ID: 984988983

View in Genome Browser
Species Human (GRCh38)
Location 4:185359671-185359693
Sequence TGGGAATTTCTTTTAATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984988983_984988989 6 Left 984988983 4:185359671-185359693 CCTGTAATTAAAAGAAATTCCCA 0: 1
1: 0
2: 3
3: 33
4: 302
Right 984988989 4:185359700-185359722 CCTTCTTTTTCTCAGGACTCAGG 0: 1
1: 0
2: 5
3: 29
4: 335
984988983_984988987 -1 Left 984988983 4:185359671-185359693 CCTGTAATTAAAAGAAATTCCCA 0: 1
1: 0
2: 3
3: 33
4: 302
Right 984988987 4:185359693-185359715 AAAATGGCCTTCTTTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984988983 Original CRISPR TGGGAATTTCTTTTAATTAC AGG (reversed) Intronic
900988379 1:6086338-6086360 GTGCAATTTCGTTTAATTACAGG - Intronic
901778893 1:11579631-11579653 TGTGCATTTCTTTAAATCACAGG - Intergenic
903345803 1:22683574-22683596 AGGGAATTTCTTTACAATACAGG - Intergenic
903751243 1:25622270-25622292 TGGAAATTCCTGTTTATTACTGG + Intronic
905150863 1:35926334-35926356 TGGGCATTCCTTTTCATTACTGG + Exonic
906724404 1:48033523-48033545 AGGGAATTTGTTCTAATTATAGG - Intergenic
907567823 1:55452834-55452856 TGGGATTTTCTCTTTATTGCTGG - Intergenic
907640715 1:56187269-56187291 TGGTAATGTATTTTAATCACTGG - Intergenic
908125255 1:61024176-61024198 TGCAATTTTCTTTTAATGACCGG - Intronic
908597643 1:65705639-65705661 TGTTAATTTCTTTAAACTACAGG - Intergenic
908598548 1:65713784-65713806 AGGGCATCTCTTTTTATTACTGG - Intergenic
908896353 1:68904715-68904737 AGGGATTTTCTGTTAGTTACTGG + Intergenic
908974380 1:69880029-69880051 TACGAATGTGTTTTAATTACAGG + Intronic
909152926 1:72031648-72031670 TGTGAAATCCTTTTATTTACTGG + Intronic
909801707 1:79818142-79818164 AGAGAATTTCTTTTTCTTACTGG + Intergenic
909859658 1:80588788-80588810 TTGTAATTTTTTTAAATTACAGG - Intergenic
910222998 1:84907743-84907765 TGGGAATTTATTCTAATTGTCGG + Intergenic
910449774 1:87333296-87333318 TGGGTTTTTTTTTTAATTACTGG - Intronic
911604776 1:99891584-99891606 TTCAAATTTATTTTAATTACAGG + Exonic
913153603 1:116071258-116071280 TTGGAATTTATTTTTATTATGGG - Intergenic
913455610 1:119027469-119027491 TGGCATTTGCTCTTAATTACTGG - Intergenic
914378716 1:147097091-147097113 TAGGATTTTCTCTTCATTACTGG + Intergenic
915274725 1:154780412-154780434 TGTGAATTTCTCTAAATTAAAGG + Intronic
915897264 1:159821862-159821884 TTGGGATTTCTTTCAATTCCAGG + Intergenic
916665866 1:166967028-166967050 TGGGAATTTCTATTACTGAAAGG - Intronic
918192050 1:182185145-182185167 AGGGAATTATTGTTAATTACTGG - Intergenic
918391522 1:184068285-184068307 TGGAAATATTTTTCAATTACAGG - Intronic
918445383 1:184612120-184612142 TGGGAATCTCTGTTAGTTGCTGG - Intronic
919139513 1:193553038-193553060 TCTGAATTTATTTTAATCACAGG - Intergenic
920235873 1:204504635-204504657 AGGGAATTTATTTTAGTTTCTGG - Intergenic
920692620 1:208158601-208158623 GGGGTGTTCCTTTTAATTACAGG - Intronic
921283991 1:213592698-213592720 TGGGATTTTATATTAATTAATGG + Intergenic
923611780 1:235502421-235502443 TGGGATTTTTTTTTAAGTTCCGG - Intronic
1063192337 10:3707791-3707813 TGGGAGTTTCATTTTATTACTGG + Intergenic
