ID: 984988494

View in Genome Browser
Species Human (GRCh38)
Location 4:185354354-185354376
Sequence CTACTGCTCAAGAGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 270}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984988494_984988497 -10 Left 984988494 4:185354354-185354376 CCTTTTTTCCTCTTGAGCAGTAG 0: 1
1: 1
2: 1
3: 29
4: 270
Right 984988497 4:185354367-185354389 TGAGCAGTAGTTCTTCATGGAGG 0: 1
1: 0
2: 6
3: 58
4: 347
984988494_984988498 -9 Left 984988494 4:185354354-185354376 CCTTTTTTCCTCTTGAGCAGTAG 0: 1
1: 1
2: 1
3: 29
4: 270
Right 984988498 4:185354368-185354390 GAGCAGTAGTTCTTCATGGAGGG 0: 1
1: 0
2: 2
3: 20
4: 235
984988494_984988502 7 Left 984988494 4:185354354-185354376 CCTTTTTTCCTCTTGAGCAGTAG 0: 1
1: 1
2: 1
3: 29
4: 270
Right 984988502 4:185354384-185354406 TGGAGGGAAGGAGGGACATATGG No data
984988494_984988499 -5 Left 984988494 4:185354354-185354376 CCTTTTTTCCTCTTGAGCAGTAG 0: 1
1: 1
2: 1
3: 29
4: 270
Right 984988499 4:185354372-185354394 AGTAGTTCTTCATGGAGGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 161
984988494_984988500 -2 Left 984988494 4:185354354-185354376 CCTTTTTTCCTCTTGAGCAGTAG 0: 1
1: 1
2: 1
3: 29
4: 270
Right 984988500 4:185354375-185354397 AGTTCTTCATGGAGGGAAGGAGG 0: 1
1: 0
2: 3
3: 26
4: 284
984988494_984988501 -1 Left 984988494 4:185354354-185354376 CCTTTTTTCCTCTTGAGCAGTAG 0: 1
1: 1
2: 1
3: 29
4: 270
Right 984988501 4:185354376-185354398 GTTCTTCATGGAGGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984988494 Original CRISPR CTACTGCTCAAGAGGAAAAA AGG (reversed) Intronic
901110562 1:6790258-6790280 CTCCTGCTGAGGAGGAAAAAAGG - Intronic
902152713 1:14457367-14457389 CTACTAATCAAGAAGAAAACAGG - Intergenic
902243031 1:15101364-15101386 CGAGAGATCAAGAGGAAAAAAGG - Intronic
904058913 1:27691249-27691271 CTGCTGCTCAAAAGAAAAGAGGG - Intergenic
904491062 1:30859321-30859343 CTCCATCTCAAGAGAAAAAAAGG - Intergenic
904999089 1:34654097-34654119 GTGATGCTCAAGAGGAATAAAGG + Intergenic
905602520 1:39266050-39266072 CTTCTGCTCCAGAGAAAAACTGG - Intronic
907836956 1:58119038-58119060 CTACTGCACAAGTGTATAAAAGG - Intronic
910263859 1:85317308-85317330 CTGCTCCTCCAGAGGAGAAAGGG - Intergenic
910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG + Intergenic
910775555 1:90871110-90871132 CTCCTTCTCAAGAGAAAGAAAGG - Intergenic
912102753 1:106232481-106232503 CCTCTCCTCAAGAGGAAGAAAGG + Intergenic
912696994 1:111849251-111849273 CTTCTGCTCACCAGGAAAAGGGG - Intronic
912956722 1:114159124-114159146 TTACTGGTCTAGAGGAAAGATGG + Intergenic
914854229 1:151338890-151338912 CAACTGATCAAGACCAAAAAAGG + Intergenic
914934787 1:151968827-151968849 CAACTTCTCAAGAGGGAAGAGGG + Intergenic
915180767 1:154057440-154057462 CTAAGGCTCCAGAGGAATAAGGG + Intronic
916196851 1:162232365-162232387 CTGATCCCCAAGAGGAAAAAAGG - Intronic
