ID: 984989713

View in Genome Browser
Species Human (GRCh38)
Location 4:185368393-185368415
Sequence CCATGGCAGGCAGTGTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984989713_984989721 18 Left 984989713 4:185368393-185368415 CCATAACACACTGCCTGCCATGG 0: 1
1: 0
2: 1
3: 24
4: 237
Right 984989721 4:185368434-185368456 CCCAACCTGTTCCCTTCCTGCGG 0: 1
1: 1
2: 2
3: 27
4: 272
984989713_984989723 19 Left 984989713 4:185368393-185368415 CCATAACACACTGCCTGCCATGG 0: 1
1: 0
2: 1
3: 24
4: 237
Right 984989723 4:185368435-185368457 CCAACCTGTTCCCTTCCTGCGGG 0: 1
1: 1
2: 3
3: 29
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984989713 Original CRISPR CCATGGCAGGCAGTGTGTTA TGG (reversed) Intronic
901357676 1:8665378-8665400 CTGTGCCAGGCAGTGAGTTAAGG - Intronic
903723858 1:25426661-25426683 CCATGGAAGTCAGTGTGGCATGG - Intronic
903993996 1:27293724-27293746 CCAAGCCATGCAGTGTGTGAGGG - Intronic
904618300 1:31761452-31761474 CGAAGGCAGGCAGCCTGTTAGGG - Intronic
905318944 1:37101967-37101989 CTATGCCAGGCACTGAGTTAGGG - Intergenic
906303635 1:44702180-44702202 ACATGCCAGCCACTGTGTTAGGG + Intronic
908303400 1:62784740-62784762 ATATGCAAGGCAGTGTGTTATGG - Intronic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
909600367 1:77455417-77455439 CCATGGCAGGCAATGTTTGCTGG + Intronic
910629086 1:89338351-89338373 CTATGGTAAGCAGAGTGTTAAGG - Intergenic
912705381 1:111907916-111907938 CTAAGACAGGCAGTGTGTTCTGG - Intronic
912826086 1:112904791-112904813 CCATGTCAGGCACTATGCTAAGG + Intergenic
913195875 1:116455456-116455478 CCATGGGAGGCAGTGTGGGGTGG - Intergenic
915090414 1:153420223-153420245 CCAGGCCAGGCAGTGTGTTATGG + Exonic
915095077 1:153456870-153456892 CCAGGCCAGGCAGTGTGCTATGG - Intergenic
916022620 1:160807604-160807626 CCCTGGCAGTCAGTGTGGCATGG + Intronic
917635064 1:176927656-176927678 ACATGCCAGGCACTGTGTCAGGG + Intronic
918117356 1:181508669-181508691 CCTTGGCAGGCTGTATGTTGGGG + Intronic
918250619 1:182699939-182699961 CCAGGGCAGGCACTGTGTGAGGG - Intergenic
919970030 1:202569924-202569946 CCATGGGAGGCAGTGGGGCAGGG + Intronic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
1064145467 10:12823206-12823228 CCAGGGCAGTCAGTGTCTCAGGG + Intronic
1065630177 10:27671786-27671808 CCTTGGAAGGCGGTGTGTTGTGG - Intergenic
1066650790 10:37653003-37653025 GCATGGCAGGCAGTTTGCTAAGG + Intergenic
1067474842 10:46558140-46558162 CCCTACCAGGCAGTGTGTGATGG - Intergenic
1068173218 10:53422509-53422531 CCATGGCAGGTAGGGGGGTAAGG - Intergenic
1070670912 10:78376621-78376643 CCCTGTCAGGCAGTGTGTTGGGG + Intergenic
1072249978 10:93573722-93573744 TCAGGGCAGGAAGTGTGATAAGG - Intronic
1072269470 10:93761641-93761663 CCATGGCTGGCAGTTTGTGTTGG + Intronic