1063537446 10:6898395-6898417 TAGTTATTTCTTTTTATTACTGG - Intergenic
1065932967 10:30495618-30495640 TGGGAATTTCTGATCATTTCAGG + Intergenic
1066035760 10:31481792-31481814 TGGATATTTCTTTTATTTTCTGG - Intronic
1068249396 10:54417302-54417324 TTGGAATTTTTTTTAAATACTGG + Intronic
1068931941 10:62599697-62599719 TGTCAATTCCTTTTTATTACTGG - Intronic
1070801288 10:79245788-79245810 TGTGAATTTCAATTAATTAAAGG + Intronic
1071142746 10:82530024-82530046 TGGGAATTTCTTCTAGTTCATGG + Intronic
1071953020 10:90726807-90726829 TAGGAATTTTTTTTAATAATTGG - Intergenic
1076309981 10:129498541-129498563 TGGATATTTATTTTAATTTCTGG + Intronic
1079196280 11:18330301-18330323 TGGTGAATTCTTTTTATTACTGG - Intronic
1079414435 11:20220373-20220395 TGCAAATTTCTTTTAATTTCTGG - Intergenic
1081293576 11:41357040-41357062 TGGTATTTTTTTTTAATTTCTGG - Intronic
1082737852 11:56876213-56876235 TGGGAAATACTTTTATTTATAGG + Intergenic
1082740118 11:56901513-56901535 TGGGATTTTATTTTTCTTACAGG - Intergenic
1085931070 11:81084512-81084534 TTGGAATTTCTTTTATTTAAGGG + Intergenic
1086464088 11:87036207-87036229 TGGGAAGTTTTTTTAAAAACAGG + Intergenic
1087219983 11:95536397-95536419 TTGGACTTTCTTTTTATTACTGG - Intergenic
1087547943 11:99608251-99608273 TTGGAAGTCCTTTTAGTTACTGG + Intronic
1087885823 11:103481436-103481458 GGGGAATTTTTTTTAATTAATGG + Intergenic
1090177310 11:124662596-124662618 TGGCATTATCTTTTAATTACTGG - Intronic
1090337210 11:125978991-125979013 TGGGCATTTTTCTTAATTGCTGG - Intronic
1091162062 11:133432901-133432923 TGGGAATTTCTTTTGCTTTGGGG + Intronic
1093185161 12:16011857-16011879 TGGCATTTTCTTTTGTTTACAGG + Intronic
1094748964 12:33382811-33382833 TTGGAATTTTCTTCAATTACTGG + Intronic
1095740487 12:45601333-45601355 TGGGAATTTCTAGTCATTACAGG + Intergenic
1095819849 12:46466009-46466031 TGGGAGTTTTTTTTAAGTATTGG + Intergenic
1095820268 12:46470895-46470917 TGGAAATTTTTTTTATTTAAAGG + Intergenic
1098113638 12:67151334-67151356 GGAGAATTTCTTTAAATAACAGG - Intergenic
1098924111 12:76330107-76330129 TTTGAATTACTTTTAATTGCTGG + Intergenic
1099415801 12:82384682-82384704 TGTTAATTTCCTTTAAGTACAGG - Intronic
1099916442 12:88900757-88900779 TGTGAATTTCTAATAACTACAGG - Intergenic
1103075509 12:117979266-117979288 TCAGAATTTGTTATAATTACAGG - Intergenic
1103585296 12:121948818-121948840 TAGGAATATCATTTAAATACTGG - Intronic
1104275153 12:127320217-127320239 TGAGAACTTCATTTAATTAAGGG + Intergenic
1104325653 12:127794144-127794166 TGGGAACATTTTTCAATTACTGG + Intergenic
1105764713 13:23547535-23547557 TGGGAATTTCTTTGCATCTCAGG + Intergenic
1106825844 13:33519489-33519511 TGGGAATTTTTTTTATCCACTGG + Intergenic
1107074279 13:36305049-36305071 TGGCTATGTCTTTTAATTATGGG + Intronic
1107157877 13:37190866-37190888 TGGCAATTTATTTTACTTCCTGG + Intergenic
1107756458 13:43628845-43628867 TGGGAATTTATTTTAACTGCTGG + Intronic
1108180455 13:47835282-47835304 TGGGGATATTTTTTAAGTACTGG + Intergenic
1108371442 13:49773539-49773561 TTACAATTTTTTTTAATTACAGG - Intronic
1108831558 13:54485848-54485870 TCAGAAGTTATTTTAATTACAGG - Intergenic
