ID: 984988354

View in Genome Browser
Species Human (GRCh38)
Location 4:185352909-185352931
Sequence CAGTCTCCCCAGAAGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984988350_984988354 -6 Left 984988350 4:185352892-185352914 CCTGCCTGTGTGTCTGTCAGTCT 0: 1
1: 1
2: 28
3: 161
4: 804
Right 984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG 0: 1
1: 0
2: 3
3: 38
4: 239
984988349_984988354 6 Left 984988349 4:185352880-185352902 CCTATCATAACACCTGCCTGTGT 0: 1
1: 0
2: 2
3: 6
4: 143
Right 984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG 0: 1
1: 0
2: 3
3: 38
4: 239
984988347_984988354 11 Left 984988347 4:185352875-185352897 CCTGCCCTATCATAACACCTGCC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG 0: 1
1: 0
2: 3
3: 38
4: 239
984988348_984988354 7 Left 984988348 4:185352879-185352901 CCCTATCATAACACCTGCCTGTG 0: 1
1: 0
2: 2
3: 6
4: 124
Right 984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG 0: 1
1: 0
2: 3
3: 38
4: 239
984988351_984988354 -10 Left 984988351 4:185352896-185352918 CCTGTGTGTCTGTCAGTCTCCCC 0: 1
1: 0
2: 3
3: 39
4: 422
Right 984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG 0: 1
1: 0
2: 3
3: 38
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984988354 Original CRISPR CAGTCTCCCCAGAAGGCAGT GGG Intronic
900659333 1:3774887-3774909 CAGCCTCCCCAGAGGCCAGAAGG + Intronic
901025305 1:6275982-6276004 CAGTGTGCCCAGGAAGCAGTGGG + Intronic
904643183 1:31945734-31945756 CAGTTTCCCCATTTGGCAGTTGG + Intergenic
904672020 1:32173092-32173114 CAATCTCCCAGGAAGGCAGGGGG + Exonic
905037273 1:34926396-34926418 CAGACTCCCCAGACGGCAGGAGG + Intronic
905507996 1:38495345-38495367 CATTCTCCCCAGCTGACAGTCGG + Intergenic
906156956 1:43619525-43619547 CACTCTCCCCTGGAGGCACTTGG - Exonic
906643345 1:47455138-47455160 CAGCCTTCCCAGCAGGCTGTGGG + Intergenic
906802574 1:48750561-48750583 CAGTCTCAACAGCAGACAGTTGG - Intronic
911902824 1:103526282-103526304 GAGTCTCCCGGGAAGGCATTTGG + Intronic
915030682 1:152878199-152878221 CAGACTCTCCAGCAGGCAGGGGG + Intergenic
915563488 1:156701107-156701129 CACCCTCCCCATAAGACAGTTGG + Intronic
920266700 1:204729480-204729502 CAGTCTTCCCTGAATGGAGTTGG - Intergenic
923215611 1:231845516-231845538 CACTGTCCCCAGAAGTCACTGGG - Intronic
923402545 1:233629140-233629162 GAGTCTCCCCAGCTGGCTGTGGG - Intronic
1064576357 10:16749817-16749839 CACTCTCCCGAAAAGGCAGGCGG - Intronic
1065404754 10:25351338-25351360 CAGCTTCAGCAGAAGGCAGTGGG + Intronic
1067090652 10:43264497-43264519 CATCCTCCCCAGCAGGGAGTGGG + Intronic
1067381628 10:45779109-45779131 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1067448385 10:46366895-46366917 CCTTCTCCCCAGCAGGCATTTGG + Intergenic
1067556382 10:47276235-47276257 CAGTCTCCCCAGGGAGCAGGAGG + Intergenic
1067588990 10:47493871-47493893 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1067636115 10:48001962-48001984 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1067889327 10:50119743-50119765 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1069329635 10:67277245-67277267 CAGTTGCATCAGAAGGCAGTGGG - Intronic