1073081376 10:100863109-100863131 CCATGGGAGTCAGAGTGTTGAGG + Intergenic
1073779948 10:106826096-106826118 CCTTTGCAGGCAGCTTGTTAGGG - Intronic
1074887116 10:117702587-117702609 CCATGGCAAGCTGTGTATTTAGG - Intergenic
1075201107 10:120405006-120405028 GTATGTCAGGCAGTGTGTTAGGG - Intergenic
1075252045 10:120888214-120888236 GCATGGCAGGCATTGCTTTAAGG + Intronic
1075536030 10:123273060-123273082 CCATGGAACTCAGTGTGTCAAGG + Intergenic
1075661039 10:124196738-124196760 CCATGGCTGGGAGTCTGTGAGGG + Intergenic
1075956502 10:126527759-126527781 ACATGCCAGGCAGCGTGCTAAGG - Intronic
1076919056 10:133441910-133441932 GCGTGGCAGGCGGTGTGTTGGGG + Intergenic
1078048659 11:7942118-7942140 CAATGGTAGGAAATGTGTTATGG + Intergenic
1078483959 11:11704931-11704953 CTGTGGCAGGCTGTGTGCTACGG - Intergenic
1078659344 11:13274509-13274531 GTATGCCAGGCACTGTGTTAAGG + Intergenic
1078794977 11:14583456-14583478 AGATGGGAGGCAGTGTGTTGGGG - Intronic
1078915219 11:15772412-15772434 CCAGGGAAGGCAGTGTGGTGAGG - Intergenic
1085215107 11:74822886-74822908 GTATGCCAGGCACTGTGTTAGGG + Intronic
1085986673 11:81795985-81796007 CCATGGAAGGCAGTGGTTTTTGG - Intergenic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1086867488 11:91997847-91997869 CTATGGTAGGAAGTGTGTCATGG - Intergenic
1088699402 11:112398525-112398547 CCATGAGAGGCAGTGTGGTATGG + Intergenic
1088825497 11:113490344-113490366 CAATGGCAGTCAGTATGTTCAGG - Intergenic
1089613757 11:119684019-119684041 CCATGGCAGGCAGGGCCTTGGGG - Intronic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1092071258 12:5633305-5633327 CCATGGCAGGCAGTGGCGGATGG - Intronic
1092312474 12:7373504-7373526 CCATAGCAGGCATTGTGTGCAGG - Exonic
1092812596 12:12285734-12285756 CCATGGCTAGCAGTTTGTTGTGG + Intergenic
1095736799 12:45566441-45566463 CTGTGCCAGGCATTGTGTTAAGG + Intergenic
1096069352 12:48766377-48766399 GCATGGCTGGCACTGTGGTACGG + Exonic
1096408353 12:51359783-51359805 CCTAGGCAGCCAGTGTGCTAAGG - Intronic
1097595336 12:61621538-61621560 CCTTGGCAGTCAGTGTGCCATGG - Intergenic
1098634002 12:72758180-72758202 CCTTGTCAGGCAGTGTGTTGTGG - Intergenic
1101426249 12:104590979-104591001 CCATGGGAGACAGTGTGTCCAGG + Intronic
1101513331 12:105411969-105411991 CCACAGCAGGCAGTGTGAAATGG - Intergenic
1102347479 12:112169167-112169189 CCATGAGAGGCAGGGTGTTGGGG - Intronic
1105518215 13:21109406-21109428 CCATGGCATGCAGGGTGTGCAGG + Intergenic
1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG + Intergenic
1109129989 13:58573388-58573410 ACATGGCAGGTAGGGTATTAGGG + Intergenic
1112486625 13:99825984-99826006 ACATGGTAGGCAGTGGCTTATGG + Intronic
1112577970 13:100653793-100653815 CCCTGGCAGGCTTTGAGTTATGG - Intronic