1109877357 13:68423172-68423194 TCAGAATTTCTGTTAATTCCTGG + Intergenic
1110472689 13:75877699-75877721 TGTGAATTTCTTGAAATCACTGG + Intronic
1111653505 13:91123743-91123765 TGGGAAGTTATTTTAATTCAGGG - Intergenic
1113412993 13:110106787-110106809 TGGGAATTGCTTTGAATTTCAGG + Intergenic
1114241520 14:20872978-20873000 TGGGAATTTCGTTGAATGATGGG - Intergenic
1114856341 14:26448963-26448985 TACGTATTTTTTTTAATTACAGG - Exonic
1115033362 14:28826697-28826719 TAAGATTTTCTTTTTATTACTGG + Intergenic
1115100498 14:29692493-29692515 AAGGAATTGCTTTTATTTACAGG + Intronic
1116367169 14:44082079-44082101 TGGGCATCACTTTTAAATACTGG + Intergenic
1118423331 14:65632564-65632586 TGGGATTTTTTTTTTCTTACTGG + Intronic
1119338175 14:73852125-73852147 TGGGGTTTTTTTTGAATTACTGG + Intronic
1119632553 14:76246132-76246154 GGGGAATTTTTTTTAATCACAGG + Intronic
1120518480 14:85498389-85498411 TGGGATTTTCTGTCAACTACTGG - Intergenic
1121774999 14:96584615-96584637 TGAGCATTCCTTCTAATTACAGG - Intergenic
1122536752 14:102470250-102470272 TGGGAAGTTTTTTTGACTACTGG + Intronic
1122842004 14:104470227-104470249 AGGGAATTTTTTCTAATTAGAGG + Intergenic
1202841881 14_GL000009v2_random:128809-128831 TGGGGGTTTCTTTTTATCACAGG - Intergenic
1202911274 14_GL000194v1_random:119052-119074 TGGGGGTTTCTTTTTATCACAGG - Intergenic
1123458094 15:20444073-20444095 TGGGAGCTTATTTAAATTACAGG + Intergenic
1123659974 15:22556336-22556358 TGGGAGCTTATTTAAATTACAGG - Intergenic
1124147192 15:27138836-27138858 TGGGAACTTTTCTTAATTCCTGG + Intronic
1124313835 15:28650831-28650853 TGGGAGCTTATTTAAATTACAGG - Intergenic
1125149258 15:36512844-36512866 TGGGAACATTTTTTATTTACTGG - Intergenic
1126374225 15:47978833-47978855 TTGGAGTTTCTTATAATTTCTGG - Intergenic
1126532490 15:49726297-49726319 TGTGAATTTTTTTTTATTAATGG - Intergenic
1127227575 15:56949276-56949298 TGGTAACTTTTTTTAATTACTGG - Intronic
1127512805 15:59658919-59658941 TGAGATTTTTTTTTAATTAATGG - Intergenic
1127643823 15:60940324-60940346 TTATAATTTCTTTTTATTACTGG - Intronic
1128903135 15:71443408-71443430 TCTGTTTTTCTTTTAATTACAGG - Intronic
1130864637 15:87922030-87922052 TGGGAATCTCATTTAATAAGTGG - Intronic
1131645480 15:94337446-94337468 TGGCAATTTCATTTAATTAAAGG + Intronic
1132137421 15:99355557-99355579 TGGGTTTTTCTTGTTATTACAGG + Intronic
1133754879 16:8755016-8755038 CGAGAATTTCTGTTAGTTACTGG + Intronic
1134150386 16:11800271-11800293 TGGGTGTTTCTTTTAGTTACAGG + Intergenic
1134485505 16:14655261-14655283 TGTTAATTTTTTTTAATTTCAGG + Intronic
1135806245 16:25545485-25545507 TGGGAAATTCTTCTTACTACCGG + Intergenic
1136619308 16:31417495-31417517 TTGGAATTTATTTTAATTTATGG + Intronic
1138310687 16:56021086-56021108 TGGGAATTTTATTCTATTACTGG + Intergenic
1138461665 16:57152070-57152092 TGGGATTTTATGGTAATTACGGG - Intergenic
1139015070 16:62679671-62679693 TTTTAATTTCCTTTAATTACAGG + Intergenic
1139893334 16:70268679-70268701 TGGGAATCTCTCTTACTGACAGG - Intronic
1140311043 16:73848624-73848646 TAGGAATTTTTTTAAATCACAGG + Intergenic
1140621787 16:76743336-76743358 TAGGGATTTCTTTGAATTCCAGG + Intergenic
