ID: 984998641

View in Genome Browser
Species Human (GRCh38)
Location 4:185462993-185463015
Sequence CTTTCAATGCTGATTGTGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984998637_984998641 16 Left 984998637 4:185462954-185462976 CCCAGAATTTTGGAGATGATAAA 0: 1
1: 0
2: 4
3: 49
4: 523
Right 984998641 4:185462993-185463015 CTTTCAATGCTGATTGTGGTTGG 0: 1
1: 0
2: 1
3: 17
4: 118
984998638_984998641 15 Left 984998638 4:185462955-185462977 CCAGAATTTTGGAGATGATAAAA 0: 1
1: 0
2: 3
3: 73
4: 619
Right 984998641 4:185462993-185463015 CTTTCAATGCTGATTGTGGTTGG 0: 1
1: 0
2: 1
3: 17
4: 118
984998636_984998641 22 Left 984998636 4:185462948-185462970 CCTTTACCCAGAATTTTGGAGAT 0: 1
1: 0
2: 0
3: 18
4: 164
Right 984998641 4:185462993-185463015 CTTTCAATGCTGATTGTGGTTGG 0: 1
1: 0
2: 1
3: 17
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984998641 Original CRISPR CTTTCAATGCTGATTGTGGT TGG Exonic
901025626 1:6277372-6277394 CCTTCAAAGCTGATAGTGGGGGG - Intronic
908027394 1:59967440-59967462 CTGTCCCTGCTGCTTGTGGTAGG - Intergenic
908673173 1:66571451-66571473 CTTAGAAAACTGATTGTGGTTGG + Intronic
910553891 1:88507981-88508003 TGTTCTATGCTGATTGTGGTGGG - Intergenic
912089922 1:106058894-106058916 CTTTCAAAGCTGATTCATGTGGG + Intergenic
912642808 1:111363318-111363340 CTTTAAATGGTCATTGTGGTAGG - Intergenic
912905099 1:113696882-113696904 CTATCAATGATGCTTGTGATAGG + Intronic
913529234 1:119721704-119721726 CTATTAATGCTGTTTGTGGCAGG + Intronic
918555877 1:185799170-185799192 CTTCAAATGCTGGTTGTAGTTGG + Intronic
919007383 1:191915165-191915187 CTTTCATTGCTGGTTGTTATGGG + Intergenic
923389897 1:233503852-233503874 CATTGAATGATGATGGTGGTGGG - Intergenic
1063941484 10:11134521-11134543 CTTCCAGTGCTGATTGTCCTCGG + Intronic
1064815442 10:19256446-19256468 CTTTCACTCATGATGGTGGTGGG + Intronic
1066327612 10:34379580-34379602 CTATGAATGCTGACTGTTGTAGG + Intronic
1068727408 10:60318801-60318823 CTCTTAATGCTGATAGTGATAGG + Intronic
1069469339 10:68673296-68673318 CTTTTAATGATGATTTTGCTGGG - Intronic
1069850624 10:71402073-71402095 CTGTCAATGGTGAGTGGGGTGGG + Intronic
1070201457 10:74209718-74209740 CTTTCAATTCTTTTTTTGGTGGG - Intronic
1072927457 10:99628840-99628862 TTTTCAACAATGATTGTGGTGGG - Intergenic
1080395021 11:31882225-31882247 CTTTGAATACTGATTGTGTTTGG - Intronic
1086003034 11:82002931-82002953 CTTTGAACTCTGCTTGTGGTAGG - Intergenic
1087379294 11:97384503-97384525 CTTTCCACACTAATTGTGGTTGG + Intergenic
1088459220 11:110064941-110064963 CTTTCACTGCTGGTTGAGGATGG - Intergenic
1090062892 11:123478774-123478796 GCTGCAATGCTGATTGTGGTTGG + Intergenic
