ID: 984989387

View in Genome Browser
Species Human (GRCh38)
Location 4:185364239-185364261
Sequence ATGGGGGAGCGGAAAGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1007
Summary {0: 1, 1: 0, 2: 8, 3: 95, 4: 903}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984989377_984989387 2 Left 984989377 4:185364214-185364236 CCCTTGGAGTATGGGCAGGGCCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG 0: 1
1: 0
2: 8
3: 95
4: 903
984989378_984989387 1 Left 984989378 4:185364215-185364237 CCTTGGAGTATGGGCAGGGCCGA 0: 1
1: 0
2: 0
3: 18
4: 143
Right 984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG 0: 1
1: 0
2: 8
3: 95
4: 903

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984989387 Original CRISPR ATGGGGGAGCGGAAAGAGGA GGG Exonic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900315116 1:2052458-2052480 AGGGGAGAGCGGGAAGAGGAGGG - Intronic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
900552692 1:3264584-3264606 CAGGAGGAGCGGAAAGGGGAGGG + Intronic
900977601 1:6026968-6026990 AAGGGGGAGGGGAGAGAGGAGGG - Intronic
901195715 1:7438757-7438779 CTGGTGGAGCAGAAAGAGCATGG + Intronic
901325598 1:8363460-8363482 AAGGGGCAGAGGAAAGTGGATGG + Intronic
901552484 1:10005890-10005912 ATCGGGGAGAGGGAGGAGGAAGG - Intronic
901770976 1:11530246-11530268 AAGGGGGAGGGCAAGGAGGAGGG - Intronic
902304646 1:15526843-15526865 CCTGGGGAGGGGAAAGAGGAGGG - Exonic
902383774 1:16065053-16065075 AGCGGGCAGCGGAAACAGGAAGG - Intronic
902501078 1:16912251-16912273 ATGGTAGAGAGGAAAGAGCATGG + Intronic
902813722 1:18904210-18904232 TTGGGGGAGGGGTAGGAGGACGG - Intronic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
903189268 1:21647708-21647730 CTGGGGTAGGGGAAAGAGCATGG - Intronic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903297886 1:22356992-22357014 CTTGGGGAGTGGAAAGATGACGG - Intergenic
904045765 1:27607376-27607398 ACGGGGGAGGGGAAAGGGGCTGG - Intergenic
904086973 1:27916196-27916218 ATGGGTGGGAGGAAAGGGGAGGG - Intergenic
904190358 1:28737997-28738019 ATGGGGGAGGGGAAGCGGGAGGG + Intronic
905294775 1:36947290-36947312 ATGGGGGCAGGGCAAGAGGAGGG - Intronic
905352118 1:37355089-37355111 AGGAGGGAGGGAAAAGAGGAAGG + Intergenic
905406149 1:37733725-37733747 TTGGGGGAGAGGAATGAGAAGGG - Intronic
905647034 1:39632259-39632281 GTGGGGGAGGGGACAGAAGAAGG - Intronic
905857037 1:41321024-41321046 ATGGGAAGGCGGACAGAGGAGGG - Intergenic
906090250 1:43172561-43172583 CCGGGGGAGGGGAAAGGGGAGGG + Exonic
906290524 1:44616922-44616944 GTGGGGGTGTGGAAAAAGGAAGG - Intronic
906567395 1:46810944-46810966 GTGGGGGTGAGGAGAGAGGATGG + Exonic
907537040 1:55172125-55172147 ATCGGGGAGAGGTAAGAGAAAGG + Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908721546 1:67131614-67131636 ATGGTGGAACAGAAAGGGGAAGG - Intronic
909005051 1:70265888-70265910 ATGGAGGGAGGGAAAGAGGACGG + Intronic
909094618 1:71271533-71271555 ATGGGGGAGGGAAAAGACCAAGG - Intergenic
909474393 1:76065672-76065694 ATGTGGGACCAGAAAGAGGCGGG + Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
911729678 1:101279828-101279850 CTCGGGGGGCTGAAAGAGGAAGG + Intergenic
912041469 1:105396691-105396713 ATGGGGAATTGGAAAGGGGATGG + Intergenic
912160983 1:106984971-106984993 ATGAGGGTGAGGAGAGAGGAGGG - Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912664938 1:111570481-111570503 GTGGGGGAGCAGGCAGAGGAGGG + Intronic
912947379 1:114096287-114096309 CTGGGGGAGCTGAGAGATGAGGG + Intronic
913061858 1:115216133-115216155 TTGGGGGAGGGGAAAGCTGAGGG + Intergenic
913185210 1:116364472-116364494 ATGGTGCAGTGGAAAGAGAAGGG + Intergenic
913484466 1:119321167-119321189 ATAGGGGAGCAGAAAGAGACTGG - Intergenic
913519536 1:119631868-119631890 AGGGGGGCGTGGGAAGAGGAGGG - Intronic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914756101 1:150562343-150562365 ATGGGCGGGCAGAAAGAGAAAGG - Intergenic
914960105 1:152197504-152197526 AGGGGGAAGGGGAAAAAGGAAGG - Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915120683 1:153628205-153628227 ATGGTGCAGGGGAAAGAGGTGGG - Intronic
915440905 1:155944967-155944989 GTGGGGGAGTGGAACGAGGAGGG + Intergenic
915460998 1:156070600-156070622 ATGGTGGGGAGGACAGAGGAAGG - Intergenic
915736808 1:158090371-158090393 GTGGGGGAGAGGAGAAAGGAGGG - Intronic
915949890 1:160182071-160182093 ACGGGGGAGCATACAGAGGAAGG + Intronic
916280856 1:163049560-163049582 CTGGGAGTGCGGTAAGAGGATGG - Intergenic
916332085 1:163628360-163628382 AGGGGGGATGGGGAAGAGGATGG - Intergenic
916614203 1:166422859-166422881 ATGGGGGAGCCAGAAGGGGATGG - Intergenic
916691089 1:167190629-167190651 ATGGGGGAATGGTAAAAGGAAGG - Intergenic
917211022 1:172632100-172632122 ATGGGGAACTGGAAAGGGGATGG - Intergenic
917657294 1:177138970-177138992 ATGGCGGAGTGGAAAGAGCATGG - Intronic
918014048 1:180615660-180615682 ATGGTCGAGCCAAAAGAGGAGGG - Intergenic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
918149953 1:181789817-181789839 ATGGTGGTGAGAAAAGAGGATGG - Intronic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919705456 1:200670563-200670585 ATGGGGGAGAGGAGACAGCACGG + Intergenic
919733715 1:200931001-200931023 GTGAGGGAGAGGAAAGAGCAAGG - Intergenic
919758754 1:201083323-201083345 CTGAGGGAGGGGACAGAGGATGG + Intronic
919780190 1:201216419-201216441 AGAGAGGAGCGGGAAGAGGAGGG - Intronic
920123867 1:203678095-203678117 ATGGGAGAAAGGAAACAGGAGGG - Intronic
920318228 1:205095618-205095640 ATGTGAGAGCAGAAAGAGAATGG + Intronic
920386866 1:205575713-205575735 AAGTGGGAGAGGGAAGAGGAAGG - Intronic
920567513 1:206986680-206986702 AAGGGAGAGAGGAAAGAAGAAGG - Intergenic
920706294 1:208252977-208252999 ATGGGGGTGGGGAGAGGGGAGGG - Intergenic
921225335 1:213014030-213014052 TTGGGGGAAATGAAAGAGGATGG + Intronic
921289598 1:213645190-213645212 ATGACGGAGCAGAAAGAGGTGGG + Intergenic
921685995 1:218089789-218089811 ATGGTGGAGTGGAGAGAGGAGGG - Intergenic
923081852 1:230665187-230665209 ATGGTGCAGTGGAAAGAGCATGG + Intronic
923127764 1:231047329-231047351 AGGAGGAAGGGGAAAGAGGAGGG - Intergenic
923482446 1:234397454-234397476 ATGGGGGAGGGGAAGGAGGGAGG + Intronic
923534495 1:234838314-234838336 CAGGGGGAGGGGAAAGAAGAAGG + Intergenic
923625046 1:235606850-235606872 ATGGGGGGGCGAGCAGAGGAAGG + Intronic
923736985 1:236619505-236619527 AAGGGCAAGCGGAGAGAGGAAGG + Intergenic
924247751 1:242101402-242101424 ATGGGGCAGCTGAAAGAAGGGGG + Intronic
924315643 1:242792606-242792628 ATTAGGGAGCGGAAGGTGGAAGG - Intergenic
924628755 1:245717119-245717141 AGGGAGGAGAGAAAAGAGGAGGG + Intergenic
1063446514 10:6121332-6121354 ATCCGGGAGCGGGAAGATGAGGG + Intergenic
1063812800 10:9733124-9733146 GTGGGGGAGAGAAGAGAGGATGG + Intergenic
1063877859 10:10498639-10498661 ATGGGGAAGAGGCTAGAGGAAGG - Intergenic
1064346016 10:14533590-14533612 ATGAGGGGACGGAAAGCGGAGGG - Intronic
1064600178 10:16985398-16985420 ATGGGGAACTGGAAAGGGGATGG - Intronic
1064735588 10:18378873-18378895 AGTTGGGAGCAGAAAGAGGAAGG - Intronic
1065229590 10:23583644-23583666 ATGGGTGTGGGGCAAGAGGAGGG - Intergenic
1065428161 10:25627345-25627367 AGGGTGGGGTGGAAAGAGGATGG - Intergenic
1065756735 10:28937433-28937455 ATGGGTGAGTGGATAGAGGTTGG - Intergenic
1065911955 10:30315187-30315209 ATTGGGGAGAGGAGAGAGAAAGG - Intronic
1066023395 10:31325648-31325670 ATGGGGGAGGGGAAGGGAGAGGG - Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1066480614 10:35792194-35792216 AGGGGGGAGTCAAAAGAGGAGGG + Intergenic
1066594833 10:37038893-37038915 GTGGGGTAGGGGAAAGGGGAAGG - Intergenic
1067174478 10:43933941-43933963 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1068099436 10:52533067-52533089 GTGGGGGAGAGGGAAGAAGAAGG - Intergenic
1068827266 10:61453475-61453497 ACGAGGGGGCGGAAAGAGGAGGG + Intergenic
1069058724 10:63871677-63871699 AAGAGTGAGAGGAAAGAGGATGG + Intergenic
1069060975 10:63894190-63894212 ATGGGAGAAGGGAAGGAGGAAGG - Intergenic
1069111794 10:64456727-64456749 ATGGGGGAGGGGGGAGGGGAGGG - Intergenic
1069635984 10:69925194-69925216 AGGCTGGAGGGGAAAGAGGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070645461 10:78199147-78199169 TTGGGGGGGCGGGAAGAGGAGGG - Intergenic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1071284809 10:84134572-84134594 ATGGGAGAGAGAGAAGAGGAGGG + Intergenic
1071371070 10:84952400-84952422 ATGGGGTGGTGGAGAGAGGAGGG + Intergenic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071709882 10:88039602-88039624 ATGGGGGAGAAGAAAACGGAGGG + Intergenic