917003427 1:170385849-170385871 CTTCTCCTCAAGTGGAAAGAAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917953351 1:180064398-180064420 TAACTGTTCAAGAGGAAGAAAGG + Intronic
918190384 1:182168394-182168416 CTACTGTACAAGATGAGAAAAGG - Intergenic
919227832 1:194730440-194730462 CTACTATTCAAGAGGAAATTTGG + Intergenic
919684367 1:200469207-200469229 CTAATGCTCCAGTGGAAACAAGG + Intergenic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
921344153 1:214164702-214164724 CTACTACTGAGGAGAAAAAATGG + Intergenic
921379278 1:214507198-214507220 CTACTGCTCAGAATGAATAATGG - Intronic
924031999 1:239895132-239895154 CTACTGCTGCAGAGAAAAAGAGG - Intronic
924767094 1:247043853-247043875 CCACTAATGAAGAGGAAAAAAGG + Intronic
1062766370 10:68953-68975 CATCTGCTCAGGAGGAAACACGG - Intergenic
1063341704 10:5271404-5271426 CTCCAGCTCCAGAGGGAAAAGGG + Intergenic
1064682215 10:17822070-17822092 CTCTTGCAAAAGAGGAAAAAAGG - Intronic
1067901376 10:50244991-50245013 CTTCTGCTCATGAAAAAAAAAGG + Intronic
1068272426 10:54746304-54746326 ATACTGCTCAAAAAGAAAGAGGG + Intronic
1068904673 10:62309724-62309746 CTACAGCTCAAGAGGAGATCTGG - Intergenic
1072440658 10:95451709-95451731 CGACTGCTTCAGAAGAAAAATGG - Intronic
1072655602 10:97328175-97328197 CTACAGCTAAAAAGGGAAAATGG + Intergenic
1075267985 10:121021837-121021859 CTACTGGTCAAGAAGTCAAAGGG - Intergenic
1080600255 11:33815790-33815812 CCAGTGCTTAAGAGGAAGAATGG + Intergenic
1080778536 11:35408683-35408705 CCACTGGTCCAGAGGACAAAAGG + Intronic
1081565598 11:44259073-44259095 CCACTGCTGAAGAGGAAGACTGG - Intergenic
1083110364 11:60400272-60400294 CTGATGCTCAGGTGGAAAAACGG + Intronic
1085551296 11:77375379-77375401 CTACTGCCCACAAGGACAAAAGG + Intronic
1088551985 11:111022431-111022453 AAACTGCCCAAGAGGCAAAAAGG - Intergenic
1088588795 11:111383190-111383212 CTGCTGATCAACAAGAAAAAGGG - Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1088783679 11:113161673-113161695 CTCATGCTTAAGAGGAAACAAGG - Intronic
1089729551 11:120511792-120511814 CTGCTGCGGAAGAGGAAAAACGG + Exonic
1092599015 12:10038555-10038577 CTACTACTTAATTGGAAAAAGGG + Intronic
1092839755 12:12528377-12528399 TTACTGGGCAAGAGGAAATACGG + Intronic
1093644292 12:21566225-21566247 CTACAGAGCAAGAGGAAAATTGG - Intronic
1093783915 12:23170759-23170781 CTACATCTCAAGAGAAAAGAAGG + Intergenic
1094449679 12:30571605-30571627 CTACTGCCTAAGAGGACAATGGG + Intergenic
1095950404 12:47778603-47778625 CTACTTTTCAAGAGGATAAAAGG - Intronic
1097150949 12:56979503-56979525 CCTCTGCTCAAGTAGAAAAAAGG + Intergenic
1098099820 12:67003067-67003089 TTAGTGCTCAGGAGGAAAGAAGG - Intergenic
1101636362 12:106545763-106545785 CTACTTCTCAAAAAAAAAAAAGG + Intronic
1104446876 12:128841613-128841635 TTAATGCTCTAAAGGAAAAAAGG + Intergenic
1104566912 12:129893641-129893663 CTTCTGCTGAAGGGGAAAAATGG - Intronic