1097465587 12:59920755-59920777 ATGTCAATGCTGATAGTGGTAGG + Intergenic
1098954435 12:76675083-76675105 CTTGCAGTGCTGATAGTGGCAGG + Intergenic
1101499659 12:105290836-105290858 CTTTCAATGATGATTATTATTGG + Intronic
1105873854 13:24536489-24536511 CCTTAAATACTGCTTGTGGTAGG + Intergenic
1106933720 13:34695352-34695374 TTTTCAATGCTGATTTTGCTAGG - Intergenic
1107919778 13:45193480-45193502 CTTTCAATTCAGATTGTCTTGGG - Exonic
1109181051 13:59214191-59214213 CTTTCACTGGTTATTGTTGTAGG - Intergenic
1109674460 13:65656315-65656337 TTATCAATTCTGATTGTGGGTGG - Intergenic
1110142360 13:72146448-72146470 CTTTTAAAGATGAATGTGGTGGG + Intergenic
1110708606 13:78625098-78625120 ATTTCAAGGCTGATCTTGGTTGG - Intronic
1112669581 13:101619185-101619207 AATTCATTGATGATTGTGGTAGG + Intronic
1113377667 13:109780873-109780895 CTTTGAATGGTGTTTGGGGTCGG - Intronic
1113726799 13:112609785-112609807 CTTGAAATGCTGCTTGTGTTAGG - Intergenic
1119957313 14:78812676-78812698 CTCTCAATGCTGTTTTTGGTGGG - Intronic
1121893795 14:97625484-97625506 CTACCAATACTGATTTTGGTGGG - Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122453252 14:101829084-101829106 CTTTTATTGCTGAGTCTGGTTGG + Intronic
1123920088 15:25064035-25064057 CCTCCAGTGCTGGTTGTGGTTGG + Intergenic
1128660486 15:69497445-69497467 CTTTCTATTCTGAGTTTGGTTGG - Intergenic
1131471691 15:92703273-92703295 CTGGCAATGCTGATTGTCTTTGG - Intronic
1131641945 15:94302350-94302372 CTTTCTTTGCTGATGCTGGTGGG - Intronic
1131693375 15:94849824-94849846 CCTGCATTGCTTATTGTGGTTGG + Intergenic
1136061342 16:27728725-27728747 CTTTAAAGGCTGAATGTGGCTGG - Intronic
1138226525 16:55300424-55300446 CTTACAATGCTGTCTGTGGAAGG - Intergenic
1141345804 16:83244687-83244709 CCTTTAATGCTGATTTTGCTTGG - Intronic
1144816333 17:18038256-18038278 CTTTCATTGCTGATGGTGAGTGG - Intronic
1147413610 17:40272331-40272353 TTTTCATTGGTGATGGTGGTGGG + Intronic
1148921182 17:51036235-51036257 CTCAAAATGGTGATTGTGGTGGG - Intronic
1150120426 17:62596716-62596738 CTTGCAATGCTGATTGTTCATGG + Intronic
1152496806 17:80678911-80678933 CTTTCACTGCTGTGTGGGGTGGG + Intronic
1153500009 18:5739153-5739175 CCTTCAAGGCCGATTGTGGTTGG + Intergenic
1153562535 18:6385559-6385581 CTTTGAATGGAGATGGTGGTAGG - Intronic
1155071266 18:22318516-22318538 CTTTCAGTTCTGATTCTGTTTGG - Intergenic
1155793280 18:30000552-30000574 CTTGCACTGATGTTTGTGGTGGG - Intergenic
1156206109 18:34887600-34887622 CTTTCATTCCTGATTGTCGTAGG + Intronic
1156735629 18:40255193-40255215 CTTTCACAGCTGAGTGTGGTTGG + Intergenic
1157086170 18:44582139-44582161 TTTGCAAAGCAGATTGTGGTGGG + Intergenic
1157651437 18:49336339-49336361 CTCTCACTTCTGATTGTGTTTGG - Intronic