1071865960 10:89732105-89732127 GTGGGGGAGCTGAGAGAGGGGGG - Intronic
1071915138 10:90286601-90286623 TTGGGGGAGAGAAAAGAGGGAGG + Intergenic
1072050574 10:91699396-91699418 ATGGGGCAGGGGAGAGAGGGAGG - Intergenic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1072783733 10:98267012-98267034 AAGGTGGAAGGGAAAGAGGAGGG + Intronic
1072807175 10:98430968-98430990 ATGGGTGAGCTGAAAAAGGTTGG + Intronic
1072811707 10:98467500-98467522 AAGGGGGAGAGAAAGGAGGAGGG + Intronic
1072902332 10:99419533-99419555 ATGGAAGAGGGGCAAGAGGAAGG - Intronic
1073131960 10:101195383-101195405 TTGGGAGTGAGGAAAGAGGAAGG - Intergenic
1073565045 10:104527878-104527900 AGGGCAGAGAGGAAAGAGGATGG - Intergenic
1073927248 10:108531303-108531325 ATGGGGTGGGGGAAAGGGGAGGG + Intergenic
1074673102 10:115818053-115818075 ATGGAGCAGCTAAAAGAGGAGGG - Intronic
1074827916 10:117228224-117228246 ATGGAGGAAGGGAAAGAGGGAGG - Intergenic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1075602181 10:123777789-123777811 ATGGGGGATGGGAGAGAGAAGGG - Intronic
1076003584 10:126930919-126930941 AAAGGGGAGCTGATAGAGGACGG + Intronic
1076318886 10:129564230-129564252 AGGGGGAAGGGGGAAGAGGAGGG - Intronic
1076811183 10:132887285-132887307 AGAGGGGAGAGGAAAGAAGAGGG - Intronic
1076811197 10:132887356-132887378 AGAGGGGAGAGGAAAGAAGAGGG - Intronic
1076811208 10:132887424-132887446 AGAGGGGAGAGGAAAGAAGAGGG - Intronic
1077304860 11:1864460-1864482 AGGGAGGAAGGGAAAGAGGAAGG + Intronic
1077375065 11:2201959-2201981 ATGGGGGAGGGAGAGGAGGAAGG - Intergenic
1077628928 11:3797695-3797717 AGGGGCGAGAGGGAAGAGGAGGG + Exonic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1077917683 11:6621960-6621982 ATGGGGGAGCGGTGAGAAGCTGG + Exonic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078576653 11:12508556-12508578 ATGGGGGTGGGGAAAGGGGTTGG - Intronic
1078800752 11:14642897-14642919 ATGGGGGAGCGGAGAGAACTAGG - Intronic
1079120528 11:17680935-17680957 ACAGGGGAGAGGAGAGAGGATGG - Intergenic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1079745679 11:24125830-24125852 ATGAGGGAGCAGAAAGATGAAGG + Intergenic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1081121907 11:39277286-39277308 ATGGGGCTGTGGAAATAGGAAGG - Intergenic
1081207583 11:40293326-40293348 GTGGGGGCGGGGACAGAGGAAGG - Exonic
1081395910 11:42586058-42586080 ATGGTGGAAGGCAAAGAGGAAGG + Intergenic
1081670620 11:44940231-44940253 ATGGGGAGGCTGGAAGAGGAAGG - Intronic
1082833638 11:57637656-57637678 GTGGGGGAGCCCAGAGAGGAAGG - Intergenic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083655561 11:64227516-64227538 ATGGGGCAGGGGGAAGAGGTGGG + Intronic
1083728760 11:64642332-64642354 ATGGGGGAGAGGAGAGATGGAGG + Intronic
1083887277 11:65579055-65579077 CTGGGGGAGGGGGAAGGGGAGGG - Intronic
1084389514 11:68865893-68865915 AGGAGGGAGGGGAAAGGGGAGGG - Intergenic
1084949590 11:72657327-72657349 TGGGAGGAGGGGAAAGAGGAGGG + Intronic
1085547352 11:77332324-77332346 AAGGGGGAGAGGGAAGAGGGGGG + Intronic
1085688739 11:78648844-78648866 ATGAGGGAGAGGAAATAGGGAGG - Intergenic
1086017668 11:82186528-82186550 ATGGGGTAATGGAAAGAGCAGGG - Intergenic
1086195170 11:84129281-84129303 CTGGGGGAGCTTTAAGAGGATGG + Intronic
1086477843 11:87198561-87198583 AGAGGGGAGCGGAGAGGGGAGGG - Intronic
1086644187 11:89198902-89198924 ATGGGGTAGGGGTAAGGGGAAGG - Intronic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1087078090 11:94144212-94144234 ATGGGGGAGGGAGAAGAAGAGGG - Intronic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1087685483 11:101258284-101258306 ATGGGGGGGCGGAAAAGGGAGGG - Intergenic
1087875287 11:103348444-103348466 ATAGGGCAGAAGAAAGAGGAGGG - Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1089016067 11:115166460-115166482 ATGGGGCTGGGGAAGGAGGAGGG + Intergenic
1089116312 11:116097857-116097879 TTGGGGTTGGGGAAAGAGGAGGG + Intergenic
1089215008 11:116829950-116829972 TCTGGGGAGGGGAAAGAGGAGGG + Intronic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089500862 11:118930380-118930402 GTGTGGGTGGGGAAAGAGGAGGG + Intronic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1090136147 11:124201000-124201022 ATGGGGGAGCCAGAAGGGGATGG - Intergenic
1090703206 11:129314749-129314771 GTGGGGGAGGGGGAAGGGGAAGG - Intergenic
1090744196 11:129693657-129693679 AAGGGGGAGGGGAAAGGGAAGGG + Intergenic
1091285669 11:134407385-134407407 ATGGGGGAGTGGAGACATGACGG - Intronic
1091470287 12:720567-720589 ATGGTGGAGGGCAAAGGGGAAGG + Intergenic
1091565866 12:1647517-1647539 ATAGGGGAAGGGAAAGAGGCAGG - Intergenic
1091862998 12:3803644-3803666 ATGGGTGAGCTGAAGGAGTAAGG + Intronic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092322808 12:7496327-7496349 ATGGGTGGGGGGAAAGGGGAGGG + Intronic
1092360943 12:7836046-7836068 AGAAGGGAGAGGAAAGAGGAAGG - Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1092940235 12:13401282-13401304 GTGGGGGAGGGGAAAGATGCTGG + Intergenic
1092984337 12:13831092-13831114 GTGGGAGAGCGGAAGCAGGAAGG - Intronic
1093092466 12:14937080-14937102 ATGGGGAAGGGGCAAGAGCATGG - Intronic
1093156651 12:15693894-15693916 ATGGAGGTGGGGCAAGAGGAGGG + Intronic
1093749237 12:22779559-22779581 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1093751791 12:22808083-22808105 ATGGGGAACTGGAAACAGGATGG + Intergenic
1094555671 12:31497761-31497783 AAGGGGGAGCGGCATGGGGAGGG + Intronic
1094583105 12:31752421-31752443 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1095931472 12:47630131-47630153 AGGGGGTTGGGGAAAGAGGAGGG + Intergenic
1096199077 12:49668446-49668468 ATGGGGTTTGGGAAAGAGGAGGG - Intronic
1096403615 12:51326851-51326873 AAGGGGGAACTGAAAGGGGAAGG - Intergenic
1097015860 12:55986890-55986912 AGGGGGGAGGGGGAAGGGGAGGG - Exonic
1097046224 12:56189439-56189461 ATGGCGGTGCGGAAGAAGGACGG - Exonic
1097232454 12:57520887-57520909 GTGGGGGAGAGGAGAGAGGGCGG + Intronic
1097261919 12:57725284-57725306 ATTGGGGAGGGGAGAGAGGTGGG - Intronic
1097298323 12:57991198-57991220 AGGTGGGAGAGGAAAGAGCATGG + Intergenic
1097626636 12:62010163-62010185 ATGGGGGAGAGGGAGGGGGAGGG - Intronic
1098164833 12:67684417-67684439 TTGGGGGAGTGGGAAGAGGTAGG - Intergenic
1099509635 12:83517994-83518016 ATGGGAAATCGGAAAGGGGATGG - Intergenic
1100188109 12:92159563-92159585 ATGGGGGAGAGGAAAGGGTTAGG - Intergenic
1100214404 12:92432958-92432980 ATGGTGGAAGGCAAAGAGGAAGG + Intergenic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1100604889 12:96143529-96143551 AGGGCAGAGCAGAAAGAGGAAGG + Intergenic
1100680551 12:96915365-96915387 ATGGGGGAAGGGCTAGAGGAAGG + Intronic
1100728898 12:97441756-97441778 ATGGAGGAGAGGAGAGAGGGAGG + Intergenic
1100824102 12:98458553-98458575 TGGGGGGAGCGGAGAGGGGAGGG + Intergenic
1100829387 12:98503911-98503933 TTGGGGGAGGGGAGAGAGGGCGG + Intergenic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1101527647 12:105546233-105546255 GTGGGTGAGGGGAATGAGGAAGG + Intergenic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1101634196 12:106523729-106523751 ATGAGGGAGGGAGAAGAGGAAGG + Intronic
1101641161 12:106586586-106586608 AGATGGGAGCGGAAAGTGGATGG - Intronic
1101760110 12:107651460-107651482 ACGGGGGAGCGGGAGGGGGAGGG - Intronic
1102212627 12:111138361-111138383 GTGGGGGTGGGGAGAGAGGAGGG + Intronic
1102509442 12:113404092-113404114 AAGGGGAAGTGGAAAGAGGGAGG - Intronic
1102556049 12:113727295-113727317 AAGAGAGAGAGGAAAGAGGAAGG - Intergenic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1102852820 12:116266274-116266296 AAGGAGGAGAGGAAAGAGAAGGG + Intronic
1103425510 12:120830389-120830411 AAGGGGGAGGGGGAAGGGGAGGG + Intronic
1103425525 12:120830417-120830439 AAGGGGGAGGGGGAAGGGGAGGG + Intronic
1103425540 12:120830445-120830467 AAGGGGGAGGGGGAAGGGGAGGG + Intronic
1103425556 12:120830474-120830496 AAGGGGGAGGGGGAAGGGGAGGG + Intronic
1103794550 12:123494414-123494436 ATGGGGCAGGGAAGAGAGGAGGG - Intronic
1103867289 12:124063177-124063199 ATGGGGGAGTCGAAAGAGCAGGG + Intronic
1103893150 12:124254872-124254894 CTGTTGGAGCTGAAAGAGGAGGG + Intronic
1104061552 12:125272683-125272705 ATGGGGGAGCTAAAGGCGGAGGG + Intronic
1104463368 12:128971840-128971862 AGGGGGGAAGGGAGAGAGGAAGG - Intronic
1104616394 12:130273472-130273494 AAGGGGGAGGAGAAAGAGAAGGG - Intergenic
1104754193 12:131258621-131258643 ATGGGGAGTCGGAAAGCGGAAGG + Intergenic
1105002667 12:132701432-132701454 GAGGGGGGGAGGAAAGAGGAAGG - Intronic
