ID: 984978867

View in Genome Browser
Species Human (GRCh38)
Location 4:185258082-185258104
Sequence ACCTTAGGACAGAAAAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984978862_984978867 4 Left 984978862 4:185258055-185258077 CCATTCCCACTAGGACTGAGGCA 0: 1
1: 0
2: 1
3: 19
4: 171
Right 984978867 4:185258082-185258104 ACCTTAGGACAGAAAAAATTTGG 0: 1
1: 0
2: 0
3: 22
4: 243
984978864_984978867 -1 Left 984978864 4:185258060-185258082 CCCACTAGGACTGAGGCAGAGGA 0: 1
1: 0
2: 1
3: 9
4: 192
Right 984978867 4:185258082-185258104 ACCTTAGGACAGAAAAAATTTGG 0: 1
1: 0
2: 0
3: 22
4: 243
984978865_984978867 -2 Left 984978865 4:185258061-185258083 CCACTAGGACTGAGGCAGAGGAC 0: 1
1: 0
2: 7
3: 32
4: 182
Right 984978867 4:185258082-185258104 ACCTTAGGACAGAAAAAATTTGG 0: 1
1: 0
2: 0
3: 22
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984978867 Original CRISPR ACCTTAGGACAGAAAAAATT TGG Intronic
902773583 1:18660375-18660397 TCCTTAAGCCAGAAAAAATAAGG - Intronic
904444755 1:30560910-30560932 TTCTTAGGAAAGAAAAACTTAGG - Intergenic
905924399 1:41739550-41739572 AGCTCAGCAGAGAAAAAATTGGG + Intronic
908053817 1:60261139-60261161 ATGTTAAGACAGAAAACATTTGG - Intergenic
908102109 1:60801945-60801967 ACATCATGACAGAAAAAAGTGGG + Intergenic
908314816 1:62922360-62922382 AGCTTAAGAGGGAAAAAATTGGG - Intergenic
908594594 1:65673480-65673502 ACCTAAAGCCAGAAAAAAATAGG + Intergenic
909004641 1:70260861-70260883 ACCTTAGGGAAGAAAAAAAGTGG - Exonic
909298483 1:73981951-73981973 ACCTGAAGACATAAAAATTTTGG - Intergenic
911026234 1:93437849-93437871 CACTTAGTACAGAAAATATTAGG - Intergenic
911153508 1:94618036-94618058 ACCTTGGGCAAGAAAGAATTCGG - Intergenic
911420311 1:97632993-97633015 ATCTTAGCACAAAAAAAATGGGG + Intronic
911843416 1:102715525-102715547 ACCCTAGGCTAGAAACAATTTGG + Intergenic
913185838 1:116370206-116370228 TCCATAGGACACAAAAATTTTGG - Intergenic
913589927 1:120314034-120314056 ACCTAAAGCCAGAAAGAATTAGG - Intergenic
913618258 1:120584332-120584354 ACCTAAAGCCAGAAAGAATTAGG + Intergenic
914571958 1:148925891-148925913 ACCTAAAGCCAGAAAGAATTAGG - Intronic
916699614 1:167277845-167277867 GCCTTAGTACAGTAAGAATTTGG - Intronic
917261690 1:173176372-173176394 ACTTTGGGAAAGAAAAAATATGG + Intergenic
917354357 1:174110413-174110435 ACCCTGGGACAGAAATATTTAGG + Intergenic
920957682 1:210634013-210634035 ACCTTGGGAAACAAAAAATTGGG + Intronic
921239098 1:213158735-213158757 ATTTTAGCACAGAAAAAACTTGG - Intronic
923256513 1:232226042-232226064 AACTGAGGACAGTAGAAATTTGG - Intergenic
1064216627 10:13405949-13405971 ACATGTGGACAGAAATAATTGGG - Intergenic
1064473742 10:15664146-15664168 ATTTTAGGAATGAAAAAATTTGG + Intronic
1064709142 10:18105477-18105499 ATCATAGAACAGGAAAAATTGGG - Intergenic
1064850808 10:19706837-19706859 ACCTTGAGACAGGAAAAATAGGG + Intronic