1113443497 13:110347641-110347663 CCAGGGCATGCAGTGTGTGGTGG - Intronic
1113641676 13:111962146-111962168 CCATTTCAGGCAGTATTTTAAGG - Intergenic
1114669800 14:24403637-24403659 ACATGCCAGGCACTGTTTTAGGG - Intronic
1115159883 14:30381888-30381910 CCTTGGCAGGTAGTGTGTAAGGG + Intergenic
1116915528 14:50521340-50521362 GCATGGCAGACAATGTGTTAAGG + Intronic
1117024795 14:51608456-51608478 TCATGCCAGGCATTGTGTTAAGG - Intronic
1118414591 14:65521813-65521835 ACATGGCAGGCAATTTGTTGTGG + Intronic
1119903666 14:78282577-78282599 CCCTGGCAGGCACTGTGGGAGGG + Intronic
1120426819 14:84359041-84359063 CCATAGCAGGCATTCTGTTTTGG + Intergenic
1121309275 14:92926394-92926416 ACATGGTAAGCACTGTGTTAAGG + Intronic
1121599030 14:95189054-95189076 CCAAGCCCAGCAGTGTGTTATGG - Exonic
1122014685 14:98784701-98784723 CCATGCCAGGCACTGTACTAGGG - Intergenic
1123056342 14:105572373-105572395 CCTTGGCAGGCAGTGGGTACAGG - Intergenic
1123057589 14:105579434-105579456 CCTTGGCAGGCAGTGGGTACAGG + Intergenic
1123080775 14:105692501-105692523 CCTTGGCAGGCAGTGGGTACAGG - Intergenic
1123081866 14:105699367-105699389 CCTTGGCAGGCAGTGGGTACAGG + Intergenic
1124680833 15:31729424-31729446 ATATGGCAGGCAATGGGTTATGG + Intronic
1125672598 15:41484871-41484893 CCTTGGCAAGGAGGGTGTTAAGG + Intergenic
1125695447 15:41633279-41633301 ATATGCCAGGCATTGTGTTAAGG + Intronic
1126751172 15:51878029-51878051 CCAAGGCAGCCAGTGTTTGAAGG - Intronic
1127693961 15:61425825-61425847 TCATGGCAGGAAGTGTGCTAGGG - Intergenic
1127922956 15:63507689-63507711 CCATGGAAGGCACTGTGTGTTGG + Intronic
1128792146 15:70441327-70441349 GCATGGGAGGCAGTGTGTTTTGG - Intergenic
1130679156 15:85981269-85981291 CCAAGGCAGACAGTGTGTGTGGG + Intergenic
1136316579 16:29458040-29458062 CCAGGGCAGGGAGTGGGGTAGGG - Intronic
1136431155 16:30197382-30197404 CCAGGGCAGGGAGTGGGGTAGGG - Intronic
1139214752 16:65116376-65116398 GCATGGCAACCAGTGTGGTAGGG - Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142622821 17:1175788-1175810 CAAAGGCAGGAAGTGTGTTCAGG + Intronic
1144557318 17:16293659-16293681 CTATGCAAGGAAGTGTGTTAGGG - Intronic
1144745676 17:17612583-17612605 GCCTGGCAGGCATTGTATTATGG + Intergenic
1146475739 17:33161250-33161272 GTATGCCAGGCAGTGTGCTAAGG + Intronic
1146787019 17:35729718-35729740 ACATGCCAGGCATTGTGTTAAGG + Intronic
1147190352 17:38734831-38734853 CCAAGGCAGGTGGTGTGTTGGGG - Exonic
1148677147 17:49452076-49452098 CCATTACAGGAAGTGTGTTGGGG + Intronic
1148996122 17:51711566-51711588 CCATCGCAGGCTGTGTCTAAAGG - Intronic
1149423393 17:56532001-56532023 CCATGGAAGGCAGACTGGTATGG + Intergenic
1151197216 17:72440178-72440200 CCATGGCAAGAAGTCTTTTATGG + Intergenic
1151400413 17:73852323-73852345 CCATTGTAGGCAGTGTGGCAAGG - Intergenic