1105073738 12:133255933-133255955 ATGGTGGAAGGCAAAGAGGAAGG + Intergenic
1105580352 13:21689940-21689962 ATGTGGGAGAGGTGAGAGGAAGG - Intronic
1105675080 13:22662340-22662362 TTCGGGGAGGGGACAGAGGACGG + Intergenic
1106235367 13:27856623-27856645 ATGGGGGAGCCAGAAGGGGATGG + Intergenic
1106269283 13:28138483-28138505 AAGGGGGAGGGGAGAGGGGAGGG - Intergenic
1106841147 13:33685997-33686019 ATGGGTCAGCAGAAAGAGGGTGG + Intergenic
1106882604 13:34148316-34148338 AGGGTGGAGTGGCAAGAGGATGG - Intergenic
1107610493 13:42107853-42107875 ATGGGGGAGCTGAGACAGAAGGG + Intronic
1107631715 13:42349864-42349886 AGGGGGCATTGGAAAGAGGATGG - Intergenic
1107855363 13:44610325-44610347 ATGAGAGAGAGGGAAGAGGAAGG + Intergenic
1109636462 13:65124452-65124474 AAGGGGAAGAGGAAACAGGAGGG - Intergenic
1109785201 13:67164847-67164869 ATTGGGTAGGGGCAAGAGGAGGG - Intronic
1110151008 13:72253205-72253227 TTGGGGTAGTGGTAAGAGGAAGG - Intergenic
1110270871 13:73588825-73588847 AAGGGGGAGGGGTAGGAGGAGGG + Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1110441033 13:75525324-75525346 ACAGGGAAGGGGAAAGAGGAAGG + Intronic
1110682961 13:78337722-78337744 ATGGGGGAGGGGGAGGGGGAAGG + Intergenic
1111204019 13:84980155-84980177 ATGGTGGAAGGCAAAGAGGAAGG + Intergenic
1111374091 13:87355156-87355178 CTGGGGGAGTGGGTAGAGGAAGG + Intergenic
1112541014 13:100313130-100313152 AGGGAGGAAAGGAAAGAGGAAGG - Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112724505 13:102286978-102287000 ATGGGGGAGGGGGAGGGGGAGGG + Intronic
1113055102 13:106259475-106259497 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1113089631 13:106603422-106603444 ATTTGGTAGCGGAAAGATGAGGG - Intergenic
1114261392 14:21039151-21039173 AAGGGGGAAGGGAGAGAGGAGGG - Intronic
1114288494 14:21268890-21268912 GTGGGGGAGGGGAAGGGGGAAGG - Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114525823 14:23366319-23366341 AGGAGGGAGGGGAAAGGGGAGGG + Intergenic
1115017552 14:28635262-28635284 AAGGGGCAGAGGAAAGAAGAAGG + Intergenic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1116928904 14:50670305-50670327 AGGCGGGAGCTGAAGGAGGAAGG + Intergenic
1117272238 14:54156816-54156838 ATGGGGGAGCAGTAAGACAAGGG - Intergenic
1117866923 14:60159755-60159777 CTGGGGGAGGGGAGATAGGAAGG - Intronic
1118012706 14:61626278-61626300 ATGAGTGAGAGGAGAGAGGATGG - Intronic
1119143939 14:72293479-72293501 GTGGGAAAGCGGAAAGGGGAGGG - Intronic
1119201478 14:72756027-72756049 ATGGAGGTGGGGAAGGAGGATGG + Intronic
1119439787 14:74620423-74620445 ATGGGGGAGAGGAAACTGGGTGG - Intergenic
1119625924 14:76175368-76175390 ATGGGGGAGGGGGAAGAAGGGGG - Intronic
1119977950 14:79046183-79046205 GGAGGGGAGGGGAAAGAGGAGGG - Intronic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1121734944 14:96211666-96211688 AAGGAGGAGCGGGAGGAGGAGGG - Intronic
1121788155 14:96678405-96678427 ATGGTGGAAGGCAAAGAGGAAGG - Intergenic
1122672047 14:103379848-103379870 CTTGGTGAGGGGAAAGAGGAGGG - Intergenic
1122782659 14:104150182-104150204 GTGGGGGAGGGGGATGAGGAGGG - Intronic
1122811663 14:104292298-104292320 GTGGGGCAGCTGAGAGAGGAAGG + Intergenic
1202871950 14_GL000225v1_random:173003-173025 GGGGGGGAGCAGAAAGAGGCTGG + Intergenic
1123539250 15:21271690-21271712 GTGGGGGAGAGGGAAGAGGAAGG - Intergenic
1124596892 15:31098750-31098772 CTGGGGGAGCAGACACAGGATGG + Intronic
1124620366 15:31270505-31270527 AGGAGGGATAGGAAAGAGGAAGG + Intergenic
1124658050 15:31524554-31524576 TTGGGGGAACGGAAGGAGGGAGG - Intronic
1125171380 15:36769992-36770014 ATGGGGGAGAGAAAAGAAAATGG - Intronic
1125599394 15:40907093-40907115 AGGGGGGGGCGGGAAGTGGAGGG - Intergenic
1126047874 15:44660776-44660798 AAAGGGAAGCGGGAAGAGGAGGG - Intronic
1127192308 15:56543403-56543425 AAGAGGGAAAGGAAAGAGGAGGG + Intergenic
1127706327 15:61550566-61550588 ATGAGGGAGGGGAAGGAGCAGGG - Intergenic
1128155340 15:65388505-65388527 ATGGGGGCGCGCACAGAGGTGGG - Exonic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129039098 15:72670476-72670498 ATGGGGCAGAGGAAGGAGGCGGG + Intergenic
1129399610 15:75274326-75274348 ATGGGGCAGAGGAAGGAGGCGGG + Intronic
1129601233 15:76999794-76999816 ATGGGGGACCTGGGAGAGGATGG - Intronic
1129715526 15:77846388-77846410 ATGGTGGAAGGCAAAGAGGAAGG - Intergenic
1130109796 15:80954612-80954634 TTGGGGGAGGGGATGGAGGAAGG + Intronic
1130115225 15:81000696-81000718 CTGGGGGAGCGGACAGGGGAAGG - Intergenic
1130152794 15:81324201-81324223 GCGGGGGCGCGGAAAGAGGCGGG - Intergenic
1130225995 15:82058823-82058845 AGGGAGGAGAGGGAAGAGGAGGG - Intergenic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1131053605 15:89363015-89363037 TTGGGTGAGCGGAAAGGGGAAGG + Intergenic
1131063457 15:89418371-89418393 ATGAGGGAGCAAAAAGAGAAGGG + Intergenic
1131106673 15:89739449-89739471 TAGGGAGAGTGGAAAGAGGAAGG - Intronic
1131709515 15:95037817-95037839 ATGGGGAACTGGAAAGGGGATGG - Intergenic
1132038218 15:98503856-98503878 ATGGGGGAGCAAAAAGGGGCAGG - Intronic
1132854388 16:2038413-2038435 AAGGGGGAGGGGAAGGGGGAGGG - Exonic
1132868272 16:2104349-2104371 TTGGGGGAGGGGGATGAGGATGG + Intronic
1132894752 16:2223518-2223540 GTGAGGGAACGGCAAGAGGAGGG - Intergenic
1132989798 16:2786859-2786881 ATGGGGGAGGGGGATGAGGGAGG - Intronic
1132989968 16:2787371-2787393 AAGGGGGTGAGGATAGAGGAGGG - Intronic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133333141 16:4988588-4988610 AGGAGGGAGGGGAAAGAGGAGGG - Intronic
1133636197 16:7668156-7668178 ACGGGGGAGGGGAGAGAGCAGGG - Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133808772 16:9145267-9145289 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1133989290 16:10692198-10692220 ATGGGGGAGTGAGAAGAGAATGG + Intronic
1134301306 16:12993900-12993922 CTGGGGGACAGGAAAGAGGGAGG + Intronic
1134523202 16:14927816-14927838 AAGGGGGAGGGGAGAGGGGAGGG - Intronic
1134523236 16:14927891-14927913 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
1134523247 16:14927919-14927941 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
1134523268 16:14927976-14927998 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
1134523463 16:14928670-14928692 TTGGGGGAGGGGGATGAGGATGG - Intronic
1134523474 16:14928696-14928718 TTGGGGGAGCGGGATGAGGATGG - Intronic
1134549303 16:15131874-15131896 AGGGGGGAGGGGGAAGGGGATGG + Intronic
1134549481 16:15132352-15132374 AGGGGGGAGGGGCAAGGGGAGGG + Intronic
1134711057 16:16327154-16327176 TTGGGGGAGGGGGATGAGGATGG - Intergenic
1134711068 16:16327180-16327202 TTGGGGGAGCGGGATGAGGATGG - Intergenic
1134770616 16:16806075-16806097 AAGGGGGAGAGGAAGGGGGAAGG - Intergenic
1134846279 16:17443509-17443531 ATGGTGGAAGGCAAAGAGGAAGG - Intronic
1134904840 16:17971506-17971528 AAGGGGAAGAGGAAAGAAGATGG + Intergenic
1134948497 16:18341377-18341399 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1134948506 16:18341403-18341425 TTGGGGGAGCGGGATGAGGATGG + Intergenic
1134948515 16:18341429-18341451 TTGGGGGAGCGGGATGAGGATGG + Intergenic
1134948526 16:18341455-18341477 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1134948690 16:18342078-18342100 AAGGGGGAGAGGAGAGGGGAGGG + Intergenic
1135186103 16:20317050-20317072 AAGGGGAAGGGGAAAGAGAACGG - Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135543244 16:23348466-23348488 AGGGGGGAGGGTAAAGAGGGAGG + Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136491377 16:30610409-30610431 ATTGGGGAGGGGAAAAAAGACGG - Intronic
1136505251 16:30698799-30698821 AGGGGCGCGCGGGAAGAGGAAGG + Intronic
1136774258 16:32863210-32863232 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1136896353 16:33998304-33998326 ATCGGGGAGCAGAAGGAAGAGGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1138047121 16:53736890-53736912 CTGGGGGAGGGGAATGAGTATGG - Intronic
1138242221 16:55436276-55436298 ATGGGCCAGAGGAGAGAGGAGGG + Intronic
1138316347 16:56073353-56073375 AGGGGAGAGGGGAAAAAGGATGG - Intergenic
1138439960 16:57028262-57028284 ATGGTGGGGAGGAACGAGGAGGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138635288 16:58333290-58333312 ATGGGGGAGTGGAACCAGGCAGG - Intronic
1139029147 16:62858355-62858377 AGGGGGGGGCAGAGAGAGGATGG - Intergenic
1139095726 16:63702862-63702884 ATGTGGGAGGAGAAAGAGTAGGG + Intergenic
1139482115 16:67236488-67236510 ATGGAGGGGCGCAAAGCGGAGGG + Intronic
1140479873 16:75256798-75256820 AGGGGAGAGCTGAGAGAGGAGGG - Intronic
1140828341 16:78728028-78728050 GAGGGAGAGAGGAAAGAGGAAGG - Intronic