1067956742 10:50799374-50799396 TTTTTAGGAAAGAAAAAATTAGG + Intronic
1072600529 10:96923319-96923341 ACTATAGGATAGAGAAAATTTGG - Intronic
1072701924 10:97648506-97648528 ACTTAAAGACAGAAAAAGTTGGG - Intronic
1073437627 10:103529914-103529936 ATCTTATGCAAGAAAAAATTTGG + Intronic
1073654972 10:105404617-105404639 ACTTTAGAACACAAAGAATTTGG - Intergenic
1073770878 10:106734422-106734444 ACTTTTGCACAGAAAAAATTAGG + Intronic
1075312913 10:121429825-121429847 AGCTTGGGACAGAAAAAGGTGGG - Intergenic
1075582369 10:123631587-123631609 ACTTTAAGACAAAAAAAATAGGG + Intergenic
1078065592 11:8077175-8077197 ACCTTTAGAAAGAAATAATTGGG - Intronic
1081897737 11:46601318-46601340 AGCTGATGACAGAAGAAATTTGG - Intergenic
1090278081 11:125433449-125433471 ACCAGAGGCCAGACAAAATTTGG + Intergenic
1091255260 11:134178618-134178640 ACCTTAGGTAAGAAAAACATGGG - Exonic
1093154995 12:15672861-15672883 ACCTTAGGACAGAAAAGAAATGG + Intronic
1093826930 12:23703634-23703656 ATATTTGGACAGAATAAATTAGG + Intronic
1094568521 12:31621694-31621716 ACTTTAGTAGGGAAAAAATTTGG - Intergenic
1094829193 12:34292159-34292181 ACCTTTGGAAGGAAAAAAATTGG - Intergenic
1095366853 12:41417307-41417329 ATCTTTGGCCAGAGAAAATTTGG + Intronic
1097454650 12:59782784-59782806 ACCTTAAGAGACAAAAAATCAGG + Exonic
1097669494 12:62518871-62518893 ATCTTAGCTTAGAAAAAATTAGG + Intronic
1098143364 12:67473304-67473326 ACTTTAGGAAAGATAAAAATAGG - Intergenic
1098614975 12:72510778-72510800 AGCTTGGGACTGAAAAAATTAGG + Intronic
1107445362 13:40465744-40465766 TCCTGGGGACAGAAACAATTTGG - Intergenic
1108435958 13:50401782-50401804 ACTTGAGGGCAGAACAAATTTGG + Intronic
1108632191 13:52295804-52295826 ACCTTTGGCCAGTTAAAATTGGG - Intergenic
1108654510 13:52516790-52516812 ACCTTTGGCCAGTTAAAATTGGG + Intergenic
1109135434 13:58643636-58643658 AACTTATAACAGAAAAAAGTAGG + Intergenic
1110537984 13:76674266-76674288 ACCTTTAGACAGACAAAAATAGG + Intergenic
1111452234 13:88434499-88434521 ACCTGAAGACACAAATAATTGGG - Intergenic
1112934572 13:104781821-104781843 ACCTCATGCAAGAAAAAATTCGG + Intergenic
1113084756 13:106556778-106556800 AGGTTAGGAAAGAAAAAACTGGG + Intronic
1113236149 13:108277535-108277557 ATCTGACGCCAGAAAAAATTCGG + Intronic
1113649529 13:112026227-112026249 AGCTGAGGACAGAAGAAATAGGG - Intergenic
1113787184 13:113008507-113008529 TCTTTAAGACAGAAAAAGTTGGG + Intronic
1114379178 14:22182909-22182931 AACCAAGGAGAGAAAAAATTGGG - Intergenic
1114915785 14:27263530-27263552 ATTTTAGGACAAAAACAATTTGG - Intergenic
1115748398 14:36461938-36461960 TCCTTGGGACAGAAAAAGTAAGG + Intergenic
1117613496 14:57508276-57508298 ACATTAGCACAGAGAAAATCAGG - Intergenic
1119356056 14:74007517-74007539 ACCTTGGAAAAAAAAAAATTAGG + Intronic
1120075207 14:80148680-80148702 ACCTTAGTGCAGGAAAATTTGGG - Intergenic