1070132675 10:73665967-73665989 CCTTCTCCCCAGCAGGCATTTGG - Intergenic
1070167434 10:73909479-73909501 AAGTCTCTCCAGAAGACAGTGGG + Intronic
1070289217 10:75103883-75103905 CAGTCTCCACAGGTGGGAGTGGG - Intronic
1070728198 10:78806905-78806927 CAATCTCCAGAGAAGGCAGGAGG + Intergenic
1070757352 10:79001641-79001663 CAGTGTCCCCAGCAGGCAGGAGG + Intergenic
1071609009 10:87018107-87018129 CCTTCTCCCCAGCAGGCATTTGG + Intergenic
1073948791 10:108783683-108783705 CTGACACCCCATAAGGCAGTTGG - Intergenic
1075580289 10:123612322-123612344 AATACTCCCCAGAAGGCAGGGGG + Intergenic
1075581459 10:123621743-123621765 CAGCCTCCTGAGAAGGCAGTGGG + Intergenic
1077019269 11:410325-410347 CTGTCTCCCGACATGGCAGTTGG + Intronic
1077034555 11:488402-488424 CATTCTCCCCGGGGGGCAGTGGG + Intronic
1079359738 11:19760423-19760445 CATTCTCCCCTGAAGCCAGGAGG - Intronic
1081702940 11:45163408-45163430 AGGGCTCCTCAGAAGGCAGTAGG - Intronic
1081773326 11:45662911-45662933 CAGTCCCCACCGAAGGGAGTTGG + Intronic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083366175 11:62142682-62142704 CAGAGTCCACAGAAGGCAGATGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084568186 11:69943527-69943549 CAGCTTCCCCAGGAGGCAGGAGG - Intergenic
1084607563 11:70181311-70181333 CAGTCCCCACAGAGGGCAGGGGG + Intronic
1084940362 11:72609370-72609392 CACTTTCCCCAGAAGGAAGGTGG + Intronic
1085299427 11:75449713-75449735 CAGTGTCCCCAGTTGGCAGATGG - Intronic
1086900683 11:92364380-92364402 GTGACTCTCCAGAAGGCAGTGGG + Intronic
1088961579 11:114671605-114671627 CAGTGGCACCAGAAGGCAGTAGG + Intergenic
1089625782 11:119750001-119750023 CAGTCTCTACGGAAGGTAGTAGG + Intergenic
1090283384 11:125477781-125477803 CAGTGTCCCCTGGAGGCAGAAGG - Intronic
1090354020 11:126127383-126127405 CAGTCTCTCCACAAAGCACTGGG - Intergenic
1092079614 12:5704607-5704629 CTGTCTTCCCTGAAGGCATTTGG + Intronic
1092083228 12:5735309-5735331 CAGTCTCCCCAGGAGCCAGCTGG + Intronic
1092769690 12:11885292-11885314 CAGCCTTCTAAGAAGGCAGTGGG + Intronic
1093955042 12:25207190-25207212 CAGTCACCACACAAGGCACTGGG - Intronic
1096230255 12:49892796-49892818 ATGTCTGCCCAGTAGGCAGTTGG - Intronic
1096431061 12:51543356-51543378 GAGTCACCCCAGAAGGCGCTTGG - Intergenic
1099556688 12:84117612-84117634 CAGGCTCCCCAAAAGTCAGATGG - Intergenic
1101304243 12:103511983-103512005 CACTCTCCCTAGAAGGCAGTTGG + Intergenic
1106080400 13:26495897-26495919 GAGCCTCCCCAGCAGGGAGTGGG + Intergenic
1106676270 13:31961833-31961855 CATCCTCTGCAGAAGGCAGTTGG + Intergenic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1113817063 13:113179745-113179767 CAGGGTCCCCAGGAGGCAGTGGG + Intronic
1114266969 14:21078361-21078383 CCCTATCCCCAGGAGGCAGTGGG + Exonic
1114835361 14:26197345-26197367 CACTCTCCCCAGAACGCAATGGG + Intergenic
1119147015 14:72326569-72326591 CAGTCACCGCAGAAGGCAAACGG - Intronic
