ID: 984998518

View in Genome Browser
Species Human (GRCh38)
Location 4:185461799-185461821
Sequence TATTGTGAGCAAAGTGTAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984998515_984998518 11 Left 984998515 4:185461765-185461787 CCATCTGAATCAGGCCAAGAGCC 0: 1
1: 0
2: 2
3: 14
4: 125
Right 984998518 4:185461799-185461821 TATTGTGAGCAAAGTGTAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 126
984998517_984998518 -10 Left 984998517 4:185461786-185461808 CCTCAGTCTAAACTATTGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 984998518 4:185461799-185461821 TATTGTGAGCAAAGTGTAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 126
984998516_984998518 -3 Left 984998516 4:185461779-185461801 CCAAGAGCCTCAGTCTAAACTAT 0: 1
1: 0
2: 1
3: 9
4: 116
Right 984998518 4:185461799-185461821 TATTGTGAGCAAAGTGTAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 126
984998513_984998518 22 Left 984998513 4:185461754-185461776 CCAGTCGGGATCCATCTGAATCA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 984998518 4:185461799-185461821 TATTGTGAGCAAAGTGTAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 126
984998512_984998518 23 Left 984998512 4:185461753-185461775 CCCAGTCGGGATCCATCTGAATC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 984998518 4:185461799-185461821 TATTGTGAGCAAAGTGTAGCCGG 0: 1
1: 0
2: 0
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984998518 Original CRISPR TATTGTGAGCAAAGTGTAGC CGG Intronic
901347289 1:8557104-8557126 GACTGTGAGAAAAGTGGAGCAGG + Intronic
902540631 1:17151909-17151931 TGTTGTGACCAAAGTGTTGATGG + Intergenic
904361380 1:29974796-29974818 TATAGTTTGCAAAGTGTACCAGG + Intergenic
908187170 1:61663631-61663653 TCTTGTGAGCAAAGGCTTGCAGG - Intergenic
911014823 1:93320983-93321005 TATTGTGAGAAAAGTGACTCAGG - Intergenic
916364431 1:164008412-164008434 GATTGTGAGCAAAGTTGAGTTGG + Intergenic
916487108 1:165269769-165269791 TATTCTCAGCAAACTGTTGCAGG + Intronic
920871178 1:209796462-209796484 TATTGAGAGCACAGCGCAGCTGG + Exonic
921874472 1:220178550-220178572 TTTTGTGATCAAAGTTAAGCTGG + Intronic
921946569 1:220889855-220889877 TTTCGTGAGCACAGTGTGGCTGG - Intergenic
923411404 1:233713556-233713578 TAATGTGAGCACAGTGTGTCGGG - Intergenic
1063699190 10:8368267-8368289 TATTTTTAGCAAACTGTTGCAGG + Intergenic
1066025668 10:31357373-31357395 TGTTGTGAGCAGAGTACAGCAGG + Intronic
1068505313 10:57893093-57893115 TATTCTGAGCCAAGTGTGGGTGG + Intergenic
1068891627 10:62154393-62154415 CAATGTGAGCAAAGTGTGCCTGG + Intergenic
1071199804 10:83208272-83208294 AATTGCTATCAAAGTGTAGCTGG + Intergenic
1072158094 10:92742105-92742127 TATTGGCAGCCAAATGTAGCTGG + Intergenic