1121081806 14:91114507-91114529 ACCTGAGGACAGAACATATCAGG + Exonic
1121850101 14:97213773-97213795 ACCATGGGACAGAAAGAACTGGG + Intergenic
1124841488 15:33245930-33245952 ACCTCAGGACAGGAAAACATAGG + Intergenic
1125632802 15:41161615-41161637 CCCTTCGGTTAGAAAAAATTAGG - Intergenic
1128645270 15:69374271-69374293 CCCATAGGACAGAAATACTTAGG - Intronic
1129357706 15:75002828-75002850 ATCTTAGAACTGACAAAATTTGG - Intronic
1129758873 15:78115980-78116002 AACTGAAGACAGAAAATATTTGG + Intronic
1130554124 15:84910906-84910928 AGTTTAGGACAGAAGAGATTTGG + Intronic
1131106753 15:89740085-89740107 ACCTTAAGCCAAAAAAAATCAGG - Intronic
1132640246 16:974887-974909 ACTTCAGGACATGAAAAATTGGG - Intronic
1134921216 16:18118388-18118410 TCCTTAGGAGAAAAAAAAATGGG + Intergenic
1135354796 16:21760115-21760137 ACTTTAGGAAAGAAAAGATTAGG - Intronic
1135453281 16:22576254-22576276 ACTTTAGGAAAGAAAAGATTAGG - Intergenic
1136998223 16:35206391-35206413 ACCTTTGGATATAAAAATTTGGG - Intergenic
1137953015 16:52801551-52801573 TCTTTAGGTCAGAATAAATTAGG + Intergenic
1139535610 16:67571046-67571068 AACTGAAGACAGAAAAAATTGGG - Intronic
1140027213 16:71301631-71301653 ACCTTAAGACAGGAAAAGTAGGG + Intergenic
1140935088 16:79662893-79662915 ACCTTAGGACAGAATGACCTTGG - Intergenic
1144121006 17:12152276-12152298 ACCCTAAGCCAGAAGAAATTGGG + Intergenic
1144229257 17:13183229-13183251 ACCTTTCGACCGAAAAAACTGGG - Intergenic
1144527859 17:16005941-16005963 AACTTAGGACACAAAAAGCTAGG - Intronic
1146544764 17:33728545-33728567 ACCTTATCACAGAAAGAAATTGG + Intronic
1146950699 17:36903607-36903629 GCTTTTGGACAGAACAAATTGGG - Intergenic
1147815603 17:43207786-43207808 ACCAAAGGACTGAAAATATTTGG - Intronic
1151507155 17:74536877-74536899 ACTTTTGGACAGACAAAATTAGG + Intergenic
1152185570 17:78854686-78854708 TCCTGAGGACAGAAAAAGCTGGG - Exonic
1152747217 17:82046650-82046672 AACTTAGGCCAAAAAAAATGGGG + Intergenic
1153433610 18:5045470-5045492 TCCTCAGGTCAGAAAAAAATGGG - Intergenic
1155042975 18:22080649-22080671 TCCTTAGGAAAGAAAAAGTAAGG - Intergenic
1155445725 18:25911350-25911372 ACCACAGAACAGAAAGAATTAGG - Intergenic
1157498779 18:48175189-48175211 ACTGAAGGACAGAAAAAATCAGG + Intronic
1157940925 18:51928540-51928562 ACCTTGAGAGAGAAAAAATCAGG + Intergenic
1158805676 18:60969110-60969132 TACTTAGGAGAGAAAAAAGTAGG - Intergenic
1158829253 18:61259926-61259948 ACTTTAGAAAAGAAAAAATAAGG - Intergenic
1159455413 18:68655015-68655037 ACCATAGGACAGCATACATTTGG - Intergenic
1159694784 18:71542230-71542252 ACCTTCGTTCAGAAAAATTTAGG - Intergenic
1163079681 19:14928607-14928629 ACCTTGGGTCAGAAACAATTTGG + Intergenic
1163188001 19:15653132-15653154 CCCTTAGGACAGAAAGACCTGGG + Intronic
1163192793 19:15690930-15690952 ACCATAGGACAAAAAATATAAGG - Intronic
1163216890 19:15885722-15885744 CCCTTAGGACAGAAAGACCTGGG - Intronic