1121565363 14:94905479-94905501 CAGTCTCCCCAGAACCCAGCTGG - Intergenic
1202904512 14_GL000194v1_random:60482-60504 CAGTTTCCCCAGATGGCATCAGG + Intergenic
1124022604 15:25938334-25938356 CTCTCACCCCAGAAGGCAGGAGG - Intergenic
1126197878 15:45952187-45952209 CACCTTCCCCAGAAAGCAGTTGG + Intergenic
1126858100 15:52858621-52858643 CAGTCTCCTCCGCAGGCAGAGGG + Intergenic
1127303430 15:57679826-57679848 GAGTGTGCCCAGAAGGCTGTGGG - Intronic
1128261138 15:66233839-66233861 CACTCTCCCCAGAAGACCTTTGG - Intronic
1128535778 15:68489142-68489164 CACTCTACCCACAAGGCAGGGGG + Intergenic
1128809134 15:70557305-70557327 CAGTCTCCTGAGAAGGGAGTTGG - Intergenic
1130538565 15:84804165-84804187 CTGCCTCCCCAGCTGGCAGTGGG + Exonic
1131065812 15:89434391-89434413 GAGTCTCCCCATCAGGAAGTGGG - Intergenic
1132334941 15:101042343-101042365 CTGTCTGCCCAGAAGACAATGGG - Intronic
1132638018 16:962897-962919 CAGCCTCCCTCCAAGGCAGTGGG + Intronic
1133977397 16:10609168-10609190 CAGTCTGGCCAGCAGGGAGTGGG + Intergenic
1134205801 16:12237137-12237159 CAGTCTCCAGAGTAGGCAGGTGG + Intronic
1134317452 16:13132251-13132273 TAGTATCCCCAGAAGACTGTCGG + Intronic
1136009841 16:27356411-27356433 CAGTCTCCCCAGTAGGATGCCGG - Intronic
1136414068 16:30092836-30092858 CAGTCTCACCACAAGGCACTGGG + Intronic
1137251404 16:46743522-46743544 CAGGCTCCCCATCAGGCTGTCGG - Intronic
1137541450 16:49364968-49364990 CTGTCTCCACAGAAGGCAGCTGG - Intergenic
1137596512 16:49727594-49727616 CACTCTCCCCAGAAGGCCAATGG + Intronic
1137707707 16:50547501-50547523 CAGTGTCCCCAGAAGGGGGCAGG + Intergenic
1138132096 16:54488998-54489020 CAGGAACCCCAGGAGGCAGTAGG - Intergenic
1138380885 16:56601549-56601571 CCTTCTCCCCAGGAGGCTGTGGG - Intergenic
1139400475 16:66677354-66677376 CAGATGCCCCAGAAGTCAGTGGG - Intronic
1139630541 16:68229570-68229592 CAGTATCACCAGAAGACATTAGG - Exonic
1140466840 16:75189593-75189615 GAGTCTCCCCTGAATGCAGCTGG + Intergenic
1141659854 16:85435944-85435966 TAGTCACCCCAGAAGGCAGGTGG + Intergenic
1141965132 16:87437011-87437033 TACGCTCCACAGAAGGCAGTGGG - Intronic
1142215882 16:88829603-88829625 CTGTGTCCCCAGCAGCCAGTGGG - Intronic
1142997346 17:3768774-3768796 CTGTCTCCCCACGAGACAGTAGG + Intronic
1143438751 17:6951489-6951511 CAATCTCTCCAGCAGGCAGTCGG - Intronic
1143669265 17:8385199-8385221 CATTCGCTCCACAAGGCAGTAGG + Intergenic
1148240543 17:45997029-45997051 TATTCTGCCCAGAAGGCAGGTGG - Intronic
1148550728 17:48549527-48549549 CCCTCTCCACAGAAAGCAGTTGG - Exonic
1148635275 17:49144348-49144370 AAGGCTCCCCAGAAGACAGATGG + Intronic
1148840764 17:50495401-50495423 CTGTGTCCCCCGAAGCCAGTTGG + Intergenic
1150125654 17:62632861-62632883 CAGCCTTCCCTGAAGGCAGCCGG + Intronic
1151551215 17:74823575-74823597 CAGTCTCCCCAGAACTTATTTGG - Intronic
1152248021 17:79196023-79196045 CAGCCTCCTCTGAAGGCAGAGGG + Intronic
1152785081 17:82243491-82243513 GAGTCCCACCAGAAGGCAGGTGG - Exonic
1152899234 17:82930489-82930511 GAGACACCTCAGAAGGCAGTGGG - Intronic
1153324066 18:3800086-3800108 CAGTCTTCCCAGCAGGGAATTGG + Intronic