1140894361 16:79311940-79311962 ATGGCGGAGAGGGAAGAGGAGGG + Intergenic
1141410784 16:83831573-83831595 AGGGAGGAGTGGAGAGAGGAGGG - Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142135037 16:88448011-88448033 AGGAGGGAGAGGAGAGAGGAAGG + Intergenic
1142180701 16:88668230-88668252 ATGGGGGGAGGGCAAGAGGAGGG - Intergenic
1142180724 16:88668306-88668328 ATGGGGGGAGGGCAAGAGGAGGG - Intergenic
1142211706 16:88811609-88811631 ATGGCGGCGCGGAAGGAGGCGGG + Exonic
1142285350 16:89169404-89169426 ACTGGGGAGAGGAAATAGGATGG + Intergenic
1203076682 16_KI270728v1_random:1125329-1125351 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142785773 17:2221389-2221411 ATGGTGGAAGGCAAAGAGGAAGG - Intronic
1143250237 17:5518136-5518158 ATGGGGGAGGTGAAGGAAGAAGG - Intronic
1143381310 17:6498022-6498044 ATGGGGGCGTGGGCAGAGGAAGG + Intronic
1143390591 17:6556972-6556994 CAGAGGGAGCGGAGAGAGGAAGG + Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143616726 17:8055971-8055993 ATGGGGGTGCGGTGAGGGGAAGG - Intergenic
1143704549 17:8687577-8687599 AGGGGAGAGTGGGAAGAGGAGGG - Intergenic
1143734040 17:8897834-8897856 ATGGTGGAGTGGAAAGATGAGGG + Intronic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1144462249 17:15467596-15467618 TTGGGGCAGGGGCAAGAGGATGG - Exonic
1145293227 17:21566702-21566724 ATGCTGGAGGGGAAAGAGGAAGG + Intronic
1145386740 17:22419235-22419257 TTGCTGGAGGGGAAAGAGGAAGG - Intergenic
1146182750 17:30708360-30708382 AAGGGGGAGGGGCAAAAGGAGGG - Intergenic
1146255924 17:31391617-31391639 AGTGGGGAGGGGAAGGAGGAGGG - Exonic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146635692 17:34502691-34502713 CTGCGGGGGTGGAAAGAGGAGGG + Intergenic
1146986680 17:37226823-37226845 AAGTGGGAGGGGAAACAGGAAGG - Intronic
1147341760 17:39756524-39756546 ATGGGGGAGGGGAAGAAGGAGGG + Intergenic
1147754180 17:42757355-42757377 AAGGGGAAGGGGAAAAAGGAAGG - Intergenic
1148159784 17:45443427-45443449 ATGGGGCAGGGGAAAGAGTGTGG - Intronic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148520116 17:48265736-48265758 ATGGGGGGAGGGAAAGAGAAAGG - Intronic
1148703058 17:49602930-49602952 TTGAGGGATAGGAAAGAGGAAGG + Intronic
1148722442 17:49763769-49763791 ATGGGGGCGAGGGAAGAGAAAGG - Intronic
1148850962 17:50555137-50555159 ACGGTGGGGCGGAAGGAGGATGG + Intronic
1149389500 17:56174791-56174813 CTGGGGGAGGGGAAAGATGAAGG - Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150391072 17:64790299-64790321 ATGGGGCAGGGGAAAGAGCGTGG - Intergenic
1150409853 17:64934351-64934373 ATGGGGCAGGGGAAAGAGTGTGG - Intergenic
1150451324 17:65271244-65271266 AGGGGAGAGGGGAAAGAGGAGGG + Intergenic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1151278051 17:73050796-73050818 ATGGGGGAGGTGAAAGGGAAGGG + Intronic
1151411446 17:73932979-73933001 AGGGGGGAGAGGGAAGAGGGAGG - Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1152035823 17:77871986-77872008 ATGGGGTGGGGGAAGGAGGAAGG + Intergenic
1152107118 17:78337005-78337027 ATTGGGGAGAGAAAGGAGGAAGG + Intergenic
1152123820 17:78434629-78434651 ATGGGGGATGGGATAGAGGATGG + Intronic
1152123827 17:78434648-78434670 ATGGGGGATGGGATAGAGGATGG + Intronic
1152343453 17:79737792-79737814 AAGGGGGCGGTGAAAGAGGAAGG + Intronic
1152471724 17:80493231-80493253 TTGGGGGAGGAGAGAGAGGAAGG + Intergenic
1152609234 17:81307473-81307495 AAGGGGGAGGGGAAGGAGAAAGG - Intergenic
1153450419 18:5221210-5221232 ATGGGGGAGGGGAAGGGGAAGGG - Intergenic
1154980891 18:21501404-21501426 ATGGGTGAGGGGCAAGAGGAGGG - Intronic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1156292411 18:35759469-35759491 AGGGGGGAGGGGAGAGGGGAAGG + Intergenic
1156493700 18:37511939-37511961 CTGGGGGTGGGGATAGAGGAGGG + Intronic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156597746 18:38566702-38566724 ATGGAGGAAGGGAGAGAGGAAGG + Intergenic
1156740539 18:40322076-40322098 ATGGTGGAAGGGGAAGAGGAAGG - Intergenic
1156826338 18:41434443-41434465 GTGGGGGAGGGAAAGGAGGAAGG + Intergenic
1157084995 18:44570992-44571014 GTGGAGGAGGGGAGAGAGGAAGG + Intergenic
1157371200 18:47113891-47113913 ATGGGGGAGAGGAGATAGGGAGG + Intronic
1157442546 18:47721774-47721796 CTCGGGGAGGGGCAAGAGGAAGG + Intergenic
1158710362 18:59831838-59831860 ATGAGAGAGCTGAAAGAGAAAGG + Intergenic
1158980105 18:62751738-62751760 GAGGGGGAGGGGAAAGATGAGGG + Intronic
1159215248 18:65383959-65383981 ATGGGGGAGCTAGAAGGGGATGG - Intergenic
1161803532 19:6429462-6429484 GAGGAGGAGAGGAAAGAGGAGGG + Intronic
1161934545 19:7363608-7363630 ATGGATGAAAGGAAAGAGGATGG + Intronic
1162876787 19:13626602-13626624 AAGGGGGAAGGGAAAGGGGAAGG + Intergenic
1163160012 19:15458688-15458710 ATGGGGGATGGGGAAGAGGCAGG - Intronic
1163351107 19:16777311-16777333 AAAGGGGAGGGGAAAGAGGAGGG + Intronic
1163376619 19:16937025-16937047 AAGGGAGAAAGGAAAGAGGAAGG - Intronic
1163640342 19:18458448-18458470 ACAGAGGAGAGGAAAGAGGATGG + Intronic
1164441908 19:28285163-28285185 AGGATGGAGGGGAAAGAGGATGG + Intergenic
1164680544 19:30131170-30131192 AGGGGGAAGGGGAAAGAGGGAGG - Intergenic
1164866861 19:31611591-31611613 AAGAGGGAGAGGAGAGAGGAAGG + Intergenic
1165749664 19:38252233-38252255 ATGGGGGAGGGGGAAGAAGCTGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166257177 19:41614956-41614978 AAGGGGGAGGGGAAAAGGGAAGG + Intronic
1166286846 19:41836250-41836272 AGGGGAGAGAGGAAAGAGCAGGG - Intergenic
1166297640 19:41896828-41896850 AGGGGGGAGGTGAGAGAGGATGG - Intronic
1166332954 19:42089241-42089263 AAGGAGGAGAGGAGAGAGGAAGG + Intronic
1166742641 19:45123560-45123582 CTGTGGGAGCGGACAGAGGGAGG - Intronic
1167163165 19:47780655-47780677 GTGGGGGATCGGGGAGAGGAGGG - Intronic
1167440679 19:49507024-49507046 AAGGGGGAGGGGAAGGAGAAGGG - Intronic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167607627 19:50489841-50489863 ATGGGAGAACAGAAAGAGGGAGG + Exonic
1167612216 19:50513012-50513034 CTGGGAGAGGGGAAAGAGGGCGG + Intronic
1167622860 19:50568618-50568640 AAGGGGGGGAGGAAAGAAGAGGG + Intergenic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1167821720 19:51934396-51934418 ATGGAGGAGAGGAAAGGGGGTGG - Intronic
1168072169 19:53959405-53959427 ATGGGGGAAGGGAAAGAGGGGGG - Intergenic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
1168169489 19:54576237-54576259 ATGGGAGAGTGGAAATAGGCAGG + Intronic
925299438 2:2800161-2800183 ATGGAGGAAGGGAAAGAGGAAGG + Intergenic
925755531 2:7128342-7128364 AAAGGGGAGGGGAAAGGGGAGGG - Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925894905 2:8463539-8463561 ATTGGGGAGCGGGCAGCGGAGGG - Intergenic
925927587 2:8681672-8681694 AAGGGGGAGGGGAAGGAGGAGGG - Intronic
925927592 2:8681684-8681706 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
926393448 2:12417811-12417833 ATGGGGGAGGGGCAGGAGGGAGG - Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
927083590 2:19653617-19653639 ATGGAGGAGGGCAGAGAGGATGG + Intergenic
927149752 2:20188833-20188855 AAGGCGGAGCGGAAAAAAGAGGG - Intergenic
927519501 2:23690393-23690415 GTGGGTGGGCGGAAAGAGCAGGG - Intronic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
927900761 2:26816731-26816753 ATAGGGGAGGGGACAGAGGATGG + Intergenic
928076048 2:28265560-28265582 TTGGGGGATGGGAAAGAGGTAGG + Intronic
928180324 2:29064115-29064137 AAGGAGGAGAGGACAGAGGACGG + Exonic
928244790 2:29617844-29617866 CTGGGAGAGAGGAAAGATGATGG - Intronic
928274088 2:29883083-29883105 AAGGGAGAGAGGAAGGAGGAAGG + Intronic
928341168 2:30444157-30444179 ATGGGGGTGGGGAACGGGGAAGG + Intergenic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
928641942 2:33308463-33308485 ATGGGGGAGTCGGAAGAAGAGGG - Intronic
928776107 2:34765582-34765604 GTGGGTGAGGGGAAAGAGGAGGG + Intergenic
929362633 2:41112716-41112738 ATGGGGGGGATGAAAGAGGAAGG - Intergenic
929444564 2:41992108-41992130 GTGGAGGAGAGGAGAGAGGAAGG + Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
930084012 2:47480098-47480120 AAGGGGGAAGGGAAAGGGGAAGG - Intronic
930084025 2:47480134-47480156 ATGGGGGATGGGAAGGGGGAGGG - Intronic
930084063 2:47480221-47480243 AAGGGGGAAGGGAAGGAGGAAGG - Intronic
930084096 2:47480306-47480328 GAGGGGGAGGGGAAAGGGGAAGG - Intronic
930245891 2:48982993-48983015 ATGGGGTTGAGGAAAGAAGAAGG + Intronic
930752172 2:54944981-54945003 ATGGGGGAGGGGAGGGAGAAAGG - Intronic
931332401 2:61301111-61301133 AGGAGAGAGCGGAAAGGGGAAGG - Exonic
931492731 2:62767043-62767065 ATGAGGGAGAGGTAAGAGGAAGG + Intronic