1140662387 16:77199838-77199860 TGGGAATTACTGTTAATAAGGGG - Exonic
1141264467 16:82483733-82483755 TGAGATTTTCTTTTAATTTCAGG - Intergenic
1144456094 17:15419510-15419532 TTGAAATCTCTTTTAATTTCTGG - Intergenic
1146415916 17:32632774-32632796 TGGGAATTTATTGTAATTTTTGG + Intronic
1149624418 17:58070005-58070027 TGGGATTTCCTTTTATTCACAGG + Intergenic
1150045861 17:61912762-61912784 TAAGATTTTCTTTTTATTACTGG - Intronic
1150054632 17:62002537-62002559 ATGGAATTTATTTTAATGACAGG + Intronic
1150884983 17:69074595-69074617 TGGGTATTCCTTTTGATTCCAGG + Intergenic
1153347808 18:4047193-4047215 TGAGAATTTCTTGTAAAGACAGG - Intronic
1156020671 18:32596136-32596158 TGTGAATGTCTTTCAATTCCAGG - Intergenic
1156329600 18:36107283-36107305 GAGGAAGTTCTTTTAATAACTGG - Intergenic
1156719661 18:40054461-40054483 TGGAAATTTTTTTTAATGTCTGG + Intergenic
1156928981 18:42618061-42618083 TTGGAATTTCTTTTAATGGTGGG - Intergenic
1158069609 18:53455206-53455228 TGGGCATGTCTTTTAACCACGGG + Intronic
1158376273 18:56872974-56872996 TGGAAATATCTTTAAATTATTGG - Intronic
1158437059 18:57441127-57441149 TGGGCATTTATTTTTATTCCAGG + Intronic
1158555240 18:58469670-58469692 TTTGAATTTCATTCAATTACTGG - Intergenic
1159095295 18:63894909-63894931 TGTGACTTTCTTTAAAATACTGG + Intronic
1159131728 18:64287533-64287555 TGGTCATAACTTTTAATTACAGG + Intergenic
1162610351 19:11745171-11745193 TGAGGAGTTCTTTTATTTACTGG + Intergenic
1165002261 19:32774650-32774672 TCAGATTTTCTTTTGATTACTGG + Intronic
1165711432 19:38013769-38013791 TGGGCATTTGTTTTATTTCCAGG - Intronic
1166277901 19:41767969-41767991 TGGGAATCTCTTATAATTTTTGG - Intronic
925930251 2:8701429-8701451 TGGGGAATTCTTTTAATTACTGG + Intergenic
926203615 2:10819254-10819276 TGGGAGTTTCCTCTACTTACCGG + Exonic
927008590 2:18878696-18878718 TGGGACTTTCATCTAATTATAGG - Intergenic
927300379 2:21505466-21505488 GGGGAATTGCTTTTAACAACAGG + Intergenic
927858028 2:26539361-26539383 TTGGTATTTTTTTTAATTAATGG - Intronic
928039231 2:27857583-27857605 TGGAAACTTCTTGTAATAACCGG - Intronic
929216490 2:39419534-39419556 TGGAGGTTTCTGTTAATTACTGG - Intronic
930932739 2:56907249-56907271 TTGGAATTGCTATTAATTCCTGG + Intergenic
931455841 2:62409293-62409315 TGGGAATTTCTTTGACTTGAGGG - Intergenic
933742216 2:85543139-85543161 TGGGAATATATTTTAATTCCTGG + Intronic
937503480 2:122509785-122509807 TGGGCATTTCTTTTTACTAGTGG - Intergenic
937770567 2:125715972-125715994 TGGGAATATTTTTTGATTGCTGG - Intergenic
937862501 2:126722096-126722118 TGGGATTTTTTGTTCATTACTGG - Intergenic
938202635 2:129387780-129387802 TGGGACTCTCATTTAGTTACTGG + Intergenic
940071477 2:149692923-149692945 TAGGAATTTCTTTGACTTTCTGG + Intergenic
940137038 2:150448827-150448849 TAGTAATTTCTTATAATTCCAGG - Intergenic
940889910 2:159025449-159025471 TGGGATTTGCTTTAAATTGCTGG - Intronic
941295606 2:163735734-163735756 TGAAGATCTCTTTTAATTACAGG + Intronic
942032761 2:171979498-171979520 TGAGAATTTTTATAAATTACTGG - Intronic
942873399 2:180763588-180763610 TGGGTATCTCTTTTATTTTCTGG - Intergenic
942898363 2:181085586-181085608 TATGAATTTGTTTTAATTAAGGG - Intergenic