1156941617 18:42774060-42774082 CAGTGTCACCAGGAGCCAGTAGG + Intronic
1157288562 18:46393932-46393954 CAGGATCCCCACCAGGCAGTGGG - Intronic
1157295504 18:46439207-46439229 CAGACTCCCCTGAAGGCTGATGG + Intronic
1157596376 18:48866466-48866488 CAGTCTTCCAAGGAAGCAGTTGG + Intergenic
1158023246 18:52868762-52868784 CAGTCTCCCTTGGAGGCAGGGGG - Intronic
1158023287 18:52868946-52868968 CAGTTTCCCCAGCTGGCACTGGG + Intronic
1159013374 18:63080829-63080851 CAGTCTCTCCAGAAATCACTGGG + Intergenic
1159697907 18:71583956-71583978 CATTTTCCCCAACAGGCAGTTGG - Intergenic
1160929700 19:1564619-1564641 CAGTCTGCCCAGAAAGCACTCGG + Intronic
1161039706 19:2103677-2103699 CACAGTCCCCAGAAGGCAGGGGG + Intronic
1162126130 19:8500340-8500362 CTGTCACCCCAGGAGGTAGTGGG + Intronic
1162142130 19:8591388-8591410 CAGGTTCCCCAGGAGGCAGCAGG + Intronic
1163785974 19:19275114-19275136 AGGGCTGCCCAGAAGGCAGTGGG - Intergenic
1165081202 19:33307315-33307337 CTGTCTCCCCAGGAGGCAGGTGG + Intergenic
1165145965 19:33730490-33730512 CAGACTCTCGAAAAGGCAGTGGG - Intronic
1167617202 19:50541868-50541890 CAGTCTCATCAGGAAGCAGTGGG + Intronic
925058844 2:875790-875812 CAGACTCCGCAGAAGCCAGAGGG - Intergenic
926098569 2:10098590-10098612 CAGGGTCCCCAGAAGGCCGTGGG - Intergenic
926624381 2:15078591-15078613 CCTTTTCCCCAGAAGACAGTGGG - Intergenic
928447535 2:31346770-31346792 CAGTCTTCCCAGGAGCCACTGGG + Exonic
929054145 2:37861775-37861797 CACTTGTCCCAGAAGGCAGTGGG - Intergenic
929243487 2:39676639-39676661 CAGGCTCCCCAGGAAGCACTTGG + Intronic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
932173401 2:69577774-69577796 CTGTCTCCACAGGAGGCAGGAGG + Intronic
933780185 2:85795789-85795811 CAGTCTCTCCAGATGGCTTTGGG - Intergenic
934502124 2:94869916-94869938 CAGTTTCCCCAGATGGCAGCAGG - Intergenic
937553058 2:123118790-123118812 TAGTCTCCCAAGATTGCAGTAGG - Intergenic
938702560 2:133892699-133892721 AAGTCTCAGCAGAAGGCAGGTGG + Intergenic
940672504 2:156687951-156687973 TAGTCTCCCCAGCAGTCAGCAGG - Intergenic
941125628 2:161580221-161580243 CAGTGTCCCCAGAAGCTGGTGGG - Intronic
941988281 2:171529589-171529611 CAGTCTACTCAGAAGGATGTAGG + Intronic
944289745 2:197991868-197991890 CAGGCCCCACAGAAGACAGTGGG - Intronic
944942452 2:204643341-204643363 CAGACTCCCTGGAAGGCAATGGG - Intronic
946606930 2:221415622-221415644 CAGTCTCCCTAGGAGGAAGGAGG - Intergenic
947593916 2:231399352-231399374 CAGTCTCCCCAGAGGCCGGGCGG + Exonic
948422635 2:237869932-237869954 CAGGCTCCCCAGCACGCAGTGGG + Intronic
948579477 2:238974636-238974658 CAGTAACCCCAGAAGTCAATGGG + Intergenic
948677810 2:239609363-239609385 GAGTCTCGCCAGAAGGCTGAGGG + Intergenic
1172884059 20:38219675-38219697 CAGCTTCCCCAGGAGGCTGTTGG + Exonic
1172901664 20:38339494-38339516 TAGTCTCCCCAGCAGCCAGAGGG - Intergenic
1175906594 20:62382900-62382922 CACTGTCCCCAGAAGCCACTAGG - Intergenic
1176623884 21:9075249-9075271 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1179048299 21:37866602-37866624 CATTCTCCCCAGTTGCCAGTAGG - Intronic