1105755419 13:23459229-23459251 GTTCTGCTGAAGAGGAAAGATGG - Intergenic
1105822040 13:24088413-24088435 CTTCATCTCAAGAGGAAGAAAGG - Intronic
1106917117 13:34527700-34527722 GTTCTGCACAAGTGGAAAAAGGG - Intergenic
1107017613 13:35720379-35720401 CTACTGCCCCAGAGCAACAAAGG - Intergenic
1108697141 13:52912538-52912560 CTGCTGCTCTAGAGAAATAAGGG - Intergenic
1111870469 13:93825559-93825581 CTAATGCAGAAGAGGATAAATGG + Intronic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1118431220 14:65720516-65720538 CTACTGCTCAAGTGGAAGGAAGG + Intronic
1119023064 14:71131317-71131339 CTCCTGGTGAAGAAGAAAAAAGG - Intergenic
1119865980 14:77974859-77974881 CTACTGCTGCAGTGGAAAAAGGG + Intergenic
1120516948 14:85482090-85482112 CTATTTCTCAAGGGGAAGAAAGG + Intergenic
1121544171 14:94751398-94751420 CGAATGGTCAAGATGAAAAACGG + Intergenic
1121613555 14:95297694-95297716 ATACTGCTCAGGAGGAAGAAGGG - Intronic
1122012272 14:98759985-98760007 CTGGAGCTCAGGAGGAAAAATGG - Intergenic
1122837942 14:104439920-104439942 CTACTGCTCAGAAAAAAAAAAGG - Intergenic
1123503432 15:20913288-20913310 CTACTGCTGAAAATGGAAAATGG + Intergenic
1123560679 15:21486953-21486975 CTACTGCTGAAAATGGAAAATGG + Intergenic
1123596917 15:21924249-21924271 CTACTGCTGAAAATGGAAAATGG + Intergenic
1124161851 15:27277765-27277787 CTACTGTTCAACAATAAAAAAGG + Intronic
1125093258 15:35820197-35820219 CTACTGATCATAAGGGAAAAGGG - Intergenic
1125275242 15:37981965-37981987 CTACTGTTCATGAGGGAAACAGG - Intergenic
1126584091 15:50266097-50266119 CTACTGCTGATAAGGAAACAGGG - Intergenic
1127235587 15:57047696-57047718 CTGATATTCAAGAGGAAAAAAGG - Intronic
1130439346 15:83935666-83935688 TTATTTCTCATGAGGAAAAATGG - Intronic
1130655793 15:85791486-85791508 CTCCTTCTCAAAAGAAAAAAAGG + Intronic
1131339896 15:91589049-91589071 CTACTGCCCATTAGGAAAAATGG + Intergenic
1132212634 15:100035729-100035751 GTACTGGACAAGATGAAAAAGGG - Intronic
1202969026 15_KI270727v1_random:214117-214139 CTACTGCTGAAAATGGAAAATGG + Intergenic
1133126542 16:3651068-3651090 CTACTGATCAAGAGGGAAAGCGG - Intronic
1133865778 16:9641793-9641815 CAGAAGCTCAAGAGGAAAAAAGG + Intergenic
1135758206 16:25115615-25115637 CTATTGCTCAACATGGAAAATGG + Intronic
1137077298 16:35986480-35986502 CCACTGCTCAATAAAAAAAAAGG - Intergenic
1137355176 16:47755582-47755604 CTAACGTTCAAGAGGAAATAGGG - Intergenic
1137765817 16:50976892-50976914 ACCCTGCTGAAGAGGAAAAAGGG - Intergenic
1139632327 16:68238028-68238050 CTCAGGCTGAAGAGGAAAAAGGG - Intronic
1140719892 16:77762033-77762055 CTACTGGTCGAAATGAAAAATGG - Intergenic
1142767085 17:2070937-2070959 CTCCTCCGCAAGAGGAGAAAGGG - Intronic
1143784239 17:9244906-9244928 CTTCTGCTCAGGAAGAAATAGGG + Intergenic
1144686989 17:17232576-17232598 CTACTGCTCAACAGGAGATGGGG + Intronic
1146203806 17:30884052-30884074 CTACTGGACAGGAGGAAACAGGG - Intronic