1151849374 17:76681348-76681370 CCAGGGCTGGCAGTGTGTCTTGG - Intronic
1203171631 17_GL000205v2_random:153762-153784 GCATGGCATACAGTGAGTTATGG - Intergenic
1154175481 18:12085461-12085483 CCATGGCGGGGAGTGGGTTATGG + Intergenic
1159780759 18:72658150-72658172 CAATAGCAGGCAGGATGTTAGGG - Intergenic
1161739092 19:6009354-6009376 TCATGGCAGGCTCTGAGTTAGGG + Intronic
1163333544 19:16657111-16657133 GCGTGCCAGGCAGTGTGCTAAGG - Intronic
1164703561 19:30303318-30303340 CCATGGCAGGCTCTATGTGATGG + Intronic
1166387690 19:42391287-42391309 ACATGGGGGGCAGTGTGTTTTGG + Intergenic
927865060 2:26582950-26582972 CCATGTCAGGCAGTGAGGTGGGG + Intronic
927904221 2:26846039-26846061 CTATGCCAGGCAATGTGCTATGG + Intergenic
928671045 2:33603618-33603640 CCAGGAAAGGCAGTGTGGTATGG - Intergenic
931881129 2:66572160-66572182 CTGTTGCAGGCAGTGTCTTAAGG + Exonic
936876837 2:117200281-117200303 CCATGATAGGCATTGTGCTAGGG - Intergenic
937790711 2:125958017-125958039 AAAAGGCAGGCAGTGTGTGAAGG - Intergenic
940825227 2:158404103-158404125 CTATACCAGGCACTGTGTTAAGG - Intronic
941124745 2:161571371-161571393 CCCAGGCAGGCAGTGTGGTCAGG + Intronic
944949648 2:204732965-204732987 TCATGGCAGGCACTCTGCTAGGG - Intronic
946009762 2:216555124-216555146 CCATAGCAGGCAGTTTTATATGG + Intronic
946018814 2:216625443-216625465 GCATACCAGGCAGTGGGTTAAGG + Intergenic
948170631 2:235898969-235898991 CCTTGGCAGGCATTATGTTTAGG + Intronic
1170148729 20:13205752-13205774 ACAAGGCAGAGAGTGTGTTATGG - Intergenic
1172114813 20:32567360-32567382 CCATGGCAGCTAGTGTGTCTGGG - Intronic
1172272049 20:33660248-33660270 CCATGGCTGGCGGTATGTAAGGG - Exonic
1172330643 20:34074061-34074083 GCATGGCAGACAGTGTTGTATGG - Intronic
1173130627 20:40389689-40389711 CCATGGCAGGCAGTCAGGAAGGG + Intergenic
1173332768 20:42088853-42088875 CCATGCCTGGCACTGTGGTAAGG - Intronic
1174280417 20:49435048-49435070 CCATGGTGGGCCCTGTGTTAGGG - Intronic
1174487389 20:50870034-50870056 CAATGGCAGGCTGGGTGTGATGG - Intronic
1175183637 20:57165609-57165631 CCATGGCGGGCAGTGGGTACAGG - Intergenic
1175540302 20:59743927-59743949 CCAGGGCTGGCAGGGTGTGAGGG - Intronic
1176327612 21:5515594-5515616 GCATGGCATACAGTGAGTTACGG - Intergenic
1176400145 21:6305357-6305379 GCATGGCATACAGTGAGTTACGG + Intergenic
1176437012 21:6683747-6683769 GCATGGCATACAGTGAGTTACGG - Intergenic
1176461274 21:7010817-7010839 GCATGGCATACAGTGAGTTACGG - Intergenic
1176484835 21:7392595-7392617 GCATGGCATACAGTGAGTTACGG - Intergenic
1178137957 21:29649504-29649526 CCTGGGCAGGAAGTGTGATAAGG - Intronic
1179514568 21:41897802-41897824 CCATGGCAGGCTGTGGGCTTTGG + Intronic
1180834231 22:18921889-18921911 GCAAGGCTGGCAGTGTGTGAGGG + Intronic