1179164540 21:38925283-38925305 GAGTGTCCTCAGAAGACAGTTGG - Intergenic
1181610115 22:24006469-24006491 GAGTCCCCCCAGAGGGCAGGTGG + Intergenic
1181842965 22:25680988-25681010 CCATCTCCCCAAAAGACAGTAGG + Intronic
1183075181 22:35422414-35422436 CAGTTTCCCCAGGAGGGAGCAGG + Intronic
1183422558 22:37720485-37720507 CAGTTTCCCCTGAAGGCTGGGGG + Intronic
1183928894 22:41224974-41224996 CAGTCTACACAGAAGGCGGTTGG + Exonic
949255303 3:2038137-2038159 CAGCCTCCCTTGAAGGTAGTTGG - Intergenic
949397351 3:3629153-3629175 CAGACTCCCCAGAGGACAGTTGG + Intergenic
950452312 3:13072327-13072349 CAGGCTTCCCAGGGGGCAGTGGG - Intronic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
954980425 3:54740706-54740728 CAGAAGTCCCAGAAGGCAGTAGG + Intronic
954983671 3:54769930-54769952 CAGTGTCCCCAGAAAACACTGGG + Intronic
955343458 3:58143480-58143502 CTGTCTTCCCAGAAGGCATGTGG - Exonic
955602153 3:60657203-60657225 CAGTATCCCTAGGAGGCACTAGG + Intronic
955844791 3:63151016-63151038 CCTACTCCCAAGAAGGCAGTTGG + Intergenic
959350473 3:105255904-105255926 CAGGCTCCCCAGGGGACAGTTGG - Intergenic
960284152 3:115808836-115808858 CAGTATCTCCAGAATACAGTAGG + Exonic
960668108 3:120130848-120130870 CTGTCTCCTCAGAATGCAGGTGG - Intergenic
961148556 3:124616339-124616361 AAGTATACCCAGAAGCCAGTGGG - Intronic
961174507 3:124822752-124822774 CAGGCCCCACAGAAGGCACTGGG + Intronic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
964998828 3:162925699-162925721 CAGTCTCACCACAAGGTAATAGG + Intergenic
965608559 3:170520950-170520972 CAGTCTCTCCAAAAGGCTGTAGG + Intronic
967431373 3:189389887-189389909 CTGTCTACCTAGAAGGAAGTAGG + Intergenic
969252447 4:5977023-5977045 CGGTCTCCCCAGAGGGCACCTGG - Intronic
969411799 4:7033452-7033474 CTGTCTCCCCAGCAGGCAGTGGG + Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
972168018 4:36311108-36311130 CGGTCTCCACAACAGGCAGTGGG - Intronic
974511719 4:62852175-62852197 CAGAAACCTCAGAAGGCAGTTGG - Intergenic
974855239 4:67453373-67453395 AGGCCTCCCCAGAAGCCAGTGGG - Intergenic
977007561 4:91590022-91590044 CAGTTTTCCCAGAAGCCACTAGG - Intronic
978617087 4:110608670-110608692 CAGCCTCTCCAGCATGCAGTGGG + Intergenic
979197096 4:117932963-117932985 CATTCTCTCCAGAAGGGGGTTGG - Intergenic
979301822 4:119095279-119095301 CAGCCTCCTTAGAAGGCAGTGGG + Intergenic
980718103 4:136654623-136654645 CAGTCTTTACAGAAGGCACTGGG - Intergenic
982054641 4:151536023-151536045 CACTCTTTCCAGAAGGCATTTGG - Intronic
984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG + Intronic
985573669 5:663904-663926 CAGCCTCCCCAGGAGGGAGCAGG + Exonic
985790492 5:1924362-1924384 CAGTCCCCCAAGAAGGCACTGGG - Intergenic
986141288 5:5033112-5033134 AAGGCTGCCCAGAAGGCAGCAGG + Intergenic
986781905 5:11074325-11074347 CAGTTTCGCCAGCAGACAGTGGG + Intronic
989974877 5:50573078-50573100 TAGTCTACTCAGAAGGCAGTGGG + Intergenic
990083176 5:51942036-51942058 CATTATAGCCAGAAGGCAGTAGG + Intergenic
990597343 5:57324814-57324836 CAGTCCACCCAGAAAGCAGGAGG + Intergenic