931706578 2:64951472-64951494 GTGGGGGAGGGGACAGAGGTAGG - Intergenic
931895543 2:66725487-66725509 AAGGGGGAAAGGAAAGAGCAAGG - Intergenic
932430368 2:71670538-71670560 AGGTGGGAGTGGAGAGAGGAGGG - Intronic
932621294 2:73266064-73266086 ATGGGGGAGAGGAGAGAGAAGGG + Intronic
934117496 2:88811060-88811082 ATGCTGGAGAGGAAAGGGGAGGG + Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935297809 2:101665812-101665834 ATGGGGGAGCCAGAAGGGGATGG + Intergenic
935308367 2:101759569-101759591 AATGGGGAGGGGAGAGAGGAGGG - Intronic
936161098 2:110084796-110084818 ATGCTGGAGAGGAAAGGGGAGGG + Exonic
936183565 2:110286558-110286580 ATGCTGGAGAGGAAAGGGGAGGG - Intergenic
936472485 2:112811503-112811525 AGAAGGGAGGGGAAAGAGGAAGG + Intergenic
936563142 2:113559534-113559556 TGGCAGGAGCGGAAAGAGGAGGG - Intergenic
937060530 2:118977588-118977610 GTGGGGCTGTGGAAAGAGGATGG - Intronic
937412752 2:121690593-121690615 ATGGGGGAGGAGTAAGGGGAGGG - Intergenic
937552133 2:123107551-123107573 ATGGGGGAGGGAAAAGTGGAAGG - Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938180982 2:129182181-129182203 ATGAGGGAGTGGAAAGAGAAGGG - Intergenic
938429367 2:131218729-131218751 CAGGGGGAGCGGCAAGAGCAAGG + Exonic
938800540 2:134759546-134759568 AAGGGGGAGGGGGAGGAGGAAGG + Intergenic
938836046 2:135105219-135105241 AGGGGGGAGCGGGAGGGGGAAGG - Intronic
939592373 2:144081645-144081667 AAGGTGGGGAGGAAAGAGGAGGG + Intronic
939631515 2:144531511-144531533 AGGGGGGAGCAAAAAGAGGGCGG - Intergenic
939657632 2:144847721-144847743 GAGAGGGAGGGGAAAGAGGAGGG + Intergenic
939991254 2:148877740-148877762 AGGGGAGAGGGGAAAGGGGATGG - Intronic
940277147 2:151951322-151951344 ATTGGGTAGGGGAAAGAAGAGGG - Intronic
940664587 2:156592846-156592868 ATGGGGGTGGGGGAAGACGAAGG - Intronic
940875440 2:158893159-158893181 GTGGGGGAGTTGAAAGAGGGAGG - Intergenic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942045475 2:172097070-172097092 ATGAGGGGGCGGAAAGGGGGAGG - Intergenic
942601910 2:177650098-177650120 ATGGGGGAGTGGGAGGAGGGAGG - Intronic
942662198 2:178277775-178277797 CTGGGAGAGTGGAAACAGGAGGG - Intronic
943214214 2:185009823-185009845 ATGGAGGTGTGGAAAGAGGAAGG - Intergenic
943600899 2:189919843-189919865 ATGGAGGAGGGGCAAGATGAAGG - Intronic
945564175 2:211375990-211376012 ATGAGGGAAAGGAAGGAGGATGG + Exonic
946032994 2:216719875-216719897 ATGGGGAAGGGGAAAGAAGGAGG - Intergenic
946125650 2:217560377-217560399 ATGGGAGAGAGGAAATGGGAAGG - Intronic
946300931 2:218823669-218823691 ATGGGGGTGGGGGAAGATGAAGG + Exonic
946405256 2:219488924-219488946 TTGGGGGAGCGGCAGGGGGAGGG + Intronic
946768991 2:223068751-223068773 CTGGGGGTGTGGGAAGAGGAAGG - Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947744858 2:232502253-232502275 ATGGGGGAGGGGTGGGAGGAGGG + Intergenic
948091938 2:235302199-235302221 AGGGGGGAGGGGGATGAGGAGGG - Intergenic
948295479 2:236857227-236857249 GGGCGGGAGAGGAAAGAGGAGGG - Intergenic
1169137118 20:3204013-3204035 ATCGGGGAGCGGATTGGGGAGGG + Intronic
1169571204 20:6908050-6908072 ATGGGGGAGGGGACACTGGATGG + Intergenic
1169833122 20:9847246-9847268 ATGGTGGAAGGCAAAGAGGAAGG - Intergenic
1169892338 20:10466665-10466687 ATGGGTGGGAAGAAAGAGGAGGG - Intronic
1170503240 20:16996554-16996576 ATGGAGGGAAGGAAAGAGGATGG - Intergenic
1170788920 20:19491734-19491756 GAGTGGGAGAGGAAAGAGGAAGG + Intronic
1170797156 20:19558059-19558081 ATGGGGGAGGGAAATGAGGATGG + Intronic
1170845039 20:19955105-19955127 ATGGGGGAGAGAAAAGAGAATGG - Intronic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171107033 20:22444026-22444048 ATGAGAGAAAGGAAAGAGGAGGG - Intergenic
1171127844 20:22620010-22620032 TTGGGGGAGGGGAATGGGGAAGG + Intergenic
1171139497 20:22728823-22728845 ATGGAGGACTGGAAAGAGGAGGG + Intergenic
1171209885 20:23309194-23309216 ATGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171383758 20:24753154-24753176 ATGGTGGAGGGAAAAGAGGTAGG - Intergenic
1172292168 20:33784216-33784238 ATGGGGGAGGGGGAAGGAGATGG - Intronic
1172631087 20:36378704-36378726 ATGGGCGAAAGGGAAGAGGAAGG + Intronic
1173133978 20:40422945-40422967 AAGGGGGGAGGGAAAGAGGAAGG + Intergenic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173615426 20:44400340-44400362 AGGGAGGAGGGGGAAGAGGATGG + Intronic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1174149717 20:48477610-48477632 GAGGGCGAGGGGAAAGAGGAAGG + Intergenic
1174219506 20:48942139-48942161 ATGAGGGAGGGAAAAGAGAAAGG + Intronic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1175130107 20:56782415-56782437 AGGGGGGAAAGGAAAGAGGCAGG + Intergenic
1175226063 20:57444657-57444679 GTGTGGGAGCGGAAAGAGGATGG + Intergenic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1176187170 20:63787070-63787092 GTGGGGTAGAGGCAAGAGGAAGG + Intronic
1177758351 21:25373802-25373824 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1177758365 21:25373829-25373851 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178021665 21:28415281-28415303 GTGGTGGAGAGGAAAGAGAATGG + Intergenic
1178225363 21:30710904-30710926 GAGGAGGAGAGGAAAGAGGAGGG + Intergenic
1178931060 21:36819781-36819803 ATGGGAAAGTGGAAAGAGTATGG - Intronic
1179250012 21:39664556-39664578 ATGGGGCAGCGGGACGGGGAAGG - Exonic
1179296161 21:40064862-40064884 AAGGGAGAGAGGAAAAAGGAGGG + Intronic
1179615387 21:42580097-42580119 AGGGGGGAGGGAAAAGAGGAGGG - Intronic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1180156074 21:45977887-45977909 ATAGGGGATGGGAGAGAGGAGGG + Intergenic
1180182412 21:46123903-46123925 ATGGGTGGGTGGATAGAGGATGG + Intronic
1180182473 21:46124159-46124181 ATGGGTGGGTGGACAGAGGATGG + Intronic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181387926 22:22558410-22558432 ATGGGGGAAGGGAAACAGGGTGG + Intronic
1181537227 22:23552741-23552763 ATGGGTGGGAGGAAAGATGAAGG - Intergenic
1181756265 22:25027236-25027258 GTGGGGGAGGGGAAAGAAAAGGG + Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182443461 22:30377130-30377152 AGGTGGGAGTGGACAGAGGAAGG + Intronic
1182551997 22:31105622-31105644 CTGGGGGAGGGGAAATGGGATGG - Intronic
1182865465 22:33600580-33600602 ATGGGGGAAAGGAAGGAGGTTGG + Intronic
1183419741 22:37704465-37704487 AAGGGGGAGGGGAAGGGGGAGGG + Intronic
1183464357 22:37972155-37972177 AAGGGGGTGGGGAAAGAGGGAGG + Intronic
1183519012 22:38285505-38285527 ATGGGGGAGCGGGGTGTGGAAGG + Intergenic
1183590349 22:38776197-38776219 ATGGGGGTGGGGAGAGAGGACGG - Intronic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183828994 22:40408201-40408223 ATGGCAGAGAGGACAGAGGAGGG + Intronic
1184100767 22:42340843-42340865 GAGGGGGAGGGGAAAGGGGAGGG + Intronic
1184295522 22:43521810-43521832 AAGGGGGAGGGGACAGGGGAGGG - Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1185053601 22:48566514-48566536 ATGGGTGAGTGGAAAGATGAAGG + Intronic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
1185127071 22:49017259-49017281 ATGGGGGAGCCAGAAGGGGATGG + Intergenic
949689667 3:6621295-6621317 ATGGGGAATTGGAAAGGGGATGG - Intergenic
949940177 3:9148724-9148746 ATGGGGTAGTGGAGAAAGGATGG - Intronic
950210928 3:11122568-11122590 ATGGTGGAGGGTAGAGAGGAGGG - Intergenic
950635519 3:14311686-14311708 AAGGGAGAGGGGAAAGAGGGAGG - Intergenic
951353422 3:21634309-21634331 AAGGGAGAAAGGAAAGAGGAAGG + Intronic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
951719118 3:25679580-25679602 AAGGGGGAGGGGAAAGGGGGAGG + Intergenic
952716482 3:36485321-36485343 ATGGTGGAGTGGAAAGAACACGG + Intronic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952865676 3:37853737-37853759 CCAGGGGAGCTGAAAGAGGAGGG + Intergenic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953527570 3:43706342-43706364 TGGGGGGAGCGGTAAGAGGAGGG + Intronic
953550621 3:43899618-43899640 AAGGGGGAGAGGAGAGGGGATGG - Intergenic
954294175 3:49665004-49665026 ATGTGGGAGGAGAAAAAGGAGGG + Intronic
954432906 3:50480809-50480831 GAGGGGGAGGGTAAAGAGGAAGG + Intronic
954660780 3:52225774-52225796 AGAGGGGAGTGGAAAGAGGAAGG - Exonic
954713772 3:52517215-52517237 CTGGGGGCGCTGAGAGAGGAGGG + Intronic
954847380 3:53571601-53571623 GTGGGGGAGCTGGAAAAGGATGG + Intronic
954967606 3:54625126-54625148 ATGGGGGAGAGGAATGCTGAGGG - Intronic
955087806 3:55720063-55720085 AAGGGGGAGGGGAGAGAAGAGGG - Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955555696 3:60134939-60134961 ATGGAGTAGAGGAAAGAGAAAGG + Intronic
