCCCAGG + Intergenic
1018331094 6:162727894-162727916 CCGCCGCCCTTTCCGGCTTCAGG + Intronic
1019389718 7:779244-779266 CAGCCGCCCCTCCCAGCGTCGGG + Intronic
1019564400 7:1672232-1672254 CCGCCCTCCCTCCCCTCCTCTGG - Intergenic
1020213201 7:6170523-6170545 CCGGCGGCTCACCCAGCTTCAGG + Exonic
1027151894 7:75739091-75739113 CCGCCCGCCCCCGCCCCTTCAGG + Intergenic
1032174398 7:129611898-129611920 CGGCCGGCCCGCCCCGCAGCCGG + Intronic
1034618139 7:152436183-152436205 CGGCCGGCCCTCCCCGCGCCGGG - Intergenic
1034951029 7:155297463-155297485 GCGCCGCCCCTCCCGGCTCCTGG - Intergenic
1035206741 7:157298567-157298589 CCCTCGGCCCTCCCCGCTTGTGG - Intergenic
1035519645 8:266340-266362 CCGCCGGCCGCCCCCTCCTCAGG - Intergenic
1037865688 8:22440857-22440879 CAGCCAGCCCTCCCCGCAGCCGG - Intronic
1037876458 8:22551302-22551324 CCGCCGCCCCTCCGCGCTGGGGG - Intronic
1042858907 8:73294502-73294524 CCGCCCGGCCTCCCCGCCCCCGG - Intronic
1043129951 8:76447874-76447896 CCGCCGGCCCTGCCGGCCCCGGG - Intergenic
1044604905 8:94039932-94039954 CCGCGGGCCCTCTCCTCTCCTGG - Intergenic
1045516195 8:102863331-102863353 CCGCCCGCCCGCCGGGCTTCGGG + Intronic
1047631718 8:126714897-126714919 CGGCCGGCCCTGCCGGCTCCGGG - Intergenic
1049184246 8:141241006-141241028 CCTCCCGCTCTCCCCGCTTTGGG + Intronic
1053056096 9:34993904-34993926 CCCCCGGCCCTGCCTGCTTCTGG + Intronic
1054808093 9:69412351-69412373 CCCTTGGCCCTCCCCGCTTCTGG + Intergenic
1057922086 9:99105474-99105496 CCGCCTCCGCTCCCCGCTTGCGG - Intronic
1060770253 9:126327054-126327076 CCGCCCGCCCTCCCGGCTGCAGG - Intronic
1060812650 9:126618789-126618811 CCACCGACCCTCCCCCCTTCCGG - Intronic
1061509356 9:131051000-131051022 CTCCCGGGGCTCCCCGCTTCAGG + Intronic
1061517065 9:131096317-131096339 CCGCCGGCCGACCCCTCTGCTGG - Intergenic
1062305921 9:135907205-135907227 CCGCCGCCCCTCGCCGCGCCGGG + Exonic
1062540916 9:137041241-137041263 AGGCCCGGCCTCCCCGCTTCTGG + Intronic
1188026247 X:25212747-25212769 CCGCCTACCCACCCCGCTTTTGG + Intergenic
1190318036 X:49163784-49163806 CCGCGGCCCCTCCCCGCTCGCGG + Exonic
1190713903 X:53088287-53088309 ACAGCGGCCCTCCCCGCTTCGGG - Exonic
1197754430 X:129984095-129984117 CCGCCCGCCCGCCCCGCCGCCGG - Intronic
1198205385 X:134460353-134460375 CTGCCGGCCCTGGCCGGTTCAGG + Intronic
1198694430 X:139320901-139320923 CCGCCGGCCCTGCCAGCCCCGGG + Intergenic
1199744291 X:150762014-150762036 CTGCCGGCACTGCCCGCTCCGGG + Intronic
1200071954 X:153533650-153533672 CTGCTGGCCCTCCCCACTGCAGG - Intronic
1200151174 X:153952202-153952224 CCGCCCGGGCTGCCCGCTTCTGG - Intronic
1200470924 Y:3584359-3584381 CGGCCGGCCCTGCCCGCCCCAGG - Intergenic