1072781886 10:98257091-98257113 TAAGGTGAGGACAGTGTAGCAGG + Intronic
1074558618 10:114515189-114515211 AATTGTGAGCTCAGGGTAGCTGG - Intronic
1075240051 10:120770224-120770246 AAATGTGAGCAAAGTGCAGAGGG + Intergenic
1076360549 10:129885777-129885799 TGTTGTGAGCCAAGTGATGCTGG - Intronic
1077983624 11:7328191-7328213 TGTTGTAAGCAAAGTATAGCTGG + Intronic
1078152424 11:8770574-8770596 TTTTCTGAGCAAAATGCAGCAGG - Intronic
1078421464 11:11216368-11216390 CACTGTGGGCAAAGTGTGGCAGG + Intergenic
1080412521 11:32039082-32039104 ATTTGTTTGCAAAGTGTAGCAGG + Intronic
1081489318 11:43555140-43555162 TATTGTTAGCTAAGTGAAGAGGG + Intergenic
1081923946 11:46807204-46807226 TGTTGTGACCAAAGGGTTGCAGG + Intronic
1084885513 11:72203358-72203380 TCCTGTCAGCAAAGTATAGCAGG + Intergenic
1089305070 11:117521467-117521489 TACTGTGAGTGGAGTGTAGCTGG + Intronic
1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG + Intergenic
1095675731 12:44915700-44915722 GATTGTCAGTAAAGTGTTGCCGG - Intronic
1096595988 12:52695831-52695853 TTATGTGAGCAAAGTGGACCTGG - Exonic
1097411520 12:59259619-59259641 TATTCTGAGCAAAATGCAGATGG - Intergenic
1099845843 12:88027366-88027388 AATTGTGATCAAAGTGTCACTGG - Intronic
1100125012 12:91414013-91414035 TATTGTGAGTAAACTCTAGCTGG + Intergenic
1104023110 12:125006844-125006866 TTTTGTGAGAAAAGAGTAGCAGG - Intronic
1104458154 12:128932403-128932425 TAATGAGAGGAAAGGGTAGCTGG + Intronic
1105274563 13:18907002-18907024 TATTCTTAGCAAAATTTAGCGGG + Intergenic
1106119404 13:26846586-26846608 TCTTGTGAGCAGCATGTAGCTGG + Intergenic
1107421467 13:40251254-40251276 TCATGTGAGCAAAATGTTGCAGG - Intergenic
1107614416 13:42149613-42149635 GGTTGTGAGCAAAGTGCAGAAGG - Intronic
1108138453 13:47391842-47391864 CATTGTCAGCAAAGTGTACGAGG - Intergenic
1110150935 13:72252167-72252189 TATTGTAAGAGAAGTGTAGAGGG - Intergenic
1110723763 13:78795922-78795944 TATTGTTAGCTATGAGTAGCAGG - Intergenic
1117622014 14:57597220-57597242 TATTGTGAGTAAACTGTATTAGG + Intronic
1119342682 14:73893799-73893821 TATTCTGAACAAACTGTACCAGG - Exonic
1125680758 15:41528811-41528833 TTTTGTGAGCAGAGGGAAGCTGG + Intronic
1127771130 15:62231736-62231758 CTTTGTTAGCAAAGTGTGGCTGG + Intergenic
1135019133 16:18948941-18948963 TATTTTTAACAAAGTGTGGCTGG + Intergenic
1135819955 16:25675343-25675365 TATTCTCAGGAAAGTGCAGCTGG - Intergenic
1136452645 16:30362404-30362426 GATTGGGAGCAAAATGTAGTGGG - Intronic
1138141183 16:54569900-54569922 TATTGTGAGAAATGTGTGCCTGG + Intergenic
1145770833 17:27491899-27491921 GATGGTGAGCAGAGTATAGCAGG - Intronic
1147800697 17:43084629-43084651 AATTGTGAACTCAGTGTAGCAGG - Intronic
1150524092 17:65903526-65903548 TATTGTGATTAAAGAGTAGCGGG + Intronic
1151899723 17:77003994-77004016 TGTTGTGACTAAAGTGTGGCAGG + Intergenic