1180865424 22:19116141-19116163 CCATGGCAGGCAGTTGGGTATGG - Intronic
1181065582 22:20304214-20304236 GCAAGGCTGGCAGTGTGTGAGGG - Intergenic
1181901752 22:26161673-26161695 CCATGGAAGGCTGTAGGTTAAGG + Intergenic
1182022035 22:27089515-27089537 CCATGCCAGGCACTGTCCTAGGG + Intergenic
1183785480 22:40026778-40026800 CCCTGGCTGGCAGTGTGGTCTGG + Intronic
1184419750 22:44372829-44372851 CCATGGGAGGCAGTGGGTATTGG + Intergenic
1203284320 22_KI270734v1_random:147188-147210 GCAAGGCTGGCAGTGTGTGAGGG + Intergenic
950471814 3:13191009-13191031 CCATGGCAAGGGGTGTGTTGGGG - Intergenic
951835567 3:26979762-26979784 CCATGGCAGGCAGCGAGTATAGG + Intergenic
951862585 3:27270324-27270346 CCATGGCTGGCAATGGGTTCTGG - Intronic
953796231 3:45988115-45988137 GCCTGGCAGGCAGTTTCTTAGGG - Intronic
955399700 3:58582718-58582740 CCATGGCAGCCACGGTGTGAAGG - Intronic
958458240 3:94360298-94360320 ACATGCCAAGCAATGTGTTATGG + Intergenic
960992738 3:123322428-123322450 ACATGGCAAGCAGTGTGGTTAGG - Intronic
961329436 3:126130058-126130080 CCATGCCAGGCATTGTTGTAAGG - Intronic
962027392 3:131562761-131562783 CCAATGCAGGCAGTGGGTGAGGG - Intronic
962478688 3:135779972-135779994 GCATGGCAGGCAGCGGGTGAGGG - Intergenic
962938329 3:140102213-140102235 CCTTGGCAGGGGCTGTGTTAGGG + Intronic
964493944 3:157268268-157268290 GCCCGGCAGGCACTGTGTTAAGG - Intronic
964723483 3:159791034-159791056 CCAAGGCAGGCAAGGTGTGAGGG - Intronic
966296874 3:178434188-178434210 TCATGGGAGGTAGTGTGATAGGG + Intronic
967141893 3:186568494-186568516 CCATGCCAGGCACTGTTCTAAGG + Intronic
967221974 3:187254991-187255013 CCATGGCAGGCAGAATTCTAGGG + Intronic
967864150 3:194176431-194176453 CCATGGCAGGCAGAGGCTTCTGG + Intergenic
968413642 4:409488-409510 ATATGGCAGGCAGTAGGTTAGGG + Intergenic
969119509 4:4897588-4897610 CAAAGGGAGGCAGTGTGATAAGG + Intergenic
970971012 4:21984101-21984123 CCATGACAGGCAGTAGATTAGGG + Intergenic
971675745 4:29626402-29626424 CCATGCCAGGCACTGTTGTATGG - Intergenic
971831577 4:31701993-31702015 CCCTCGCAGGCCGTGTGTCAGGG - Intergenic
972816933 4:42656040-42656062 ACATGGCAGGCAGGATGTTGAGG + Intronic
973044454 4:45518974-45518996 CCCTGGCAGGGAGTGTGCCAGGG + Intergenic
973210125 4:47606084-47606106 CTATGCCAAGCATTGTGTTAGGG + Intronic
978407553 4:108396016-108396038 CAAGGGCAGGCAGTATGATAGGG + Intergenic
980083929 4:128372152-128372174 CCATGCCAGGCACTGCGTTATGG - Intergenic
981232942 4:142379809-142379831 CCACGTCAGGCACTGTGTAAGGG + Intronic
981324852 4:143434161-143434183 CCATTGCAGTGAGTGTGTTGTGG + Intronic
982071700 4:151701241-151701263 CCATGGCAGCCTGTGTGTGGCGG + Intronic
984989713 4:185368393-185368415 CCATGGCAGGCAGTGTGTTATGG - Intronic
985534784 5:457995-458017 CAATGGCAGGGAGTGTGGTCTGG - Exonic