992742320 5:79786042-79786064 CTGTCTCCTCAGAAGGCCTTGGG - Intronic
995530846 5:113090640-113090662 CAGTCTACCCAGAAGGACGATGG + Intronic
996492086 5:124110031-124110053 AAGTCTCCCCAAAAGGATGTGGG + Intergenic
997229884 5:132234612-132234634 CAGAATCCCCAGAAGCCTGTGGG + Intronic
998166339 5:139846554-139846576 CAGGTTCCCCAGCAGCCAGTGGG + Intergenic
998474567 5:142409417-142409439 CAGTTTGCCCAGCAGGCAGGAGG - Intergenic
999091710 5:148941848-148941870 AAATCTGCCCAGAAGCCAGTGGG - Intronic
1000939623 5:167344827-167344849 GAGTCCCCACAGAAAGCAGTGGG + Intronic
1001541783 5:172544908-172544930 CAGTCGCCCCATCAGGCAGTTGG - Intergenic
1002092931 5:176815363-176815385 GAGACTCCCCAGAAGGCAGGAGG - Intronic
1002661189 5:180792100-180792122 CAGTCGTCCCAGAAGGCCTTTGG + Exonic
1004320236 6:14626214-14626236 CCTGCACCCCAGAAGGCAGTGGG - Intergenic
1004658998 6:17693307-17693329 CAGTCTTACCAGAAACCAGTTGG - Intronic
1006182374 6:32162129-32162151 CTGTCTCCCCAGTAGGCCTTGGG + Intronic
1006778932 6:36618683-36618705 CAGTCTCCCCAGCTGGAAGTAGG + Intergenic
1007358329 6:41336533-41336555 CAGTCTCCTGGGAAGGCTGTTGG + Intronic
1007460795 6:42017246-42017268 CAGCCTCTCCAGCAGGGAGTGGG + Intronic
1007635819 6:43299143-43299165 CAGTCTCCCTGGGAGGCAGCAGG + Intronic
1008093907 6:47319214-47319236 CAGTTTACTCAAAAGGCAGTGGG + Intergenic
1012450833 6:99350858-99350880 CAGTCACCCCAGGAGGCCGTTGG - Intergenic
1015840338 6:137470088-137470110 CACTCTGCCCAGTAGGCATTAGG - Intergenic
1019634150 7:2066667-2066689 CAGACTTCCCAGAAGGCTGCGGG + Intronic
1020886179 7:13821498-13821520 TAGACTTGCCAGAAGGCAGTTGG + Intergenic
1021382373 7:19983674-19983696 GACTCACCCCATAAGGCAGTGGG + Intergenic
1023643123 7:42281639-42281661 AAGCCTCCCCAGAAGACAATGGG - Intergenic
1026298811 7:69079344-69079366 CAGTCTACCCGGAGGGCAGAAGG - Intergenic
1026449501 7:70515154-70515176 GAGTCTCTCCTGCAGGCAGTGGG + Intronic
1029308665 7:99641037-99641059 CAGTCTCTTCAGAAGGTGGTAGG + Intergenic
1029403234 7:100358171-100358193 GAGGCTCCCCAGAGGGCTGTGGG - Intronic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1029993737 7:104986110-104986132 CAGGATACCCTGAAGGCAGTAGG + Intergenic
1030962278 7:115940590-115940612 CAGTTTCCAAAGAAAGCAGTAGG - Exonic
1033234229 7:139625539-139625561 CACCCATCCCAGAAGGCAGTAGG - Intronic
1034050500 7:147978910-147978932 CAGCCTCCCCAGGAGGAATTGGG - Intronic
1034426410 7:151016503-151016525 CTGTGTCCCCAGGAGGCACTGGG - Exonic
1035181210 7:157090748-157090770 CCGTGTCCCCAAAACGCAGTTGG - Intergenic
1038191372 8:25324121-25324143 CACTCTCTCCAGAAAGCAGGTGG - Intronic
1038528200 8:28295347-28295369 CAGTCTCACCTGGAGGCAATGGG + Intergenic
1040433820 8:47370219-47370241 CTGTCTCCTTAGAAGGCAGAAGG + Intronic
1042485910 8:69345502-69345524 CAGTCTCCCTAGAAGACAGCAGG + Intergenic
1043965440 8:86469573-86469595 CAGTCTACTCAGAAGGCTATAGG - Intronic
1044727336 8:95204158-95204180 CAGACTCCCCAGCAGGCATCTGG - Intergenic
1044854487 8:96461002-96461024 CAGGCTCACCAGAAAGCAGGTGG + Intergenic