1146486438 17:33246592-33246614 CCCCTGCTCAGGAGGAAATAAGG + Intronic
1147708232 17:42443334-42443356 CTACTGGTGAAGATGTAAAATGG - Intergenic
1147770876 17:42867125-42867147 CTGCTGGTCAAGAGGAATGATGG - Intergenic
1148473396 17:47910443-47910465 CTACCACTCTAAAGGAAAAATGG + Intronic
1150922394 17:69497029-69497051 TTACTGCATAAGAGGAACAAAGG - Intronic
1152511748 17:80794712-80794734 ATTCTGCTCAACAGGAAAAAGGG + Intronic
1152817988 17:82419893-82419915 GTAATGCTCTAGAGGTAAAAGGG - Intronic
1152959239 18:68524-68546 CATCTGCTCAGGAGGAAACACGG - Intronic
1153322220 18:3784656-3784678 CTGCTCCTGACGAGGAAAAAAGG + Intronic
1155580696 18:27302378-27302400 CAATTTCTCAAGAGGAAAAATGG + Intergenic
1155614086 18:27701455-27701477 CTAGGGCTCAAGAGGAAGATGGG - Intergenic
1156016167 18:32549558-32549580 ATACTGCCAAAGAGGAGAAAGGG + Intergenic
1156710720 18:39941930-39941952 ATACTACTCAATAGCAAAAAAGG + Intergenic
1157093694 18:44666751-44666773 ATACTCCTCACTAGGAAAAACGG + Intergenic
1157110869 18:44819236-44819258 CTACTGCTCAAAAGGAAACCAGG - Intronic
1158382327 18:56946234-56946256 CTAATGCTGAAGAGGAACATGGG - Intronic
1158789345 18:60757835-60757857 CTAGTTGTCATGAGGAAAAAGGG + Intergenic
1163092738 19:15032402-15032424 CTACAGCTCTAGAGGATGAATGG - Intergenic
1164351725 19:27354286-27354308 CAACTGCTCAAGAAAAAGAAGGG + Intergenic
1166420883 19:42635081-42635103 CTCCTGCTAAGGAGCAAAAAGGG - Intronic
927909610 2:26887637-26887659 CTACTCCACAAAAGTAAAAATGG + Intronic
929978995 2:46661566-46661588 ATACTTCTAAAGAAGAAAAAAGG - Intergenic
931135180 2:59391177-59391199 CTTCTTCACAAGAGGAAAAATGG - Intergenic
931918506 2:66986204-66986226 TTTCTGTTCAAGAGGAGAAATGG - Intergenic
933349009 2:81128477-81128499 CTTCTCCTCAAGTGGAATAAAGG + Intergenic
933854092 2:86396589-86396611 GCACTGCTCCAGAGGCAAAATGG - Intergenic
934095551 2:88599754-88599776 CTACTGCTTTAGAGGAAAAGAGG - Intronic
934612718 2:95752935-95752957 CTCCTGAGCAAGAGGAAACAGGG - Intergenic
934648196 2:96071488-96071510 CTCCTGAGCAAGAGGAAACAGGG + Intergenic
934667259 2:96181158-96181180 CTACTGTTCTAGATGAAAAGTGG + Intergenic
934818752 2:97353769-97353791 TTACTGCTAAAGAGTAAAAGAGG + Intergenic
935326331 2:101941167-101941189 GTCCTGCTCAAGAGGAAAAAAGG + Intergenic
935933970 2:108161486-108161508 CCACTGCTGAAGAGAAGAAAGGG + Intergenic
936068519 2:109349876-109349898 CCACTGGACAAGAGGACAAAGGG + Intronic
936176001 2:110220474-110220496 CTCCTGCTTAAGAAAAAAAAAGG - Intergenic
936968544 2:118151686-118151708 GTACTGCTCAAGATGCAAAGAGG - Intergenic
937247368 2:120502408-120502430 CTTCCCCTCAAGAGGAAAAATGG + Intergenic
937432950 2:121855726-121855748 CTACTGATCACGAGTAAACAGGG - Intergenic
937769443 2:125702775-125702797 CTACTGTTCAAAAGTGAAAAAGG + Intergenic
938938250 2:136146516-136146538 GTACTGCTCAAGAGAAATCATGG + Intergenic