1160301716 18:77687574-77687596 CTCTCAATCCTCCTTGTGGTGGG - Intergenic
1163693731 19:18751733-18751755 CACTCAATGCTGATGGAGGTGGG - Intronic
1165704217 19:37963726-37963748 CTTTCATTGTTGATTTTGGTGGG + Intronic
929208881 2:39330671-39330693 CTGTCAGTGCTGATTTTTGTCGG - Intronic
929939264 2:46319617-46319639 CCTCCATTGCTGATCGTGGTTGG + Intronic
930106523 2:47644636-47644658 GTTGCAATGCAGACTGTGGTTGG + Intergenic
930628723 2:53728209-53728231 CTGGCAATGCTGAATGTGGAAGG + Intronic
931511214 2:62997359-62997381 CTTTCAATGCTGATTGCCAATGG + Intronic
931842065 2:66163053-66163075 CTTTCATTCCTGATATTGGTTGG - Intergenic
933232633 2:79826777-79826799 CTTTCCTTGATGATTGTGTTTGG - Intronic
937794040 2:125996085-125996107 AATTCAATGTTGATGGTGGTGGG - Intergenic
938151365 2:128887696-128887718 CTTTCATTCCTGATTTTGGTAGG + Intergenic
938317122 2:130337604-130337626 CCTTCGCTGCTGATTGTGGGCGG - Intergenic
938637123 2:133240523-133240545 CTTACAATGCTGACTGTCTTGGG + Intronic
943425311 2:187724497-187724519 CTTACAATGCTTATTTTGGCTGG + Intergenic
943454627 2:188089628-188089650 TTTTCTATCCTGATTTTGGTGGG + Intergenic
947659517 2:231856086-231856108 CTCTCATTGCTGAGTGTGGCAGG - Intergenic
1170456489 20:16538219-16538241 CACTCAGTGCTGATTGTGGGTGG - Intronic
1179633149 21:42691058-42691080 CTTTGAATGGTGATGGTGATGGG - Intronic
1182686883 22:32128071-32128093 CCTTCTGTGCTGAATGTGGTGGG - Intergenic
952179615 3:30903970-30903992 CTTGTAATGTTGACTGTGGTAGG - Intergenic
952662736 3:35871190-35871212 CTTTAAATGCAGATTCTGTTCGG - Intergenic
953225108 3:41011397-41011419 ATAGCAATGCTGATTGTTGTAGG - Intergenic
959330403 3:104997282-104997304 TCTTCAATGCTGCTTGTTGTAGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961469089 3:127100398-127100420 CTTCCACTGCTCACTGTGGTTGG + Intergenic
962543516 3:136408258-136408280 CTTTCAATTCTGATAGAGATTGG + Intronic
965238941 3:166168223-166168245 ATTTCAATGTTTATTGTGGGGGG - Intergenic
965771131 3:172182139-172182161 CTTACCTTGCTGATTCTGGTAGG - Intronic
970283969 4:14488538-14488560 CCTTCTATGCTGATTTTGCTGGG - Intergenic
971180969 4:24328254-24328276 GTTTTAATGCTGATTGGGGGGGG - Intergenic
977130555 4:93231060-93231082 CTCTAAGAGCTGATTGTGGTGGG - Intronic
980635141 4:135492503-135492525 CTTATAATGTTGATTGTGTTTGG + Intergenic
983916246 4:173294911-173294933 CTTTCAACACTGATTGTGGTTGG + Intronic
984121352 4:175749013-175749035 CTGTGAAGGCTGATTGAGGTGGG - Intronic
984998641 4:185462993-185463015 CTTTCAATGCTGATTGTGGTTGG + Exonic
985121524 4:186647866-186647888 CCTTCAATCCTGACTGTGGCAGG + Intronic
987048640 5:14130704-14130726 CTTTCAGTACTGAATGTGGCGGG - Intergenic