1160709151 19:542806-542828 TATTGTGAGTGAAGTGTTACTGG + Intergenic
1162501490 19:11056600-11056622 TAGTGTGTGTAAAGTGTGGCTGG + Intronic
1163273827 19:16270114-16270136 AATAGTGAGCAAAGTGTGTCTGG + Intergenic
1168601164 19:57719777-57719799 TATCATGAGCAATGTGAAGCAGG + Exonic
925192369 2:1894847-1894869 TGCTGTGAGCACAGTGTAGCAGG - Intronic
925315652 2:2921219-2921241 AACTGTGAGCAATGTGTTGCGGG - Intergenic
926635908 2:15179278-15179300 TACTGTGAACCAAGTGAAGCAGG - Intronic
931104912 2:59044840-59044862 AATTGTGAGGAAAGTAAAGCGGG + Intergenic
931598898 2:63982493-63982515 TATTGTGACCAAAGGCTCGCAGG - Intronic
932852875 2:75203401-75203423 TATTCTAAGCAAACTGAAGCAGG - Intergenic
936863434 2:117050282-117050304 TATTGTGAGCCAAGAGAATCAGG - Intergenic
937177134 2:119950126-119950148 TATTTTGTGCATAGTGTAGTTGG - Intronic
947520613 2:230843353-230843375 TGTTGTGAACAAAGTCTACCAGG - Intergenic
947929904 2:233955839-233955861 TAATGTGAGCAATGGGGAGCTGG - Intronic
948682167 2:239642434-239642456 TAGGGTGTGTAAAGTGTAGCTGG + Intergenic
948682283 2:239643375-239643397 TAGGGTGTGTAAAGTGTAGCTGG + Intergenic
1169003665 20:2189032-2189054 TATTGTGAACAGAGTGTAGAGGG - Intergenic
1175592414 20:60203701-60203723 TAGTGTGGGCAAAAGGTAGCAGG + Intergenic
1177176398 21:17704708-17704730 TATTGTTAGCAAATTTCAGCTGG - Intergenic
1182956169 22:34428723-34428745 TTTTGTGAAAAAACTGTAGCGGG - Intergenic
949196597 3:1317119-1317141 TAATGGGAGAAAAGTGAAGCAGG - Intronic
951375722 3:21913785-21913807 TATTGTGATCAAAGGGTGGGAGG - Intronic
952612108 3:35224352-35224374 TATTGTGATCAAATTGGGGCTGG + Intergenic
953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG + Intergenic
955222212 3:57032501-57032523 CATGGTGAGCAAAGTTTTGCTGG + Intronic
956224489 3:66941063-66941085 AAGTGTGGGCAAAGTGTCGCAGG + Intergenic
962152059 3:132903332-132903354 TATTCTGAGCCACCTGTAGCTGG - Intergenic
963168279 3:142226596-142226618 TATTGTGTGCAAACTTTACCAGG - Intergenic
963460029 3:145600317-145600339 CATTGAAAGCAAAGTGTAGAAGG - Intergenic
964336845 3:155663668-155663690 TACTGTGTGCAAAGGATAGCTGG - Intronic
964696007 3:159508619-159508641 TATTTAGAGCAGTGTGTAGCGGG - Intronic
967528814 3:190525468-190525490 GATTTTACGCAAAGTGTAGCAGG + Intronic
967854919 3:194110239-194110261 TATTGAGAGCCAAGTATAGTTGG + Intergenic
967929806 3:194682830-194682852 GACTGTCAGCAAAGTGGAGCTGG - Intergenic
969500852 4:7552129-7552151 CATTTTGTTCAAAGTGTAGCAGG - Intronic
970156515 4:13147509-13147531 TATGGTCAGGAAAGTGAAGCTGG + Intergenic
972773566 4:42220753-42220775 TACTGTGAACAAAGCGGAGCAGG - Intergenic
974142391 4:57903690-57903712 TAGTGGGAGCCCAGTGTAGCTGG + Intergenic
975392751 4:73837904-73837926 TATTGTGAGCAAAGAATCACTGG + Exonic