1164319069 19:24122524-24122546 GCCATAAAACAGAAAAAATTGGG - Intronic
1164745064 19:30605918-30605940 TACTTAGGACAGAAAGACTTTGG + Intronic
1166295761 19:41888511-41888533 AAATTAGGAGAGAAGAAATTGGG - Intronic
1167549314 19:50148545-50148567 TCTTCAGGACAGATAAAATTTGG + Intergenic
925858657 2:8154116-8154138 ACCTTACAAAAGAAATAATTGGG - Intergenic
926791033 2:16572035-16572057 ACATTAGGACTGAAAAGAGTAGG + Intronic
927259222 2:21070043-21070065 ACCTTAGGACAGATGTATTTTGG - Intergenic
928348671 2:30525009-30525031 ACCTTAGAAAAGAAAATATATGG + Intronic
929040271 2:37737886-37737908 TCCATAGGAAAGAAATAATTGGG - Intronic
930716617 2:54599475-54599497 ACCTTTGGTCAGAAAGAACTTGG + Intronic
931359959 2:61569893-61569915 ACATTAAAAAAGAAAAAATTGGG - Intergenic
932487354 2:72092268-72092290 ACCTAAGGGAAGAGAAAATTTGG + Intergenic
933825944 2:86161135-86161157 AAATTAGGCCAGAATAAATTTGG - Intronic
934913546 2:98279789-98279811 GCCTCAAGACAGCAAAAATTAGG + Intronic
935879070 2:107542962-107542984 ACCTTGGGCCAGAGAAAAATGGG + Intergenic
936892880 2:117392775-117392797 ACCTTAATACAGAACAAAATAGG - Intergenic
936983878 2:118289870-118289892 ACCTTAAGTCAAAAACAATTAGG - Intergenic
937358040 2:121210800-121210822 ACCTTAGCACAGAGAGAATGGGG - Intergenic
939577437 2:143913065-143913087 ACCAGAAGACAGAAAACATTGGG + Intergenic
940480394 2:154222163-154222185 TCCTTAGGAAAGAAAGCATTGGG + Intronic
940940286 2:159551937-159551959 ACTCTAGAAAAGAAAAAATTGGG + Intronic
941017250 2:160371476-160371498 ACCTGATAACAGGAAAAATTAGG - Intronic
941245669 2:163092980-163093002 CCCTTAGGTCATAAAAGATTTGG - Intergenic
942179680 2:173368267-173368289 CCCTTCGGGCAGAAGAAATTAGG - Exonic
942193761 2:173497018-173497040 AACTTAGGACAGAAGGAATCTGG - Intergenic
942387389 2:175456736-175456758 AAATTTGGACATAAAAAATTTGG - Intergenic
942631301 2:177952456-177952478 ACACAAGGACAGAAAACATTTGG + Intronic
943453186 2:188071811-188071833 ACCTTAGGACAGAGACTATGGGG + Intergenic
943829377 2:192439770-192439792 AGCTTAGGTCAGAAAAACTTTGG - Intergenic
945852794 2:215029874-215029896 ACTTTAGAACAAAAATAATTAGG + Intronic
945908015 2:215615766-215615788 GATTTAGGACAGAAGAAATTGGG + Intergenic
946699376 2:222396329-222396351 ATATTAGAACAGAAAATATTTGG + Intergenic
1168949398 20:1786335-1786357 ACCTCAGGAAAGAAGAGATTGGG + Intergenic
1169740104 20:8883177-8883199 AAATTAGGACAGAAATAATATGG + Exonic
1177725488 21:24961507-24961529 TCCTTAGTACAGAGAAACTTTGG + Intergenic
1178153370 21:29822283-29822305 AACTGGGGACAGAACAAATTTGG + Intronic
1179201664 21:39229020-39229042 AACAAAGGGCAGAAAAAATTTGG + Intronic
1181384607 22:22534893-22534915 ACTTTAGGAAAGCCAAAATTGGG + Intergenic
1183046228 22:35222633-35222655 ACCTTAGGATCTATAAAATTAGG - Intergenic
1203292544 22_KI270736v1_random:9428-9450 TCCATAGGAAAGAAATAATTGGG - Intergenic