955663453 3:61325978-61326000 ATGGGGGAGTCAAGAGAGGAAGG - Intergenic
955856777 3:63280591-63280613 TTGGGATAGAGGAAAGAGGAAGG - Intronic
956474701 3:69607888-69607910 GAGAGGGAGGGGAAAGAGGATGG + Intergenic
956778617 3:72587160-72587182 ATGGGGGAGCTGAAGGGAGATGG - Intergenic
956971537 3:74532038-74532060 GAGGGAGAGAGGAAAGAGGAAGG + Intergenic
957562417 3:81839657-81839679 ATGGGGGAGGGGAAGGAGTAGGG + Intergenic
958883483 3:99699416-99699438 ATGTGAGAGCAGGAAGAGGAAGG - Intronic
960723477 3:120647313-120647335 AAGGGGTAGCAGAAATAGGATGG + Intronic
961235309 3:125361362-125361384 ATTGGGTAGGGGAAATAGGAGGG - Intronic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961735237 3:128997277-128997299 ATGGGGAAGGGGCAAGAAGAAGG - Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
962710482 3:138081654-138081676 CTGGGGGAGAGGGAAAAGGAGGG + Intronic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
963433356 3:145237179-145237201 ATGGGGGAGAGAAAAGAGTCAGG - Intergenic
963656401 3:148056934-148056956 ATGGGATAGCAGCAAGAGGAGGG - Intergenic
963730870 3:148970801-148970823 AAGGGGGAGGGGACAAAGGAAGG - Intergenic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
966386491 3:179404535-179404557 AAGGGGGCGGGGAGAGAGGAGGG + Intronic
966507656 3:180725073-180725095 ATGGTGGAAGGGGAAGAGGAAGG - Intronic
966594726 3:181715382-181715404 GTGGGGGAGGGGAAAGGGGTGGG + Intergenic
966981353 3:185139125-185139147 GAGGGGGAGCGGGAGGAGGAAGG + Intronic
967210240 3:187162101-187162123 AACGGGGAGAGGAAAGTGGATGG - Intronic
967741478 3:193007763-193007785 ATGGGAGATTGGATAGAGGATGG - Intergenic
967877255 3:194275804-194275826 AGGGGGAAGCGGAAAGACCATGG - Intergenic
967877278 3:194275890-194275912 AGTGGGGAGCGGAAAGAGGAGGG - Intergenic
967991081 3:195131236-195131258 ATGGGGAGACGGAAAGAGGGTGG - Intronic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968449445 4:668417-668439 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449475 4:668530-668552 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449490 4:668586-668608 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449501 4:668623-668645 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449565 4:668864-668886 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449612 4:669031-669053 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449659 4:669198-669220 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449686 4:669311-669333 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449715 4:669403-669425 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449734 4:669478-669500 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449744 4:669516-669538 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449757 4:669573-669595 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449762 4:669592-669614 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449767 4:669611-669633 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449781 4:669667-669689 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449786 4:669686-669708 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449791 4:669705-669727 ATGGGGTAGCGGGAATAGCATGG - Intronic
968449796 4:669724-669746 ATGGGGTAGCGGGAATAGCATGG - Intronic
968529968 4:1086564-1086586 GAGGGGTAGGGGAAAGAGGATGG + Intronic
968530026 4:1086718-1086740 ATGGGGTTGGGGAGAGAGGATGG + Intronic
968530033 4:1086737-1086759 ATGGGGTAGGGGTGAGAGGATGG + Intronic
968530059 4:1086813-1086835 ATGGGGTGGGGGAGAGAGGATGG + Intronic
968530066 4:1086832-1086854 ATGGGGTTGGGGAGAGAGGATGG + Intronic
968530095 4:1086908-1086930 ATGGGGTGGGGGCAAGAGGATGG + Intronic
968530109 4:1086946-1086968 ATGGGGTCGGGGAGAGAGGATGG + Intronic
968530129 4:1087003-1087025 ATGGGGTGGGGGAGAGAGGATGG + Intronic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
968530206 4:1087231-1087253 ACGGGGTAGGGGAGAGAGGACGG + Intronic
968530213 4:1087250-1087272 ACGGGGTAGGGGAGAGAGGATGG + Intronic
968589853 4:1451950-1451972 GTGGGGGAGGGAGAAGAGGAGGG - Intergenic
969535665 4:7754971-7754993 ATGGGAGAGTGGACAGAGGCTGG + Intergenic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971005673 4:22371793-22371815 ATGGTGGAAAGGTAAGAGGAAGG - Intronic
971408258 4:26342520-26342542 ATGGGAGAAAGGAATGAGGAGGG - Intronic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
971642505 4:29153849-29153871 ATGGAGGAAGGCAAAGAGGAAGG + Intergenic
971769851 4:30882176-30882198 GAAGGGGAGGGGAAAGAGGAAGG - Intronic
971787505 4:31123812-31123834 ATGGGGGTCTGGAAAGAGGATGG + Intronic
972356255 4:38281774-38281796 AGGAGAGAGAGGAAAGAGGAGGG - Intergenic
972987413 4:44781049-44781071 ATGGGGGAACAGAGAGGGGAAGG - Intergenic
973532144 4:51844295-51844317 TTCGGGGTGCGGAGAGAGGAGGG + Intronic
974020493 4:56688146-56688168 AGGAGGGAGGGGGAAGAGGAAGG + Intergenic
974597692 4:64036628-64036650 AAGGGGGAGGGGAAGGGGGAGGG - Intergenic
975360217 4:73460937-73460959 GAGGGGGAGGGGAAGGAGGAGGG - Intergenic
975372851 4:73608037-73608059 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
975704195 4:77095640-77095662 ATGGGGGAGTGGAATGAAGTGGG + Intergenic
975707065 4:77121887-77121909 ATGGGGAATTGGAAAGGGGATGG + Intergenic
976830461 4:89308443-89308465 ATGGGGTAGCGGGAAGGGGATGG - Intergenic
977613200 4:99058135-99058157 ATGTAGGAGAGGGAAGAGGAGGG + Intronic
978501793 4:109417746-109417768 AGAGGGGAGGGGAAAGAGGAGGG + Intergenic
978782084 4:112566853-112566875 ATTGGGGATGGGGAAGAGGATGG - Intronic
979188335 4:117826840-117826862 ATAGGGGAACAGAAACAGGAAGG + Intergenic
979733391 4:124052472-124052494 ATGGGTGAGCCAAAGGAGGAAGG + Intergenic
979892792 4:126120969-126120991 ATGAGGTAGAGGAAAGAGTAAGG + Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
981614845 4:146635795-146635817 AAGGGGGAGGGGACAGAGGGAGG + Intergenic
981616887 4:146651813-146651835 AGGGGGGAGGGGAAAATGGAAGG - Intergenic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
982517951 4:156375629-156375651 AGGGGTGAGGGGCAAGAGGAGGG + Intergenic
982720417 4:158854322-158854344 ATAGGGGAGAGGAGAGAGGAGGG - Intronic
982805574 4:159758672-159758694 AGGTGGGAGCTAAAAGAGGAGGG + Intergenic
982855822 4:160381548-160381570 ACGGGGGAGAGGGAAGGGGAAGG + Intergenic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984098059 4:175455508-175455530 ATGGGGAACTGGAAAGGGGATGG + Intergenic
984703553 4:182833357-182833379 AGGGGAGAGGGGAAGGAGGAGGG - Intergenic
984925321 4:184801361-184801383 ATGGGGGTGCAGAATGAGGGTGG + Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985486857 5:156671-156693 ATGAGGGAATGGAAAGAGCAGGG + Intronic
985542208 5:492354-492376 ATGGGGGAGGGGAGGGAGGTAGG + Intronic
985658122 5:1142478-1142500 AGTGGGGAGGGGAAAGGGGAGGG - Intergenic
985805060 5:2037703-2037725 ATGGGAGAGGGGAGAGAGGAGGG - Intergenic
985894913 5:2743213-2743235 GGCGGGGAGCGGAGAGAGGAAGG - Intergenic
985928456 5:3035905-3035927 ATGAGGGACCGGGCAGAGGAGGG - Intergenic
986429626 5:7668676-7668698 ATGGTGGAGAGAAAAGAGTATGG + Intronic
986773506 5:10994352-10994374 AGGGGGGCGGGGAAGGAGGAAGG + Intronic
986773514 5:10994371-10994393 AAGGGGCCGGGGAAAGAGGAGGG + Intronic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987911656 5:24154838-24154860 ATGGGGGAGTGGCAAGAGTAGGG + Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989628568 5:43457476-43457498 ATGGTGGAAGGTAAAGAGGAAGG + Intronic
989759292 5:44993096-44993118 AGGTGGGAGAGGGAAGAGGAGGG + Intergenic
989770615 5:45140225-45140247 ATGGTGGAAGGCAAAGAGGAAGG - Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990379721 5:55210925-55210947 ATGGGGAGGTGGTAAGAGGAAGG + Intergenic
990499908 5:56385752-56385774 ATGGGAGAGGAGGAAGAGGAGGG - Intergenic
992060731 5:73044113-73044135 ATGGCGGAAGGCAAAGAGGAAGG - Intronic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992578973 5:78151835-78151857 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993204587 5:84863344-84863366 AGGGGGGAGGGGAGGGAGGAAGG - Intergenic
993305642 5:86271883-86271905 ATGGGGGAGCGGGAGCAGAAAGG - Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993628900 5:90259831-90259853 ATTGGGGAGTGGGAGGAGGAAGG + Intergenic
994721962 5:103390820-103390842 ATTGTGGAGTAGAAAGAGGAAGG - Intergenic
995045686 5:107643689-107643711 ATGGGGGAGTGGGGACAGGAAGG + Intronic
995105629 5:108374704-108374726 AGGGAGGTGAGGAAAGAGGAGGG + Intronic