988411190 5:30887984-30888006 GCAAGGCAAGCAGTGTGTCAGGG - Intergenic
990355889 5:54965813-54965835 CCATGGCAACCACTGTGTTATGG - Intergenic
990826096 5:59899765-59899787 ACATGGCAGCCAGCTTGTTATGG + Intronic
990943879 5:61230174-61230196 CCAAAGCAGGCTGTGTGTGAGGG - Intergenic
991423142 5:66462162-66462184 CAATGCCAGGCACTGTGCTAGGG + Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
992115463 5:73534726-73534748 CAATGGCAGGCAGTGAGGGAGGG + Intergenic
994247897 5:97501438-97501460 ACATGGCAGACAGTGTGCTCAGG + Intergenic
995220916 5:109646893-109646915 CCATGACAAGCATTGTGCTAGGG - Intergenic
996345248 5:122480456-122480478 CCATGACTGGCATTCTGTTATGG - Intergenic
996628521 5:125599968-125599990 TCTTGGCAGGCAGTGGGGTAAGG - Intergenic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
997956541 5:138283033-138283055 CTAGGGTAGGCAGTGAGTTAAGG + Intergenic
998141362 5:139701394-139701416 CCTTGGAAGGAAGTGTGTGAGGG - Intergenic
998502494 5:142645626-142645648 ACATGCCAGGCATTGTGATAAGG - Intronic
1000132932 5:158317608-158317630 CCATGGGAGGGAGTGTGATGGGG - Intergenic
1000804806 5:165776790-165776812 AAATGGCAGGAAGTGTGTAATGG + Intergenic
1000900759 5:166909204-166909226 CCAGGTCAGGCAGTGAGTCATGG - Intergenic
1001949201 5:175804340-175804362 CCAAGGCAGGCAGTGTTCTCTGG - Intronic
1004907071 6:20246101-20246123 AAATGTCAGGCAGTGTTTTAGGG + Intergenic
1007775946 6:44224352-44224374 CCATGCCAGGATGTGTGTGATGG + Intronic
1007999122 6:46340019-46340041 TTATGGCAGGCAATGTGCTAAGG - Intronic
1011617325 6:89209027-89209049 CCAGGGCTGTCTGTGTGTTAGGG - Intronic
1012354428 6:98296025-98296047 CAATGACAGGCAGGGAGTTAGGG - Intergenic
1012696255 6:102388256-102388278 ATATGTCAGGCATTGTGTTAAGG - Intergenic
1015318264 6:131842053-131842075 CCTAGGCAGGCAGAGTGTAAAGG - Intronic
1015409453 6:132876690-132876712 CCAGGTCAGGCAGGGAGTTAGGG + Intergenic
1018212463 6:161495673-161495695 CCATGGCTGGCTCTGTGGTAAGG - Intronic
1018693531 6:166370088-166370110 CCATGGCTGGCAGGTTGTGAAGG - Intronic
1018796521 6:167189713-167189735 CTGTGGCAGGCATTGTTTTAGGG + Intronic
1018819799 6:167365404-167365426 CTGTGGCAGGCATTGTTTTAGGG - Intronic
1019256765 7:57349-57371 CCATGGCAGGCTGGGTGCTGGGG + Intergenic
1019736523 7:2652614-2652636 CAATGACAGGCAGTGTGTACAGG - Intronic
1020455731 7:8372023-8372045 CCATGGCAGGCAGGGAGGGATGG - Intergenic
1020472503 7:8555031-8555053 CCTTGGAAGGCAGTGTGGTTTGG + Intronic
1022046353 7:26625370-26625392 CCATGGTAGGGAGTGGGTTTGGG + Intergenic
1022562227 7:31361559-31361581 TCCTGGCAAGCAGTGTGTCAGGG + Intergenic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1031059842 7:117038699-117038721 ACTTGGAAGGCAGTGTATTAGGG + Intronic