944591967 2:201226162-201226184 TGGTATTTCCTTTTAATTACTGG - Intronic
945696302 2:213109666-213109688 TAGGAATTTATTTTCATTAGTGG - Intronic
945865847 2:215174640-215174662 TGGGCATTTCTATAAGTTACTGG + Intergenic
946791753 2:223307999-223308021 TGAAAATTTCCTTTAATTACTGG - Intergenic
947564411 2:231185087-231185109 TGGGAATTTCCTTTTAGGACAGG + Intergenic
948052467 2:234988876-234988898 TGGAAATTTTATGTAATTACAGG + Intronic
948281286 2:236749718-236749740 TGGGAATTCCTTTTGCTTCCGGG - Intergenic
1171998410 20:31751686-31751708 TTGGAATTGCTTTTGACTACAGG + Intronic
1174224768 20:48988469-48988491 TTTTAATTTTTTTTAATTACAGG + Exonic
1174745835 20:53061616-53061638 TGGAACTTTCTTTTACTGACAGG + Intronic
1176630625 21:9133719-9133741 TGGGGGTTTCTTTTTATCACAGG - Intergenic
1178452511 21:32716459-32716481 TGGGAACATCTTTAAAGTACTGG - Intronic
1179558559 21:42196482-42196504 TGAGATTTTTTTTTAAATACAGG - Intergenic
1183357188 22:37365995-37366017 TGGGGTTTTCTTTTAAGTAATGG + Intergenic
1184985948 22:48134291-48134313 TGGTGATTCCTTTTAATGACGGG - Intergenic
949869355 3:8574595-8574617 TATTAATTTTTTTTAATTACTGG + Intergenic
949908414 3:8879107-8879129 TGGGAGTTCCTTTACATTACAGG + Exonic
951459281 3:22931954-22931976 TGAGAAATTCTCTTAATTAATGG - Intergenic
952206721 3:31187724-31187746 AGGAATTTTTTTTTAATTACAGG + Intergenic
952688921 3:36180848-36180870 TGGGAATATTTTGTAATTTCTGG - Intergenic
953780499 3:45865610-45865632 TTGGATTTTCTTTTTATAACAGG + Intronic
955785442 3:62533077-62533099 AGAGACTTTCTTTTAAATACAGG + Intronic
956424578 3:69119985-69120007 TGAGCTTTTCTTTTAAATACTGG + Exonic
957908507 3:86589975-86589997 TGAGAATTTATTTTTATTTCAGG + Intergenic
958253892 3:91302206-91302228 TGGGAATTACATTTAAATATGGG + Intergenic
959405243 3:105953542-105953564 TGGGATTTTGTTGTAATTATAGG + Intergenic
959445426 3:106433489-106433511 TGGGAATTTTTTTTCTTGACGGG - Intergenic
960267788 3:115640628-115640650 TTGGAATGTCGTATAATTACTGG - Intronic
961982492 3:131095591-131095613 TGGGAATTTCATATAATTTCTGG + Intronic
962114693 3:132491422-132491444 TGGGCATAGCTTTTAATTAGTGG - Intronic
962494744 3:135927753-135927775 AGGGAATTTCTTTTAATGGCAGG + Intergenic
963533596 3:146500772-146500794 TGAGATTTTCTTTTAATGAACGG - Intergenic
964020591 3:152005621-152005643 TTGTAATTTCTTTTCATTACTGG - Intergenic
964417637 3:156464570-156464592 AGGGAATTTTTTTTAATTAGAGG + Intronic
964471232 3:157058223-157058245 TGTTTATTTCTTTTAATCACTGG - Intergenic
964669757 3:159212008-159212030 TGGGATTTTATTTTAAATTCAGG - Intronic
965520483 3:169664534-169664556 TTGAAATTTCCTTTAATTACAGG + Intergenic
965786997 3:172345884-172345906 TAGGTATTTCTTCTAGTTACCGG - Intronic
966656279 3:182361859-182361881 AGTGAATTTCTTGTCATTACAGG + Intergenic
967678291 3:192327453-192327475 TGAGAATTTTTTTTAACTAAAGG - Intronic
969945990 4:10783578-10783600 TGGGAAAGTCATTTATTTACAGG + Intergenic
971918645 4:32909168-32909190 TGAGATTTTTTTTTACTTACTGG - Intergenic
972057115 4:34816726-34816748 TTGGAATTTCTTTTCTTTAAGGG - Intergenic
972720172 4:41688454-41688476 TAGAAATTTCATTTAACTACTGG + Intronic