949164648 3:924160-924182 ACAGTAGGACAGAAATATTTAGG - Intergenic
949164699 3:925013-925035 ACAGTAGGACAGAAATATTTAGG - Intergenic
957337306 3:78848000-78848022 ACCTTTTGACAGGAAAAAATGGG - Intronic
957487273 3:80878643-80878665 ACTTTAAGACAGAACAAAGTTGG - Intergenic
958010092 3:87866040-87866062 AGGCTAGGACAGAAAAACTTAGG - Intergenic
958797724 3:98723906-98723928 ACCTAAGGAGAGAAAGAGTTTGG + Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960454238 3:117850882-117850904 AACTTAGAAAAGTAAAAATTTGG + Intergenic
960635974 3:119785347-119785369 ACCTGAGGACAGAACTAACTGGG + Intronic
963361311 3:144275382-144275404 TTCTTATGACAGAAAAAATTAGG - Intergenic
964528126 3:157637279-157637301 ACCTTAGGAGAGAAGAATTCAGG + Intronic
964911102 3:161781330-161781352 ACCTTTGGAAAGAAGAAAGTGGG - Intergenic
965120425 3:164547642-164547664 ACCTGAGGATAGAAAAAAAGAGG + Intergenic
965210860 3:165786407-165786429 AATTTAAGACAGAAAAAATGTGG + Intronic
965466270 3:169034451-169034473 ACCTTAATACAGAAAATATGGGG + Intergenic
965471166 3:169094249-169094271 ATTTAAGAACAGAAAAAATTTGG - Intronic
966171439 3:177085603-177085625 ACTTTATGACTGAAAAAATATGG + Intronic
969888982 4:10242284-10242306 ACATTAGGACAGATATATTTTGG + Intergenic
970307708 4:14750464-14750486 ACCTTAAAACACAAAAAAATGGG + Intergenic
972010862 4:34179851-34179873 AACTGAAGACATAAAAAATTTGG - Intergenic
974788664 4:66656596-66656618 ACCTTAATAAAAAAAAAATTAGG + Intergenic
975660606 4:76685104-76685126 TGCTTAGGAGAGAAAATATTAGG - Intronic
975913171 4:79293193-79293215 ACCACAGGAAAGAAAAACTTTGG + Intronic
976841261 4:89434695-89434717 AACTGAGCACAGCAAAAATTAGG - Intergenic
976856187 4:89608134-89608156 AGATTAGGGTAGAAAAAATTGGG + Intergenic
977064664 4:92299476-92299498 ACATTTGGACAGAAAAGATAAGG + Intronic
978553916 4:109958288-109958310 AACTTAGGACTGAAAATATTTGG - Intronic
978926981 4:114258494-114258516 ATTTTAGGACAGAAAACATGTGG + Intergenic
980955494 4:139424498-139424520 TCCTTAGGACAAGAAAATTTTGG + Intergenic
982773482 4:159419565-159419587 ACTTAAGGACAGAAAAAAGAAGG - Intergenic
982885645 4:160777395-160777417 ACCTTTGGACAGTTAACATTTGG + Intergenic
983290395 4:165796606-165796628 ATCTTAGGGCAAAAAAACTTTGG - Intergenic
983305419 4:165978753-165978775 ACCTGAGAACAGCTAAAATTGGG - Intronic
983305700 4:165983069-165983091 AGCTCAGGAGAGAAAATATTAGG + Intronic
983949784 4:173626794-173626816 ACATAAGGACACAAAAAATATGG - Intergenic
984043379 4:174766418-174766440 AATTTAAGACAGAAGAAATTTGG + Intronic
984978867 4:185258082-185258104 ACCTTAGGACAGAAAAAATTTGG + Intronic
986474875 5:8118954-8118976 ACCTTAAGAAAAAACAAATTTGG + Intergenic
987150845 5:15038124-15038146 ACCTGAGGGCAGAATAAACTGGG - Intergenic
989321694 5:40142387-40142409 ATCTTAGGACATAAAGAACTAGG - Intergenic