1031221678 7:118974662-118974684 CCATGGCAGGGAGTACGTTGTGG - Intergenic
1031592693 7:123612559-123612581 CCATGGCTCGCACTGTGTTAAGG - Intronic
1031683415 7:124702995-124703017 CCATTCCAGCCAGTGTGGTAAGG - Intergenic
1036086130 8:5615202-5615224 ACTTTGAAGGCAGTGTGTTAAGG + Intergenic
1036562300 8:9907140-9907162 TCATGGCAGGCGTTGGGTTATGG - Intergenic
1039889459 8:41674250-41674272 ACATGCCAGGCACTGTGCTATGG + Intronic
1040516114 8:48136464-48136486 CCCTGCCAGGCAGTGGGTTAGGG + Intergenic
1041659852 8:60391152-60391174 CCATGGCAGGCAGACTGGGAAGG + Intergenic
1042130002 8:65579000-65579022 CCTGGGCAGGCAGTGTGGTGGGG + Intergenic
1044986660 8:97761887-97761909 CCATCACAGGCAGTTTGCTAAGG - Intergenic
1045144368 8:99323882-99323904 CCTTGACAGGCAGTATTTTAAGG + Intronic
1045461052 8:102426201-102426223 CAATGGCAGGAAGGGTGTTTAGG - Intergenic
1045536449 8:103033167-103033189 CCAGGGCTGGCAGTGAGATAGGG + Intronic
1046273331 8:111924768-111924790 TAATGCCAGGCACTGTGTTAAGG + Intergenic
1046908327 8:119598799-119598821 CCATGGAAGGGAGTGTGCTCTGG + Intronic
1047958120 8:129991235-129991257 GCCAGGCAGGCACTGTGTTAGGG - Intronic
1047986066 8:130234977-130234999 ATGTGGCAGGCAGTGTATTAGGG + Intronic
1048822345 8:138391710-138391732 CCATGTCAGGCACTGTTCTAAGG + Intronic
1049443629 8:142620144-142620166 CCACGGCAGGAAGTGTGTCTGGG + Intergenic
1049731854 8:144182214-144182236 CCAGGACAGGCAGTGTGCCAAGG + Intronic
1051155125 9:14134389-14134411 TCATGCCAGGCAGTATGCTAGGG + Intronic
1051276254 9:15401745-15401767 CTATGGCTGCCTGTGTGTTACGG - Intergenic
1052170526 9:25390116-25390138 CCATGCCAGGCCCTGTTTTAAGG + Intergenic
1053655088 9:40210662-40210684 CCAAGGCAGGCAGTGAGGTCTGG - Intergenic
1054367203 9:64356878-64356900 CCAAGGCAGGCAGTGAGGTCTGG - Intergenic
1054529511 9:66165652-66165674 CCAAGGCAGGCAGTGAGGTCTGG + Intergenic
1054674834 9:67846615-67846637 CCAAGGCAGGCAGTGAGGTCTGG - Intergenic
1055742766 9:79407918-79407940 CCACGGCAGGCACTGGGTGATGG - Intergenic
1057090473 9:92253629-92253651 ACATGGCAGTCAGAGTGTTTAGG + Intronic
1057733472 9:97632344-97632366 CCATGGCATGGAGTGTGCAATGG + Intronic
1060561513 9:124548903-124548925 CCATGGCAGGAAGTGGGATGGGG - Intronic
1060913244 9:127367903-127367925 TCATGTCAGGCAATGTGTTGTGG - Intronic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG + Intronic
1203434500 Un_GL000195v1:124913-124935 GCATGGCATACAGTGAGTTACGG + Intergenic
1185479537 X:435735-435757 CCATGGCCGGCCGTGAGTTCTGG - Intergenic
1186145077 X:6616638-6616660 CCACGCCACGCAGTGTCTTAAGG + Intergenic
1192194625 X:69019910-69019932 CCATGGCAGGCACTGTCTCAAGG + Intergenic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1198659736 X:138955294-138955316 ACATGGCAGGGAATGGGTTAAGG - Intronic