996093716 5:119376566-119376588 CTGGGGGAGCAGAAAGACGGGGG - Intronic
996334911 5:122372790-122372812 GAGGGGGAAGGGAAAGAGGAGGG - Intronic
996387529 5:122925075-122925097 AAGGAGGAGAGGGAAGAGGAGGG - Intronic
996418317 5:123234001-123234023 AAGGGGAAGGGGAAAGAGAAAGG - Intergenic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
998416185 5:141947835-141947857 TTGGGGGTAAGGAAAGAGGAGGG - Intronic
998997577 5:147882402-147882424 ATGGGGGATAGGAAAGTGAAGGG - Intronic
999301534 5:150493757-150493779 ATTGGGGAGCTGGAAGAGCAGGG + Intronic
999394028 5:151215130-151215152 ATGGGGGTGGGGAAAGAGACAGG + Intronic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
1000109681 5:158095943-158095965 GTGGGGGAGTGGAAAGAAGATGG + Intergenic
1000113869 5:158135209-158135231 ATGGGGCAGGAGAAAGGGGATGG + Intergenic
1000204672 5:159047522-159047544 ATGGGGGAGGGGCAACAGCAAGG + Intronic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1000858647 5:166430581-166430603 AGGGGGGAGGGGAGAGAGGGTGG - Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001720222 5:173851042-173851064 AAGGGAGGGAGGAAAGAGGAAGG + Intergenic
1002098913 5:176847841-176847863 GCGGGGGAGGGTAAAGAGGAAGG - Intronic
1002461468 5:179375938-179375960 CTGGGGGAGGGGGAAGAGGGAGG + Intergenic
1002461526 5:179376080-179376102 CTGGGGGAGGGGAAAGGGGGAGG + Intergenic
1003005606 6:2378204-2378226 GAGGGAGAGAGGAAAGAGGAAGG + Intergenic
1003194015 6:3899011-3899033 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1003728355 6:8792035-8792057 GTGGGAGAGCTGGAAGAGGAGGG + Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004020649 6:11773232-11773254 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1004577299 6:16909559-16909581 CTGGGGGAGCTGAAAGAGACGGG - Intergenic
1004847490 6:19661588-19661610 ATGGGTTAGAGGAAAGAGGAAGG + Intergenic
1005159598 6:22843599-22843621 ATGGCAGAGGGCAAAGAGGAAGG - Intergenic
1005345331 6:24883869-24883891 GTGGGGGAGCATAAACAGGATGG - Intronic
1005385554 6:25280664-25280686 ATGGCAGAGCTGAAATAGGATGG + Intronic
1005952880 6:30644412-30644434 ATGGAGGAAAGGAGAGAGGAAGG - Intronic
1006455941 6:34131904-34131926 AATGGGGAGAGGGAAGAGGAAGG - Intronic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006567746 6:34974165-34974187 AAGGGGGAAGGGGAAGAGGAAGG - Intronic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007431594 6:41780165-41780187 TCCGGGGAGCGGAAAGGGGACGG + Intronic
1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG + Intronic
1007946506 6:45832035-45832057 ATAGGGGAGGAGAAAGAGGGAGG - Intergenic
1008137191 6:47790500-47790522 ATGGGGGAGGTGAAGGAGGGAGG - Intronic
1008265135 6:49415655-49415677 ATGAGAGAGTAGAAAGAGGAAGG + Intergenic
1010250065 6:73697841-73697863 ATGGGAGAAGGGGAAGAGGATGG + Intronic
1010474939 6:76275783-76275805 ATGGAGGAGGGGAAAGGGAAAGG - Intergenic
1010769374 6:79811121-79811143 GTGGGAGAGGGGAAAGAAGAGGG + Intergenic
1011632309 6:89339492-89339514 ATGGGGGAGGAGAGAGGGGAGGG + Intronic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013113975 6:107086652-107086674 TCGGGGGAGAGGAAAGGGGAGGG - Intronic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1014263055 6:119241865-119241887 CTGGGGGAAGGGAAAGATGAAGG + Intronic
1014748457 6:125228211-125228233 TTGGGGGAAAGGAAAGAAGAGGG + Intronic
1015575351 6:134665433-134665455 AAGGGGGAGGGGGAAGGGGATGG + Intergenic
1015888965 6:137950111-137950133 GTAGGGGAGAGGAAAGAAGAAGG - Intergenic
1016855243 6:148662855-148662877 ATGGGGAAGGGGAAAGATCAAGG - Intergenic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1018969332 6:168515446-168515468 CTCGTGGAGCGGAAAGCGGACGG - Intronic
1019049229 6:169170372-169170394 GAGAGGGAGCGGAAGGAGGAAGG - Intergenic
1019159122 6:170057710-170057732 AGGGGGGAAGGGAAAGGGGAGGG - Intergenic
1019430710 7:997689-997711 ATGCGGGAGCTGGATGAGGAGGG - Exonic
1019805043 7:3117534-3117556 AGGGGAGAGAGGAAAGAGAAAGG + Intergenic
1020035193 7:4959756-4959778 GTGGGGGAGCGGAAAGTGGGGGG + Intergenic
1020342795 7:7130977-7130999 AAGGGGAAGAGGAAAGAGAAGGG - Intergenic
1022320984 7:29287278-29287300 AGTGGGGATCTGAAAGAGGATGG + Intronic
1022789098 7:33669001-33669023 TTGAGGGAGAGGAAAGAGCATGG + Intergenic
1022827357 7:34029424-34029446 ATGGAGGAGAGGCAAAAGGAAGG + Intronic
1023115706 7:36859946-36859968 ATGAGGGAGAAGGAAGAGGACGG - Intronic
1023457560 7:40358168-40358190 ATGTGGGAGCTTAAAGATGATGG + Intronic
1023809687 7:43902159-43902181 ATGGTGGAGAGGGAGGAGGAGGG + Intronic
1024028355 7:45433337-45433359 AGGAGGGAGAGGAAGGAGGAGGG - Intergenic
1024210998 7:47204009-47204031 AGAGGGAAGGGGAAAGAGGAAGG - Intergenic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024620867 7:51156816-51156838 AAGGGGGAGAGGAAGGAGAAGGG - Intronic
1024630771 7:51244998-51245020 AAGGAGGTGTGGAAAGAGGAAGG - Intronic
1024854680 7:53764365-53764387 GTGGGGGGGCGGTGAGAGGATGG - Intergenic
1025603812 7:63024462-63024484 ATGGGAGAAGGGAAAGATGAAGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026191913 7:68136509-68136531 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026191921 7:68136528-68136550 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026223791 7:68423155-68423177 ATGGGGGAGAAGAGAGAGGTGGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027397141 7:77767768-77767790 AAGGGGGAGGGGGGAGAGGAGGG - Intronic
1027397160 7:77767805-77767827 AGGGGGGAGGGGGCAGAGGAAGG - Intronic
1028433512 7:90775627-90775649 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
1028433519 7:90775639-90775661 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
1028584607 7:92440294-92440316 AAGGGGGAAGGGAAAGGGGAAGG + Intergenic
1028628700 7:92908345-92908367 ATGATGGAGTGGAAAAAGGATGG - Intergenic
1029155193 7:98512436-98512458 TTGGTGGGGCTGAAAGAGGAAGG + Intergenic
1029238390 7:99142665-99142687 ATGGGGGAGTGAGAAGAGGGTGG + Intronic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1029799007 7:102926012-102926034 ATGGGGGACCAGAAAGAAGCAGG + Intronic
1029820153 7:103138953-103138975 TTGAGGGAGTGGAAATAGGAGGG - Intronic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1030627163 7:111856737-111856759 ACGGGTAAGCGGGAAGAGGAGGG + Intronic
1031041162 7:116839782-116839804 ATGAGGAAGAGGAAAGATGAGGG + Intronic
1031214803 7:118877111-118877133 AGAGGGGAAAGGAAAGAGGAGGG + Intergenic
1031696178 7:124857682-124857704 AAGGGGAAGTGAAAAGAGGATGG - Intronic
1032425445 7:131819005-131819027 ATGGGGCAGGGGAAAGAGAAAGG + Intergenic
1032531399 7:132623651-132623673 ATGGGGTAGAGCAAACAGGAGGG - Intronic
1032667279 7:134049296-134049318 ATGGGTGAGTGGAAGGATGAAGG - Intronic
1032748018 7:134807574-134807596 ATGGGGGAGCATGAAGAGGGTGG + Intronic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033291724 7:140090882-140090904 GTGGGGGAGAGGAAGAAGGAGGG - Exonic
1033559927 7:142521528-142521550 ATGGTGGAGAGGTAAGTGGAGGG + Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033804387 7:144937580-144937602 AAGGGGAAGCGGAAAGAGAAGGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033969813 7:147025405-147025427 AAGGGGGAGGGGAAGGGGGAGGG + Intronic
1034405331 7:150899020-150899042 ATGGAGGAGGGGACAGAGAAGGG + Intergenic
1034469989 7:151249831-151249853 AGGAGGGACCGGAAGGAGGAGGG + Intronic
1034720739 7:153290100-153290122 TCGGGGGAGGGGGAAGAGGAGGG + Intergenic
1034879827 7:154754976-154754998 GTGGGTGGGCGGAAAGAAGAGGG + Intronic
1034880568 7:154759441-154759463 AAGGGGCAGCGGCAATAGGACGG + Intronic
1035435888 7:158858907-158858929 AGGGGGGAGGGGAGAGGGGAGGG - Intronic
1035449342 7:158965639-158965661 ATGGCAGAGGGCAAAGAGGAAGG - Intergenic
1035494309 7:159309360-159309382 ATGGTGGAAGGCAAAGAGGAAGG + Intergenic
1035570170 8:667410-667432 GTGGAGGAGCGGGAAGAGGAGGG - Intronic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1036487229 8:9190218-9190240 ATGGGAGGGAGGAAAGAGGAAGG - Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036638168 8:10565437-10565459 ATGGGGGAGTGGGAAGAGTGGGG - Intergenic
1036658899 8:10695089-10695111 ATGGGGGAGGGGAAGGGGAATGG + Intronic
1036755627 8:11468931-11468953 GTGGGCCAGAGGAAAGAGGAAGG + Intronic
1036800118 8:11784706-11784728 CTGGTGGAGCTGAAAGAGTATGG + Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037582355 8:20253164-20253186 ATGGGGGAGCGGACACACGAGGG + Exonic
1037753238 8:21696095-21696117 AAGGAGGAGGGGACAGAGGAGGG - Intronic
1037753453 8:21697079-21697101 ATGGGACAGAGGAAAGGGGAAGG + Intronic