992764321 5:79982295-79982317 ACCTAAATACAGAACAAATTGGG + Exonic
994557067 5:101318019-101318041 ATTTTAGGACAGATAAAATGGGG - Intergenic
994998760 5:107100583-107100605 CCTTTAGAACAGAAGAAATTGGG - Intergenic
995608922 5:113888892-113888914 GCCTTAGGACAGAGAAAATATGG - Intergenic
995958375 5:117808605-117808627 ACCTTAGTAGAAAAAAAATAAGG - Intergenic
996328617 5:122305603-122305625 CACTTAAGACTGAAAAAATTGGG - Intergenic
996477657 5:123939103-123939125 ATCTGAGGAGAGAAAAACTTTGG - Intergenic
997705632 5:135949562-135949584 ACATTAGGGAAGAAATAATTAGG - Intronic
998003699 5:138643465-138643487 TCCTTTGGACAGAGAGAATTTGG - Intronic
998544290 5:143012952-143012974 ACTTTAGAAAAGAAAAAAATCGG - Intronic
998663412 5:144266871-144266893 ATCATAGGACAGAAAAAAATAGG - Intronic
998984083 5:147736004-147736026 ACCTCAGGACAGATTAAATAAGG + Intronic
999600424 5:153256838-153256860 ACCTGAGAGCAGACAAAATTAGG - Intergenic
1000551439 5:162670380-162670402 ACCTTAGCACAGCAAATTTTAGG + Intergenic
1003716234 6:8649436-8649458 ACCTTAGGAGAAGAAGAATTGGG - Intergenic
1004900817 6:20192296-20192318 ACTTTAGGGCAGAAAAGATGAGG - Intronic
1005740281 6:28784728-28784750 ACATTAGAAAAGAAAAAAGTCGG + Intergenic
1007441406 6:41864260-41864282 TCATAAGGACAGAAAAAATAGGG + Intronic
1009755368 6:67932537-67932559 ACCTTAGAACAGCAAAGATTTGG - Intergenic
1009891947 6:69695677-69695699 ACTTTGGGTCAGAAATAATTTGG - Intronic
1010383096 6:75246737-75246759 ACCCTGGGACTGAAAACATTTGG - Intronic
1010978872 6:82347759-82347781 TCCTTAGCTCAGAAAAAATCTGG - Intergenic
1011020878 6:82810515-82810537 ACCATAGGACAAAAAAATATGGG - Intergenic
1011198299 6:84805337-84805359 ACTTTAGGAAAGAAAACATTAGG - Intergenic
1011692206 6:89880555-89880577 ACATTAAGAAAGAAAAAAATGGG - Intergenic
1011861769 6:91766705-91766727 ACCAAAGCACAAAAAAAATTTGG - Intergenic
1011928138 6:92673586-92673608 ACCCTAAGACAGAAGAGATTGGG + Intergenic
1011987129 6:93462360-93462382 AACTGAGGATAGAAAATATTTGG + Intergenic
1012716917 6:102686134-102686156 ACCTTATGACAGGGAGAATTAGG + Intergenic
1014806457 6:125835377-125835399 ACCTTAGGAGAAAAAAAAAAAGG + Intronic
1014846282 6:126281478-126281500 ACCTGAGGAAAGGAAAAATGAGG + Intergenic
1016100982 6:140099917-140099939 ACATTAGCAAAGAAGAAATTTGG - Intergenic
1021568086 7:22034301-22034323 ACCTTAGGACAAACAAGTTTGGG - Intergenic
1021731396 7:23598438-23598460 ATCTTAAAACAGCAAAAATTAGG - Intronic
1023032161 7:36099229-36099251 ACCAGAGGACAAAAAAAATGGGG + Intergenic
1023287831 7:38637403-38637425 TCCTTAGGAGAGAAGAAATATGG + Intergenic
1024305974 7:47929797-47929819 ATCTGAGGTCAGCAAAAATTTGG + Intronic
1024889765 7:54186456-54186478 AACTTAGAACAGAAAAACTTGGG + Intergenic
1025153679 7:56584179-56584201 ACGTTAGAAAAGAAATAATTTGG - Intergenic
1026041941 7:66875391-66875413 TCCTTAGAACAGGAAAAACTGGG - Intergenic