976187872 4:82460369-82460391 TAGTGAGGGCAAAGTGTAGTTGG + Exonic
976972738 4:91127474-91127496 TTTTGACAGCAAAGTGTTGCAGG + Intronic
977043070 4:92038416-92038438 TATAGAGATCAAACTGTAGCAGG + Intergenic
979383555 4:120036871-120036893 TGTTGTGTGCAATGTGTTGCAGG - Intergenic
982146265 4:152396668-152396690 TATTGTTAGCATAATATAGCTGG - Intronic
984155236 4:176188381-176188403 TATTGTGAGCAATGTGGGGAGGG - Intronic
984998518 4:185461799-185461821 TATTGTGAGCAAAGTGTAGCCGG + Intronic
985955724 5:3264378-3264400 TATGATGGGCAAAGGGTAGCAGG + Intergenic
987390322 5:17369250-17369272 TGTTGTGAGGAAAGGGTGGCCGG - Intergenic
987803568 5:22731264-22731286 TATTGTGAGCTAGGTATAGGTGG + Intronic
987924928 5:24328622-24328644 TAATGTCTGCAAAGTGTGGCTGG + Intergenic
990822021 5:59851937-59851959 AAGTGTGGGCAAAGGGTAGCTGG - Intronic
993526231 5:88969055-88969077 AACTGTGAAGAAAGTGTAGCTGG + Intergenic
1001144374 5:169170916-169170938 TATTCTGTGCAAAGTCTACCTGG + Intronic
1005111285 6:22284762-22284784 TACAGTCAGCAAAGGGTAGCAGG - Intergenic
1008006577 6:46416330-46416352 TATTGTAAGCAAAGAGTAAGAGG + Intronic
1008314814 6:50026525-50026547 TTTTCTGAGCTAACTGTAGCTGG - Intergenic
1014744334 6:125182376-125182398 AGTCGTGAGCAAAGTGTTGCAGG + Intronic
1015457197 6:133439822-133439844 CATTGTTAGCAAAGAGTATCTGG + Intronic
1015797334 6:137026144-137026166 TTTTCTGAGCAAGGTGGAGCAGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1021812022 7:24411894-24411916 TATTATGACCAAAGTGAAACAGG + Intergenic
1022402575 7:30053852-30053874 TTTTGTGACCAAAGTCTTGCAGG - Intronic
1028239286 7:88399501-88399523 TATGGTGAGCAAAGTGCAGAGGG + Intergenic
1028827977 7:95295933-95295955 TTTTGTCAGTAAGGTGTAGCAGG - Intronic
1039032912 8:33329107-33329129 TATTGTTGGAAAAGTGTAGAAGG - Intergenic
1041407204 8:57513080-57513102 TATTTGGAGCAAAATGTATCAGG - Intergenic
1045190497 8:99877612-99877634 TATTGCGAGCAAAGTGATACTGG - Intronic
1045653754 8:104366494-104366516 TATTGTGATCACACTGTAGTTGG + Intronic
1046938540 8:119908613-119908635 TCTTGTGGGACAAGTGTAGCTGG + Intronic
1047395420 8:124493620-124493642 TCTTGTTACCAAAGAGTAGCAGG + Intronic
1051173502 9:14342631-14342653 AACTGTGAGGAAGGTGTAGCGGG + Intronic
1051866271 9:21686478-21686500 TTTTCTGAGCAAAGAGTAGAAGG + Intergenic
1056851210 9:90086134-90086156 TATTGTTAGCAAAGGGTTCCAGG - Intergenic
1058328380 9:103726949-103726971 TATTCTGGGCAAAGTTTATCAGG + Intergenic
1059969728 9:119653176-119653198 TATTGCCAGTTAAGTGTAGCAGG - Intergenic
1185568562 X:1115185-1115207 GAGTGTGACCCAAGTGTAGCTGG + Intergenic
1196710936 X:118761913-118761935 TGGTGTGAACAAAATGTAGCAGG + Intronic
1200857912 Y:7959126-7959148 CATTGTGGGCAAACAGTAGCAGG + Intergenic