1037760410 8:21738159-21738181 ACGGGGGAGGGGGATGAGGAGGG - Intronic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1037809031 8:22075298-22075320 AAGGGGGAGGGGGAGGAGGAGGG - Intronic
1037886665 8:22599415-22599437 GTAGGGGAGCGGCGAGAGGAGGG - Intronic
1037992568 8:23331190-23331212 AGGGGAGAGGGGAAAGAGGGAGG + Intronic
1038040730 8:23722239-23722261 GTGGGGGAGAGGGAGGAGGATGG + Intergenic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038244130 8:25838438-25838460 ATGGGAGAGGGGAAAGAAAAAGG + Intergenic
1038523804 8:28256391-28256413 AGGGGAGAGGGGAGAGAGGAGGG + Intergenic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038792630 8:30681872-30681894 TGGGGGCAGGGGAAAGAGGAAGG + Intronic
1039412012 8:37362741-37362763 AGGGGTGAGGGGAAAGGGGAGGG + Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039927590 8:41950932-41950954 AAGGGAGAGGGGAGAGAGGAAGG + Intronic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1041311109 8:56517503-56517525 GAGGAGGAGGGGAAAGAGGAGGG - Intergenic
1041636653 8:60153092-60153114 AGGGAGGAGGGGACAGAGGAGGG + Intergenic
1041728054 8:61036580-61036602 AGGAGGGAGAGGGAAGAGGAGGG - Intergenic
1041769155 8:61454316-61454338 AGGGGGGAAAGGAGAGAGGAGGG - Intronic
1042360388 8:67876323-67876345 AGGGTAGAGAGGAAAGAGGAGGG + Intergenic
1043934774 8:86130785-86130807 ATGGGGAAGAGGACAGAGGCAGG - Intronic
1044458897 8:92421705-92421727 ATGGGGGATGGAAAAGAGAAGGG + Intergenic
1044460421 8:92438160-92438182 ATGGGGGAAGAGAAAAAGGATGG - Intergenic
1044540146 8:93399516-93399538 ATGGGGAAGCTGCAAGAAGAGGG + Intergenic
1045015056 8:97994205-97994227 GAGGGGGAAGGGAAAGAGGAAGG + Intronic
1045098780 8:98825485-98825507 ATCGGGGAGCGGGAAGAAGGAGG - Intronic
1045274280 8:100688319-100688341 AAGGGAGAGAGGAAAGAGAAGGG + Intronic
1046018264 8:108632222-108632244 ATAGGGGAAAGGAAAAAGGATGG + Intronic
1046795101 8:118363159-118363181 ATAGGGGAGTGGAAAGAGCATGG + Intronic
1047023618 8:120804247-120804269 ATGGGTGGAAGGAAAGAGGAAGG - Intronic
1047191901 8:122685987-122686009 ATGGTGGAGCAGAAAGCGTAAGG + Intergenic
1048182058 8:132204476-132204498 ATGGGGGACCAGAATGAGGCTGG - Intronic
1048516570 8:135116800-135116822 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1049122018 8:140747640-140747662 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1049201209 8:141341492-141341514 GTGGGGGTGGGGGAAGAGGAGGG + Intergenic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1049712396 8:144071232-144071254 AGGGGGGAGGGGAAGGGGGAGGG - Intergenic
1049794893 8:144492749-144492771 AGGAGGGTGCAGAAAGAGGATGG - Intronic
1051522806 9:18009159-18009181 ATTGGGGAGGAGAAAGAGAAAGG - Intergenic
1051544556 9:18259602-18259624 AGAGGGGAGCAGAAAGAGGAGGG - Intergenic
1052395638 9:27934809-27934831 ATGGCAGAGTGGAAAGAGGATGG + Intergenic
1052918200 9:33939994-33940016 GAGGAGGAGGGGAAAGAGGAGGG + Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053054707 9:34987778-34987800 AAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1053113574 9:35482539-35482561 ATGGGGAAGGGAAAAGAAGATGG + Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055869337 9:80855336-80855358 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1056472034 9:86915048-86915070 AAGGGAGAATGGAAAGAGGAAGG + Intergenic
1056604936 9:88077828-88077850 ATGGGAGAGGGGAGAGGGGAGGG + Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1057211993 9:93205475-93205497 ATGGGGGAGATGACAGAGGCTGG - Intronic
1057757885 9:97852291-97852313 ATGGGGGAGTGGGAAGAGAGCGG - Intergenic
1058163518 9:101595093-101595115 GAGAGGGAGCGGAGAGAGGAGGG + Intronic
1058732566 9:107864394-107864416 TTGGGGGAACTGAAAGATGATGG - Intergenic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059226118 9:112674768-112674790 AAGGAGGAGAGGAAAGAGGGGGG - Intergenic
1059721765 9:116966785-116966807 ATGGGGAAGGGGAAAGAGTGTGG - Intronic
1059984620 9:119809956-119809978 ATGGGGGAGAGGATAGAAGGTGG - Intergenic
1060150287 9:121284068-121284090 AGGGGGGCGTGGCAAGAGGAGGG + Intronic
1060214777 9:121732129-121732151 AAGAGGCAACGGAAAGAGGACGG - Intronic
1060479452 9:124009395-124009417 ATGGGGGAGTGGAAAGTCGCAGG + Intronic
1060528279 9:124332778-124332800 ATGCGGGATCTGAAAGAGGGAGG - Intronic
1061374485 9:130215920-130215942 ATGGGGGAGGGCAGAGAAGAGGG - Intronic
1061465821 9:130778651-130778673 CTGGGGGATCTGAAAGTGGATGG - Intronic
1061566822 9:131446358-131446380 AAAGGGGAGAGGGAAGAGGAGGG - Intronic
1061587619 9:131578954-131578976 AAGGGGAAGCGGAAAGTGAAAGG + Exonic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062097981 9:134712495-134712517 AAGGGGGACAGGAAGGAGGAGGG - Intronic
1062143737 9:134976727-134976749 ATGGGGGAGGGGGAAGGGGGAGG - Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062703966 9:137924360-137924382 AAGGAGGAGGGGAAAGAGGGAGG - Intronic
1203732497 Un_GL000216v2:103597-103619 ACGGGGGGGCAGAAAGAGGCTGG - Intergenic
1203707786 Un_KI270742v1:68399-68421 CTGGGGATGCGGACAGAGGAGGG - Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1186036474 X:5428882-5428904 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1186293233 X:8121860-8121882 ATGGGGGAGGGGGGAGGGGATGG - Intergenic
1186356803 X:8799600-8799622 ATGGGGGAAGGGGAGGAGGAGGG - Intronic
1186357130 X:8800715-8800737 ATGGGGGAAGGGGAGGAGGAGGG - Intronic
1186946255 X:14571049-14571071 AGGGGGGAGCAGGAAGAAGAGGG + Intronic
1187045982 X:15647540-15647562 AGGGGGGAGGGGAAGGGGGAGGG + Intronic
1187051961 X:15703842-15703864 AGGGGGGAGGGGAAGGGGGAGGG + Intronic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1187775654 X:22753791-22753813 ATTTGGTAGCGGAAAGAAGATGG + Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188360230 X:29243968-29243990 GTGGGGGAGAGGGAAAAGGAGGG - Intronic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189288327 X:39867572-39867594 ATGGGGGTGCGGAAGGTAGATGG - Intergenic
1189443151 X:41055809-41055831 ATGGGGGAAGGGAATGAGGTAGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190558646 X:51664858-51664880 ATGGGGGAGGGGAAAGATATTGG + Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190775533 X:53549571-53549593 ATGGGGGAGGGGAATGAGCTAGG + Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1190932675 X:54962601-54962623 ATTGGGGAGAGGAAGGAAGAGGG + Intronic
1192089723 X:68140920-68140942 ATGGGGAATTGGAAAGGGGATGG - Intronic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192438080 X:71154899-71154921 GGGGGGCAGCAGAAAGAGGAAGG - Intronic
1194348524 X:92796048-92796070 AAGGGGGAGGGGAGAGGGGAGGG + Intergenic
1195004823 X:100675530-100675552 ATTGGAGAGGAGAAAGAGGAAGG + Exonic
1195061140 X:101196018-101196040 GTGAGGGAGCAGAAAGAGGTGGG - Intergenic
1195112827 X:101664657-101664679 TAGGGGGAGGGGAAGGAGGAAGG - Intergenic
1195283234 X:103357256-103357278 AAGGGGGAGAGAAAAGAAGAGGG - Intronic
1196019070 X:110970596-110970618 GTGGGTGGGGGGAAAGAGGAGGG + Intronic
1196237472 X:113299834-113299856 AGAGGGGAGGGGAGAGAGGAGGG - Intergenic
1196481597 X:116156667-116156689 GTGGGGGAGAGGGAAAAGGAGGG + Intergenic
1196545042 X:116952843-116952865 ATGGTGTAGTGGAAAGATGATGG + Intergenic
1196568319 X:117235025-117235047 GTGGGAGTGGGGAAAGAGGAAGG - Intergenic
1197841687 X:130754736-130754758 AAGGGGGAGGGGAGAGAGGAAGG + Intronic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198056651 X:133002313-133002335 AAGAGGGATAGGAAAGAGGAGGG + Intergenic
1198298548 X:135310677-135310699 GTGGGGGAGGGGACACAGGAAGG - Intronic
1198478858 X:137022432-137022454 ATGGGAGATTGGAATGAGGAGGG + Intergenic
1199381355 X:147176322-147176344 ATGCTGGAGGGGAAAGAGGAAGG + Intergenic
1199453229 X:147996999-147997021 ATGGAGGAGGGGAAAAAGGCTGG + Intronic
1199575688 X:149311748-149311770 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1199765881 X:150941484-150941506 AGGTGGGAGCAGACAGAGGAGGG + Intergenic
1200105699 X:153710865-153710887 ATCGGGGAGCAGAAGGAAGAGGG - Intronic
1200656855 Y:5912685-5912707 AAGGGGGAGGGGAGAGGGGAGGG + Intergenic
1200788524 Y:7279616-7279638 ATTGGAGAGAGGAGAGAGGAGGG + Intergenic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic
1201550135 Y:15210514-15210536 AGGGAGGAGGGGAGAGAGGAAGG + Intergenic
1201930726 Y:19343520-19343542 AAAGGGGAGTGCAAAGAGGAAGG - Intergenic
1202017426 Y:20425256-20425278 AGGGCTGAGAGGAAAGAGGAGGG + Intergenic
1202133684 Y:21638187-21638209 ATTGTGGTGAGGAAAGAGGATGG - Intergenic