989735823 5:44704176-44704198 CTTTCAATGATGATAATTGTAGG - Intergenic
993147394 5:84112574-84112596 CTTGCTATACTGATTTTGGTGGG + Intronic
994582195 5:101658514-101658536 CTTTCGAAGCTGAGTGTGATAGG + Intergenic
996281433 5:121734172-121734194 CTTTCTATCCTGATTTTGGCTGG + Intergenic
996750462 5:126883501-126883523 CCTTCAGTGCTGATTACGGTGGG - Intronic
998489078 5:142530271-142530293 CCTTCCATGCTCATTGTGCTAGG + Intergenic
999873626 5:155777680-155777702 CTTTCACTGCTAACAGTGGTGGG - Intergenic
1013675075 6:112450195-112450217 CTTTCAATTCTGTTTGTGTTTGG + Intergenic
1013753697 6:113436606-113436628 GTTGGAATGCTAATTGTGGTAGG - Intergenic
1015143729 6:129963055-129963077 CTCTCAGTGCTGATTGTTGTTGG + Intergenic
1021157553 7:17230553-17230575 CCTACAATACTGATTGGGGTGGG - Intergenic
1024968694 7:55049415-55049437 CTTTCACTGCTGAGTGCAGTGGG - Intronic
1025226780 7:57172275-57172297 TTGTCAATGCTGATTAGGGTTGG - Intergenic
1027494992 7:78876718-78876740 CATTCAATGCTGTTTGTTATAGG + Intronic
1028325262 7:89516569-89516591 ATTTTAATTCTGATTCTGGTAGG - Intergenic
1028931767 7:96420984-96421006 CTTTAAATTCTGATTTTGTTCGG - Intergenic
1029493558 7:100885155-100885177 TTTTTATTACTGATTGTGGTGGG - Intronic
1033754473 7:144386713-144386735 CATTAAATGCTTGTTGTGGTTGG + Intergenic
1035641930 8:1190581-1190603 CTCTCAATGCTGATTGCGACAGG - Intergenic
1038317850 8:26502749-26502771 CTTTCCAGGCTGGGTGTGGTTGG - Intronic
1040626444 8:49155009-49155031 CTTTCTATGCCAATTTTGGTGGG + Intergenic
1043206621 8:77451773-77451795 CTGAGAGTGCTGATTGTGGTTGG - Intergenic
1045445512 8:102258980-102259002 CTTTCAATGATGAATCAGGTAGG - Exonic
1045507299 8:102787897-102787919 CTTTCAATTCTGTGTGGGGTGGG - Intergenic
1047141013 8:122139825-122139847 CTTCCAATGCTGTTTGTTCTTGG - Intergenic
1048753627 8:137708628-137708650 TTTTAAATGTTGATTGTGGTAGG + Intergenic
1051210024 9:14731526-14731548 CTTTCAATGCTGAATGTAAAAGG + Intergenic
1053214834 9:36261603-36261625 CTTTCAATACCTCTTGTGGTAGG - Intronic
1056974805 9:91242571-91242593 CCTTCACTTCTGACTGTGGTTGG - Intronic
1059443340 9:114323311-114323333 CTTTCCCTGCTGGCTGTGGTCGG + Intronic
1060799229 9:126533085-126533107 CTGTAAATGCTGAGTGTGGACGG - Intergenic
1062059902 9:134489663-134489685 CTTCCTGGGCTGATTGTGGTGGG + Intergenic
1186669077 X:11750963-11750985 CTTTGAATGATGATTGTCATTGG + Intergenic
1193591829 X:83397790-83397812 TTTACAATGATGATTGTTGTTGG - Intergenic
1193636704 X:83959309-83959331 CTTTCTATGCTGATTTTGCTGGG - Intergenic
1194535241 X:95097877-95097899 CTTCTAATACTGATCGTGGTTGG + Intergenic
1196111079 X:111947861-111947883 TGTTCAATGCTGATGGTGGAGGG + Intronic