939059738 2:137406581-137406603 CAACTGCTCATGAGAACAAATGG - Intronic
939862526 2:147436806-147436828 CTACTTTCCAAGGGGAAAAATGG + Intergenic
939902600 2:147868443-147868465 CCACTGCTACAGGGGAAAAAAGG - Intronic
940295233 2:152115735-152115757 CTACTGCTCAAGATGAGCAGAGG + Intergenic
940433723 2:153625671-153625693 CTGTTGCTGAAGAGAAAAAATGG + Intergenic
940904253 2:159154459-159154481 CCACTGCTTAGGAGGAGAAAGGG + Intronic
941302847 2:163826114-163826136 ATATTGCTGAAGAGGAAAAAAGG - Intergenic
942451993 2:176114096-176114118 CTTCTGGCCAAGAGGCAAAAGGG + Intronic
944010829 2:194973109-194973131 GTACCACTCAAGAGGAAGAAAGG - Intergenic
944150362 2:196552078-196552100 CTACAGGTAAAGAGGAAACAAGG + Intronic
945268580 2:207915450-207915472 CCAGTGCTCACGAGAAAAAAGGG + Intronic
945730790 2:213531024-213531046 ATATAGCTCAAGAGGAAAAAAGG - Intronic
946617422 2:221524829-221524851 CTACTGCTCATGAATTAAAATGG + Intronic
947742069 2:232489181-232489203 TTAATTCTAAAGAGGAAAAATGG + Intergenic
1169253718 20:4081561-4081583 CTAGTGCTGAAAAGAAAAAAAGG - Intergenic
1169803726 20:9537870-9537892 TCACTGCTAAAAAGGAAAAAAGG - Exonic
1171224742 20:23432657-23432679 CAACTGCTTAAAGGGAAAAATGG + Intergenic
1172577631 20:36021588-36021610 ATAGGGCTCAAGAAGAAAAAGGG - Intronic
1172870723 20:38134024-38134046 CTACTGCTAAAGAGGGAGATTGG + Intronic
1175678595 20:60967844-60967866 CCACTGCTCTAAAGGAAACAAGG + Intergenic
1178396829 21:32250362-32250384 CAGCTGCTCAAAAGGGAAAATGG - Intergenic
1179278027 21:39909549-39909571 CCACATCCCAAGAGGAAAAAAGG - Intronic
1182306230 22:29370667-29370689 CAACTGACCAAGAGGAGAAACGG + Intronic
1184493255 22:44822766-44822788 TTTCTGCTCAAAAGCAAAAACGG - Intronic
1184974481 22:48051452-48051474 CTACCTCTCAAAAGAAAAAAAGG + Intergenic
951396610 3:22176665-22176687 CTACTGCTTAAAAGGAAGAAAGG - Intronic
951626029 3:24663851-24663873 TTACTGATAAAGAGGAAAAAAGG - Intergenic
953152013 3:40333375-40333397 CTACTGCCAGGGAGGAAAAAAGG + Intergenic
953500667 3:43430734-43430756 CTTCTGATAAAGAAGAAAAATGG - Intronic
957538419 3:81536042-81536064 CTACAGCTCTAGAGTAAACAGGG + Intronic
958282523 3:91689390-91689412 CAACTGCTCTATAGGAAGAAAGG - Intergenic
958289786 3:91808467-91808489 CAACTGCTCTATAGGAAGAAAGG - Intergenic
958292571 3:91854062-91854084 CAACTGCTCTATAGGAAGAAAGG - Intergenic
958333512 3:92524469-92524491 CAACTGCTCTATAGGAAGAAAGG - Intergenic
958362496 3:93000300-93000322 CAACTGCTCTATAGGAAGAAAGG - Intergenic
958364587 3:93034317-93034339 CAACTGCTCTATAGGAAGAAAGG - Intergenic
958375814 3:93218220-93218242 TAACTGCTCAATAGGAAGAAAGG - Intergenic
958385205 3:93371152-93371174 CAACTGCTCTATAGGAAGAAAGG - Intergenic
958387099 3:93402274-93402296 CAACTGCTCTATAGGAAGAAAGG - Intergenic
958397270 3:93568533-93568555 TAACTGCTCAATAGGAAGAAAGG - Intergenic
958730847 3:97958730-97958752 TGACTCCTCTAGAGGAAAAATGG - Intronic
