ID: 985002283

View in Genome Browser
Species Human (GRCh38)
Location 4:185497568-185497590
Sequence CCCAACAGGCAGAGGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985002276_985002283 17 Left 985002276 4:185497528-185497550 CCCAGCTGCTCGGGAGGCTGAGA 0: 120
1: 8936
2: 133161
3: 309024
4: 222295
Right 985002283 4:185497568-185497590 CCCAACAGGCAGAGGTTGCAGGG No data
985002277_985002283 16 Left 985002277 4:185497529-185497551 CCAGCTGCTCGGGAGGCTGAGAC 0: 95
1: 7805
2: 122593
3: 280236
4: 217923
Right 985002283 4:185497568-185497590 CCCAACAGGCAGAGGTTGCAGGG No data
985002274_985002283 25 Left 985002274 4:185497520-185497542 CCTGTAGTCCCAGCTGCTCGGGA 0: 1416
1: 61365
2: 183820
3: 268099
4: 206793
Right 985002283 4:185497568-185497590 CCCAACAGGCAGAGGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985002283 Original CRISPR CCCAACAGGCAGAGGTTGCA GGG Intergenic
No off target data available for this crispr