973054567 4:45640004-45640026 TGGTATTTTCTTTTAATTAGGGG + Intergenic
974644924 4:64677191-64677213 TGGGACTTTAATTTAGTTACAGG + Intergenic
975059216 4:69976973-69976995 TTGGAATTTCTTTTCTTTAAGGG + Intergenic
976074978 4:81287628-81287650 TAGGAACTTCTTTTAATAAGAGG + Intergenic
976341050 4:83944955-83944977 TTGCAATTTATTTTAATTAGTGG + Intergenic
976381368 4:84403185-84403207 TAGTAATTTCTTTAAAGTACAGG - Intergenic
977010285 4:91626137-91626159 TTGGAGTTTCATTTAATTTCGGG - Intergenic
977146331 4:93445351-93445373 TGGGCATTTCTTTTACCTGCAGG + Intronic
978065183 4:104389858-104389880 TGGGAATTTTTTTTTATAAAAGG + Intergenic
978119028 4:105056105-105056127 TGGTAATTTTTTTAAATTGCTGG + Intergenic
979348090 4:119612596-119612618 TGGGTATTTCTTTAAATCAATGG + Intronic
980848213 4:138349720-138349742 TGGGACTTTTTTTTTTTTACTGG - Intergenic
981339909 4:143609628-143609650 TAGAATTTTTTTTTAATTACAGG - Intronic
982363758 4:154552177-154552199 TGGGAATATGTTTTATTTTCTGG + Intergenic
984312403 4:178079193-178079215 AGGGAAATTATTTTAATTGCTGG + Intergenic
984546993 4:181118169-181118191 TGAGAATTTCTTATAACTAAGGG - Intergenic
984662142 4:182385773-182385795 TGAGAATTTCTTAAAACTACTGG + Intronic
984987629 4:185346780-185346802 TGGGTGTTTTTTTTAATTAAAGG + Intronic
984988983 4:185359671-185359693 TGGGAATTTCTTTTAATTACAGG - Intronic
986353978 5:6906154-6906176 TTGGAATTCCCTTTAATGACGGG - Intergenic
986374886 5:7120530-7120552 AGGAAATTTCTTTCTATTACTGG - Intergenic
987649492 5:20721775-20721797 TGCTAATTTCTTTTAATTTTGGG + Intergenic
987722336 5:21653967-21653989 TGTGGATTTCTTTGAATAACAGG + Intergenic
988081698 5:26423562-26423584 TCAGAATTTTATTTAATTACAGG - Intergenic
988398606 5:30731274-30731296 TGAGAAATTCTTTTCTTTACAGG + Intergenic
988731218 5:33974842-33974864 TGGGTAATTCTATTAATTTCAGG + Intronic
988746065 5:34139754-34139776 TGCTAATTTCTTTTAATTTTGGG - Intergenic
989502239 5:42181037-42181059 TCTTGATTTCTTTTAATTACTGG - Intergenic
991135251 5:63175535-63175557 AATGAATTTCCTTTAATTACAGG + Intergenic
992061120 5:73048593-73048615 AGGTAATTTCTAATAATTACAGG + Intronic
992538342 5:77735911-77735933 AGGGGATTTCTTTTAAATAGAGG - Intronic
992667956 5:79029931-79029953 GGGGAGTTTCTTTTAATTACTGG - Exonic
992910972 5:81395536-81395558 TGGGAAGTTTATTAAATTACTGG + Intergenic
994702648 5:103156222-103156244 TAGGAATTCCTTTTAACTGCGGG + Intronic
995780855 5:115773948-115773970 AAAGAATTTTTTTTAATTACTGG - Intergenic
996913940 5:128688812-128688834 CGGGAATTTTTTTTAATTAATGG - Intronic
996951203 5:129127970-129127992 TGGGAATTTTGTTTAACTACAGG - Intergenic
1000134643 5:158335644-158335666 TTGGAATTTCTTTTCTTTAAGGG + Intergenic
1000423164 5:161060562-161060584 TGGGATTTTCATCTAATTATAGG + Intergenic
1000693793 5:164355061-164355083 TGGGCAATTCTTCTAATCACAGG - Intergenic
1001339903 5:170833709-170833731 AGGGAATTTATTTTATTTAAGGG + Intergenic
1004197958 6:13522493-13522515 TGGGATTTGCTTTAAAATACTGG + Intergenic
1004984732 6:21068368-21068390 TTGGAATTTATTTTAATTTAAGG + Intronic
1005544222 6:26847979-26848001 TGCTAATTTCTTTTAATTTTGGG - Intergenic