958785372 3:98592548-98592570 CATCTCCTAAAGAGGAAAAAGGG + Intronic
963318897 3:143791146-143791168 CTACTTCTCAAGTGATAAAATGG + Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964637119 3:158870279-158870301 CTACTACTCAAGAGGAATGGAGG + Intergenic
965764282 3:172113780-172113802 ATACTGCCAAAGAGGGAAAAAGG - Intronic
968381369 4:99667-99689 CTACAGCTCAGAAGGAACAAAGG + Intergenic
968711324 4:2121047-2121069 CCACTGCACAAGATAAAAAAAGG - Intronic
970200403 4:13599229-13599251 CTGCTGCTCAGCAGGAAGAAAGG + Exonic
970219325 4:13794626-13794648 CTTCTGCTCCAAAGGAAAAGGGG - Intergenic
970932533 4:21529282-21529304 CAACTGCAGAAGAGGAGAAAGGG + Intronic
971453562 4:26822552-26822574 TTACAGCCCAAGAGGAAAAAAGG + Intergenic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
973232043 4:47851446-47851468 CAGCAACTCAAGAGGAAAAAAGG - Intronic
973661071 4:53106588-53106610 CGAATGATCAAGAGGAAGAAAGG + Intronic
973728482 4:53800245-53800267 CTACTGCCAAAGAGGAAACGAGG + Intronic
974284806 4:59850489-59850511 GTACAGATCAACAGGAAAAATGG - Intergenic
974381017 4:61139999-61140021 CAACTGCTCAAAGGGAAAATAGG + Intergenic
976991110 4:91367561-91367583 CTACTGGTAAAGAGCAAAGAGGG - Intronic
979856596 4:125640205-125640227 CCACTACTCAAGAAGAAGAAGGG - Intergenic
981956889 4:150486255-150486277 CTACTGCAAAAGAAAAAAAAGGG + Intronic
982520579 4:156411748-156411770 CTGCTGCTCAGGAAAAAAAAAGG - Intergenic
982659555 4:158190808-158190830 TCACTGCTCAAGGGGAAAACAGG - Intergenic
984012417 4:174386011-174386033 CTACAGTTCAAGAGGAAATTTGG + Intergenic
984988494 4:185354354-185354376 CTACTGCTCAAGAGGAAAAAAGG - Intronic
985950675 5:3219500-3219522 CTCCTGCTCATCAGGAACAATGG - Intergenic
987176825 5:15320215-15320237 CTAGTTATCAAGAGGAAATAGGG + Intergenic
987496622 5:18653220-18653242 CATCTCCTCAAGAGGAAGAAAGG + Intergenic
987716012 5:21572077-21572099 CTACTGCTCAGGAAAAAATAAGG + Intergenic
987960383 5:24799907-24799929 CTACTACTGAAGAGAGAAAAAGG - Intergenic
988087706 5:26493033-26493055 CTACTGCACAGAAGGAAAACAGG - Intergenic
988299096 5:29399009-29399031 TTACTTCTCAAGAGTCAAAAGGG + Intergenic
988299351 5:29403224-29403246 CTTCTACTCAAGTGGAAGAAAGG - Intergenic
988827809 5:34957090-34957112 CTACTTTTGAAGAGGAAAACAGG + Exonic
988894460 5:35657041-35657063 CCTCTCCTCCAGAGGAAAAATGG + Intronic
989294277 5:39805980-39806002 CTACTGCCCAGCAGGTAAAAAGG + Intergenic
989840059 5:46053431-46053453 ATACTGCTCAATTGGAAAACAGG - Intergenic
990225968 5:53654103-53654125 TTTCTGCTAAAGAAGAAAAAGGG - Intronic
990626851 5:57623020-57623042 CTATTGCACAGGAAGAAAAAAGG + Intergenic
990786204 5:59423300-59423322 GAACTGCTCAAAAGGAAACAAGG - Intronic
991014544 5:61916879-61916901 CTCCTTCTCAAGAGGACAGATGG - Intergenic
991306799 5:65185359-65185381 CCCTTGTTCAAGAGGAAAAATGG - Intronic