1028056505 7:86252089-86252111 ATTTTAGGACAGAAAATATCAGG + Intergenic
1029586759 7:101477655-101477677 TTCTTAGGAGAGAAAAAATGGGG - Intronic
1031131941 7:117843021-117843043 AACTGAGGATAGAAAATATTTGG + Intronic
1031324959 7:120384215-120384237 AACTATGGACAGAAAATATTTGG - Intronic
1033389257 7:140910646-140910668 CCTTTAGGACTGAAAAAATTGGG - Intronic
1037293484 8:17375748-17375770 ACATTATTACAGAAAATATTTGG - Intronic
1037891885 8:22627993-22628015 GCCTTAGGACAGACAAGAATTGG - Intronic
1038857787 8:31351885-31351907 ACCTCAGGAAAGAGAGAATTTGG - Intergenic
1039088460 8:33802901-33802923 TCCCTAGGAAAGAAAAAATAGGG - Intergenic
1040035081 8:42862207-42862229 ACTTTAAGACAGAAAAATTATGG + Intronic
1041236136 8:55804498-55804520 ACCTTAGGAGTGAAATAATTGGG + Intronic
1044050038 8:87489900-87489922 AACTAAGGAAAGAAAATATTTGG - Intronic
1045087517 8:98702543-98702565 TGCTTAGGCCAGCAAAAATTAGG - Intronic
1045344641 8:101283090-101283112 AACTCAGGCCAGAAAAAATGAGG - Intergenic
1045856712 8:106772517-106772539 CTCTTAGGATAAAAAAAATTGGG + Intergenic
1047736138 8:127766988-127767010 AACTTAGGTCAGAAAAAAGATGG + Intergenic
1050435443 9:5605170-5605192 ACATTAGGAAATAAAAAATATGG + Intergenic
1050782875 9:9361017-9361039 ACCTCAGGACTGAAAATATTTGG - Intronic
1051156781 9:14156785-14156807 ACCCTAGGACAGAAGCAAGTAGG - Intronic
1051351188 9:16199338-16199360 ACATTAGGAAAAAAAAAAATTGG - Intergenic
1052074617 9:24125517-24125539 AACTAAGGATAGAGAAAATTTGG + Intergenic
1052407520 9:28081080-28081102 ACCTTAGGACTGGAGACATTTGG + Intronic
1052899373 9:33778108-33778130 ACCTACAGATAGAAAAAATTTGG + Intronic
1055844799 9:80548673-80548695 ACCTTAGGAATGAAGTAATTAGG + Intergenic
1056405732 9:86272924-86272946 ACCATAGGTCAGAAATATTTGGG - Intronic
1059945661 9:119405951-119405973 CCCGAAGGACAGAAAGAATTTGG - Intergenic
1060055806 9:120412021-120412043 ACTTTAGGACGGAAAAGAGTAGG - Intronic
1062222086 9:135422040-135422062 ACCTCATGAAAGAAAGAATTTGG - Intergenic
1185663117 X:1742740-1742762 ACCTCAGGCAAGAAAGAATTTGG + Intergenic
1186476554 X:9862305-9862327 ACCTGAGGAAGGAATAAATTTGG + Intronic
1188307402 X:28574854-28574876 ACTTTAAGACAAAAAATATTTGG + Intergenic
1190958586 X:55221952-55221974 ACAGGAGGACAGAAAACATTAGG + Intronic
1190964194 X:55282048-55282070 ACAGGAGGACAGAAAACATTAGG + Intronic
1193449864 X:81652501-81652523 TCCTGAAGACAGAAAAAATTGGG - Intergenic
1193502198 X:82292379-82292401 AAATTAGGAAAGATAAAATTAGG + Intergenic
1193551680 X:82900868-82900890 ACTTTAAGCCAGAAGAAATTGGG + Intergenic
1195724307 X:107898491-107898513 ATCATAGGAAAGAGAAAATTTGG - Intronic
1196309059 X:114139824-114139846 ACCCTACCACAGGAAAAATTTGG - Intergenic
1197710053 X:129659551-129659573 ACCTTAGCACTTAAAAAATTAGG - Intergenic
1197887598 X:131234745-131234767 ACCTTAGGAAAGAAAAGGTCAGG - Intergenic