1008374832 6:50779626-50779648 TGGCAATTTTTTTTAAATAAAGG + Intergenic
1008803555 6:55400145-55400167 TGTGAGTTTTTTTTAATTAAAGG - Intronic
1009015007 6:57889606-57889628 TGCTAATTTCTTTTAATTTTGGG - Intergenic
1009190597 6:60624833-60624855 TGGGAATTGCATTTAAATATAGG - Intergenic
1009325236 6:62340619-62340641 TTGGAATTTCTTTTCTTTAATGG - Intergenic
1010057979 6:71587594-71587616 TGAAAATTTCTTATAATTAAAGG - Intergenic
1010616541 6:78019920-78019942 TGGGAATTTCTTTTTTTTTAAGG - Intergenic
1010642523 6:78346665-78346687 TTTGAATTTCCTTAAATTACTGG - Intergenic
1011797396 6:90971680-90971702 TGGAAACTTGTTTTAATTAGTGG - Intergenic
1012837164 6:104283749-104283771 TGGCAATTTCTTTTGAATGCTGG - Intergenic
1013569067 6:111402231-111402253 TGGGAATCTCTTTTAGTCCCAGG + Intronic
1014909458 6:127073006-127073028 GGGGAATTTCTATAAATTAATGG - Intergenic
1016107937 6:140185929-140185951 TTGGAATTTCTTTTCCTTAAGGG - Intergenic
1016441246 6:144085734-144085756 TGGCTAATTCTTTTTATTACTGG - Intergenic
1017611180 6:156188027-156188049 TTGGAATTTCTGTTAATGATAGG - Intergenic
1017756377 6:157532578-157532600 TGGGTATTTATTTAAAGTACAGG - Intronic
1018199332 6:161380642-161380664 TGTGAATTTCTTATAATTAGTGG - Intronic
1018506667 6:164477639-164477661 TAGGAATTTCATGTAATTTCTGG + Intergenic
1018854483 6:167665878-167665900 TGAGAAATTCTTTAAATTACAGG - Intergenic
1021529341 7:21626168-21626190 TGGGAATTTTTTTTAAAAAGCGG - Intronic
1021780295 7:24099168-24099190 TGAGAATTTCTTTATATTAGGGG + Intergenic
1021831304 7:24614084-24614106 TGGGAATTTATTCAAAGTACAGG - Intronic
1022085729 7:27065703-27065725 TAGGGATTTTTTTAAATTACGGG - Intergenic
1023124959 7:36946274-36946296 TGGAAATTTCCTTTATTGACAGG - Intronic
1024781647 7:52857652-52857674 AGAGAATTTCTTTTAATCATGGG - Intergenic
1025183435 7:56837376-56837398 TGGGAGTATCTTTTAAGGACAGG - Intergenic
1025688490 7:63739591-63739613 TGGGAGTATCTTTTAAGGACAGG + Intergenic
1025911601 7:65833087-65833109 TGGGAGTATCTTTTAAGGACAGG + Intergenic
1027901052 7:84115497-84115519 TGTGATTTTCTTTTATTTAAAGG + Intronic
1027990811 7:85358729-85358751 TTGTAATTTCTTTTAATGAGAGG + Intergenic
1028184366 7:87764948-87764970 GGGAGATTTTTTTTAATTACTGG + Intronic
1028274547 7:88838049-88838071 TGGGATTTTCAATTAATTTCAGG + Intronic
1029917779 7:104230173-104230195 TGTGAATATGTTTTAATTTCAGG + Intergenic
1030854909 7:114543367-114543389 TGGAAATTTTTTTTAATTTGAGG - Intronic
1031459580 7:122030290-122030312 TGGTAATTTCTTTTATTAATTGG - Intronic
1031843942 7:126781647-126781669 TAAGCATTTCTATTAATTACAGG - Intronic
1033634245 7:143194717-143194739 TGGGAATTTCTTTTTCTGGCTGG + Intergenic
1035018048 7:155783442-155783464 TGGGGCTTTCTTTGAATTAAGGG + Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035204544 7:157286477-157286499 TGAGAATTTCTGATAATTCCCGG - Intergenic
1035260406 7:157658407-157658429 TGAGAGTTTCCTTTAAATACGGG - Intronic
1037847898 8:22300345-22300367 TGTTCATTCCTTTTAATTACTGG + Intronic
1039542705 8:38384625-38384647 TGGCAATTTCTTTGACTTTCAGG - Intergenic
1039635400 8:39159273-39159295 TAGAGATTTCTTTAAATTACTGG + Intronic