991449090 5:66732730-66732752 CCAAGGCTCAAGTGGAAAAAGGG - Intronic
993717135 5:91286598-91286620 TTACTTTTCAAAAGGAAAAACGG - Intergenic
996918640 5:128740318-128740340 GTACTACTCAGCAGGAAAAAGGG + Intronic
998681134 5:144468471-144468493 CAACTGCTCATGAGTAAAAACGG + Intronic
998779996 5:145646302-145646324 GTACAGATCAAGAGGAAGAAAGG - Intronic
999929234 5:156412533-156412555 CTTTTACTCATGAGGAAAAAGGG + Intronic
1001349092 5:170939071-170939093 CAACTTCTCAACAGTAAAAATGG + Intronic
1002594692 5:180314209-180314231 CTCATCCTCAAGAGGAAAATGGG - Intronic
1003212214 6:4078749-4078771 CCACAGCTCAGGAGGAAAAGGGG - Intronic
1003971589 6:11305208-11305230 CTCATGCTCAAAATGAAAAAAGG - Intronic
1005266140 6:24114043-24114065 CTACTGTTAAGGGGGAAAAAAGG + Intergenic
1006047606 6:31310412-31310434 CTACTGGACAAGTGGGAAAAGGG + Intronic
1007318002 6:41004833-41004855 ATCCAGCTGAAGAGGAAAAATGG - Intergenic
1008177770 6:48289349-48289371 TAACTGTTCAAGAGGTAAAAAGG - Intergenic
1008256883 6:49313094-49313116 CTCCAGCTCAAAAAGAAAAAAGG - Intergenic
1009000709 6:57709983-57710005 CTACTGCTCAGGAAAAAATAAGG - Intergenic
1010079965 6:71849621-71849643 CTAGATCTCCAGAGGAAAAAAGG + Intergenic
1013209370 6:107973084-107973106 CTAATACTAAGGAGGAAAAAAGG + Intergenic
1013999819 6:116352353-116352375 CTTGTGATCAAGAGAAAAAATGG - Intronic
1015107520 6:129554284-129554306 CTACTGCTTAAAAGGAAATAAGG + Intergenic
1016819799 6:148336495-148336517 CTGCTGCTAAAGAGGTAAATGGG + Intronic
1017112850 6:150949008-150949030 CTAATGATTAAGAAGAAAAAAGG - Intronic
1017646112 6:156541256-156541278 CTTCTGCCCAAGAGGCCAAAGGG + Intergenic
1020572954 7:9889834-9889856 CCTCTTCTCAAGAGGAACAAAGG - Intergenic
1021412001 7:20339385-20339407 TTACTGCGAAAGAGGAAATAAGG - Intronic
1021542684 7:21777265-21777287 ATACTGCTCAACAATAAAAAAGG - Intronic
1023652912 7:42389747-42389769 CTACTGTACTAGAGGAAAGATGG - Intergenic
1023974582 7:45018689-45018711 TAACTTCTCAAGAGAAAAAATGG - Intronic
1027418611 7:77998280-77998302 CAACTTCCCTAGAGGAAAAAAGG + Intergenic
1027689675 7:81328108-81328130 CTACTGCTGAAGTGGGAAATGGG + Intergenic
1029873291 7:103719016-103719038 CTATTGCTCAAGAGAGAAAGAGG + Intronic
1030170068 7:106591818-106591840 GTACTCCTCAGGAGGAAGAATGG - Intergenic
1032126510 7:129198346-129198368 TTACTTCTGCAGAGGAAAAATGG - Intronic
1032557467 7:132852231-132852253 CTACTGCTGAAGAGCTAATATGG + Intronic
1034136858 7:148778915-148778937 ATATTGCTAAAGAGGAATAATGG - Intronic
1034648779 7:152673045-152673067 CTACTGTGCAAAGGGAAAAATGG + Intronic
1035529186 8:337691-337713 ATATTGGTCCAGAGGAAAAATGG + Intergenic
1035958102 8:4105596-4105618 CTACAGCAGAAGAGGAAACAGGG + Intronic
1037204815 8:16304024-16304046 CTACAGTTCAAGAGGAGATATGG + Intronic
1038095187 8:24301349-24301371 ATAATGCACAACAGGAAAAAAGG - Intronic
1039141409 8:34392863-34392885 CTACTGCCAAAGAGGTAGAATGG + Intergenic