1046981891 8:120345442-120345464 CAGGCTCCCCAGGAGGCCCTTGG - Exonic
1047311216 8:123694030-123694052 CAGTCTGCTCAGAGGTCAGTGGG - Intronic
1047846905 8:128816004-128816026 CAGTCTCCCCAGATGTTAATAGG - Intergenic
1048211929 8:132461593-132461615 CAGGCACCCTGGAAGGCAGTGGG - Intronic
1048379814 8:133855518-133855540 GAGCCTACCCAGAAGGCAGCTGG + Intergenic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1049617091 8:143580400-143580422 AAGTCTCCCCAGAACCCAGAGGG + Intronic
1050998930 9:12256490-12256512 CACTTTCCCCAGGAGGTAGTGGG + Intergenic
1051020588 9:12537920-12537942 CATTCTCCTGGGAAGGCAGTGGG - Intergenic
1052745507 9:32436376-32436398 CGATTTCCCCAGAAGGCAGATGG - Exonic
1055941008 9:81649752-81649774 CTGTCTCCCCAGAGGGGAGGAGG - Intronic
1057261938 9:93589495-93589517 CTGTGTCCCCAGGAGACAGTTGG - Intronic
1057772660 9:97982756-97982778 CAGTCTGCCAAGGAGGCAGCGGG + Intergenic
1059074829 9:111181733-111181755 CAGTCTCCACTGAATGCATTAGG - Intergenic
1059320431 9:113464300-113464322 CAGCCTCCCCACAAGGCAGCAGG - Intronic
1059535147 9:115073738-115073760 CAGTCTCCCCACAGGCCAGTGGG - Exonic
1059602483 9:115795004-115795026 CATTATCTCCAGAATGCAGTGGG - Intergenic
1061149371 9:128820263-128820285 CTGTCTTCCCAGAAGGAAGCTGG - Exonic
1061279498 9:129589154-129589176 AAGTGTCACCAGAAGCCAGTGGG - Intergenic
1061586795 9:131574884-131574906 CAGTTTCCCCAGCTGGAAGTGGG - Intergenic
1061753608 9:132797796-132797818 CAATCTCCCCCGAAGGCCATGGG + Intronic
1061880332 9:133565751-133565773 CAGTTCCCCCAGAAGGAAATCGG - Intronic
1062023781 9:134331173-134331195 CAGAGTCCCAAGAAGGCAGGTGG + Intronic
1203747069 Un_GL000218v1:45677-45699 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1203563036 Un_KI270744v1:73803-73825 CAGTTTCCCCAGATGGCAGCAGG - Intergenic
1186295058 X:8140439-8140461 CAACCTCCCCAGAAGGCATTTGG + Intergenic
1187531351 X:20099775-20099797 CAGACTCCCCAGTAGCCAGCTGG + Intronic
1189993208 X:46613832-46613854 CACTCTACCCAGAGGGCAGGTGG + Intronic
1191141060 X:57117318-57117340 GAGTCTCACCTGAAGGCAATGGG - Intergenic
1191142660 X:57133034-57133056 GAGTCTCACCTGAAGGCAATGGG - Intergenic
1192229496 X:69255403-69255425 CAGTCCAGCCAGGAGGCAGTGGG + Intergenic
1192710700 X:73582602-73582624 AAGTCTCACCTGAAGGCAATGGG - Intronic
1194156772 X:90399846-90399868 GAATCTCCCCACAAGGTAGTTGG + Intergenic
1194840667 X:98737157-98737179 CAGTCTCCGGAGAAGTCATTAGG - Intergenic
1194999391 X:100627470-100627492 CAGTTTCCACTGGAGGCAGTAGG - Intronic
1196818736 X:119686171-119686193 CAGGCTCCCCAGAGGGCAGTTGG - Intronic
1198126356 X:133648043-133648065 GGGTCTCCGCAGAAGGTAGTAGG - Intronic
1198811249 X:140538462-140538484 CAGTAGCCCCACAAGGCAGCTGG + Intergenic
1200110204 X:153737085-153737107 CAGACTCCCCAGAATGCAGAGGG + Intronic
1200216196 X:154369242-154369264 CACTCTCCCCAAATGGCAGCAGG + Intronic
1200503119 Y:3976832-3976854 GAATCTCCCCACAAGGTAGTTGG + Intergenic
1201160390 Y:11160672-11160694 CAGTTTCCCCAGATGGCAGCAGG + Intergenic