1040764845 8:50895354-50895376 TGGAAGTTTCTATAAATTACAGG + Intergenic
1041344600 8:56883704-56883726 TGGGCATTTCTTTTTTTTGCTGG - Intergenic
1042298670 8:67251537-67251559 TTAGGATTACTTTTAATTACTGG - Intronic
1042921800 8:73927470-73927492 GGAGAATTTCTTTTAGATACTGG - Intergenic
1043326916 8:79063490-79063512 TTGGAATGTCTTTTTATTCCCGG - Intergenic
1044344473 8:91089333-91089355 TGGCAATTTCTGTTAATTTTTGG + Intergenic
1045131309 8:99157182-99157204 GGGAAATTTATTTTAAATACAGG + Intronic
1045950635 8:107848181-107848203 AGGGAATCTCTTTTTATGACGGG - Intergenic
1046313691 8:112473044-112473066 TGGGAAATTGTTTTACTTGCTGG + Intronic
1046419569 8:113961730-113961752 TGGTAATTTCTGGTATTTACTGG + Intergenic
1046758369 8:117994646-117994668 TGGTCATTTCTTTTAAATATAGG - Intronic
1047632662 8:126725405-126725427 TGAGATTATCTTTTAATTGCAGG - Intergenic
1049033286 8:140052982-140053004 TGGGTATTTGTTTTATTTAATGG - Intronic
1050703864 9:8372761-8372783 TTAGAATTTCTTTTACTTAATGG + Intronic
1050736848 9:8773658-8773680 TTGGAATTTATTTTAATGATGGG - Intronic
1051084010 9:13326446-13326468 TGACAATTTTTTTTAAGTACAGG + Intergenic
1052076988 9:24155271-24155293 TGGGAATTTCTTTCAGGTAAAGG + Intergenic
1054925761 9:70587397-70587419 TGCGACTTTCATTTATTTACAGG - Intronic
1055798781 9:80007784-80007806 AAGGAATTTCTTTTGATTAGAGG - Intergenic
1057628154 9:96696734-96696756 TAGGAATTTTTTTTTAATACAGG - Intergenic
1057839506 9:98474466-98474488 TGGGTATTTTGTTTACTTACGGG - Intronic
1058728090 9:107822993-107823015 TGGGACTTTCTGTTATTTTCAGG - Intergenic
1059559929 9:115324321-115324343 TGGGACCTTCTTTGAATTCCAGG + Intronic
1059611350 9:115900427-115900449 TGTGAATTTCTTGGAATTCCAGG - Intergenic
1186735629 X:12460712-12460734 TGGGGATTTTTTTTAAGTAAAGG + Intronic
1187126002 X:16454994-16455016 TTGCAATTGTTTTTAATTACTGG - Intergenic
1189018847 X:37313471-37313493 TGGGAATATCTTCTAATCACCGG + Intergenic
1189183522 X:39029263-39029285 TGGGAATTTCTGTTATGTAGAGG + Intergenic
1192021699 X:67399689-67399711 TGGCAATTTTTTTCTATTACTGG + Intergenic
1193197497 X:78650888-78650910 TGGGAATTCCTTTAATTTACTGG + Intergenic
1193773332 X:85613982-85614004 TGGGAATTGCTTTGGATTTCAGG + Intergenic
1194957868 X:100202145-100202167 TGGGATTTTCATTGAACTACTGG - Intergenic
1195693406 X:107648274-107648296 GGGGAATTACTTTAAAATACTGG - Intronic
1195887225 X:109651931-109651953 TGGCAATTTATTCTATTTACAGG - Intronic
1195940270 X:110161941-110161963 TGAGAATTTTTATTAATAACAGG - Intronic
1196392183 X:115219353-115219375 TGTAAATTGCTTTTAATTTCAGG - Intronic
1198071440 X:133152318-133152340 TGGGAATTTTTTTAAAATACAGG + Intergenic
1198391878 X:136183656-136183678 TGGAAATATCATTTAATTAAGGG - Intronic
1198793429 X:140370608-140370630 TGTGAATTTCTTTTACTAAAAGG + Intergenic
1198989485 X:142495025-142495047 TGGGAAAGTCTTTTATTTCCTGG + Intergenic
1199438116 X:147836982-147837004 TGGGAATTTCTTATAATTTCTGG + Intergenic
1199826005 X:151500219-151500241 TAGGAATTACTTTTTATTCCTGG - Intergenic
1200288674 X:154849825-154849847 TGTGTATTTCTATTACTTACTGG + Intronic