1039262031 8:35782237-35782259 TTACTGCTCTTGAGGATAAATGG + Intronic
1043107252 8:76129725-76129747 CAACTGCTCAAGTGAAAAAAAGG - Intergenic
1043842235 8:85121035-85121057 CTGCTGCTGAAGATGTAAAATGG - Intronic
1043843709 8:85139631-85139653 AAAATGCTCAAGAGGAAATAAGG + Intronic
1044548020 8:93481180-93481202 CTCCTGCTCCACAGGAAAATGGG + Intergenic
1045149282 8:99385524-99385546 CTACTCATTAAAAGGAAAAATGG - Intronic
1047837775 8:128713011-128713033 CTATTGCTCAAAAGCAACAAGGG + Intergenic
1048610027 8:136012038-136012060 CCACTGGTCAATAGGAACAAGGG + Intergenic
1048822206 8:138391009-138391031 CTACTTCCCAAGATGAAGAATGG + Intronic
1048961195 8:139579845-139579867 CTACAGTTTAAAAGGAAAAATGG - Intergenic
1051610525 9:18957519-18957541 CTACTGGGAAAAAGGAAAAATGG - Intronic
1052398740 9:27973976-27973998 CTTCTACTCAAGAGTACAAATGG + Intronic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1055355766 9:75435633-75435655 TAACTGCTACAGAGGAAAAAAGG - Intergenic
1056140650 9:83675996-83676018 TTACTGGCCAAGAGGCAAAATGG - Intronic
1056248507 9:84723148-84723170 CTAATGCTCAAGAACACAAAAGG - Intronic
1061428941 9:130519043-130519065 CTAAAGCACAAGAGGACAAAGGG + Intergenic
1203375370 Un_KI270442v1:370603-370625 ATACTGCTCAATAGAAAGAAAGG + Intergenic
1186586864 X:10884612-10884634 GAAATTCTCAAGAGGAAAAATGG + Intergenic
1187638390 X:21259700-21259722 CTGCTGCTCCAGAAGAAAGATGG + Intergenic
1189214432 X:39311092-39311114 CTACTGCTCAAGAGAGTCAAGGG - Intergenic
1190394039 X:49961712-49961734 CTGCTTCTCAAGAGAAAACAAGG - Intronic
1191147814 X:57187224-57187246 CCACTGCTCAAGAAAATAAAAGG - Intergenic
1192512386 X:71730248-71730270 CTACAGCTCAAGAGGAGATTTGG + Intergenic
1192514311 X:71751261-71751283 CTACAGCTCAAGAGGAGATTTGG - Intergenic
1192798460 X:74443910-74443932 CTTCTGCTCAAGATGCAGAAGGG - Intronic
1193741304 X:85220494-85220516 CTTCACCTCAAGAGGAAGAAAGG - Intergenic
1194144143 X:90242691-90242713 CATATGCTTAAGAGGAAAAAGGG + Intergenic
1194456006 X:94104513-94104535 CTACAGCTCAAGATGATAATTGG + Intergenic
1195387981 X:104331316-104331338 CTACTGCTGAAGAGGAATAGAGG - Intergenic
1195434550 X:104827894-104827916 AAACTGATCAAGTGGAAAAAAGG - Intronic
1196326943 X:114416834-114416856 TTACTTCTCAAGAGCAAAAAAGG + Intergenic
1196796167 X:119503502-119503524 CTACTGCTGAAAAGGAAATAGGG + Intergenic
1197283395 X:124565011-124565033 ATACTTTTCAAAAGGAAAAATGG + Intronic
1197446916 X:126562047-126562069 CTACTGCTCAGCAGTCAAAAAGG + Intergenic
1198586109 X:138124157-138124179 CTTCTCCTCAAGTGGAAAAATGG + Intergenic
1199169651 X:144721178-144721200 CTGCAGCTCAGAAGGAAAAAAGG + Intergenic
1199555967 X:149109093-149109115 TTACTGCTCAAGAGTCAATATGG + Intergenic
1200393521 X:155968538-155968560 CAACTGCTCAGGAGGAAACAGGG - Intergenic
1201322965 Y:12720629-12720651 CTCCTCCTCCAGAGGAACAAGGG + Exonic