ID: 985003461

View in Genome Browser
Species Human (GRCh38)
Location 4:185508580-185508602
Sequence CGTTACACAGAGATGGCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985003456_985003461 15 Left 985003456 4:185508542-185508564 CCGGAGGGAGTGCTGCATCCACT 0: 1
1: 0
2: 0
3: 13
4: 149
Right 985003461 4:185508580-185508602 CGTTACACAGAGATGGCACCGGG 0: 1
1: 0
2: 0
3: 9
4: 98
985003454_985003461 27 Left 985003454 4:185508530-185508552 CCACAGTCAATCCCGGAGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 85
Right 985003461 4:185508580-185508602 CGTTACACAGAGATGGCACCGGG 0: 1
1: 0
2: 0
3: 9
4: 98
985003458_985003461 -3 Left 985003458 4:185508560-185508582 CCACTGTGTTAATGGATACACGT 0: 1
1: 0
2: 0
3: 7
4: 65
Right 985003461 4:185508580-185508602 CGTTACACAGAGATGGCACCGGG 0: 1
1: 0
2: 0
3: 9
4: 98
985003455_985003461 16 Left 985003455 4:185508541-185508563 CCCGGAGGGAGTGCTGCATCCAC 0: 1
1: 0
2: 0
3: 22
4: 210
Right 985003461 4:185508580-185508602 CGTTACACAGAGATGGCACCGGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985003461 Original CRISPR CGTTACACAGAGATGGCACC GGG Intronic
900346623 1:2213433-2213455 AGTTTCTCAGAGGTGGCACCCGG - Intergenic
905085298 1:35369021-35369043 CATTACACAGAGATGTGACTGGG - Intronic
907913590 1:58848690-58848712 CTTTGCACAGTGATGGGACCAGG + Intergenic
912903465 1:113678059-113678081 AGTTAAACAGAAATGACACCTGG + Intronic
915532171 1:156508998-156509020 GTGGACACAGAGATGGCACCAGG + Intergenic
919412875 1:197268287-197268309 GGTGGGACAGAGATGGCACCTGG + Exonic
920537892 1:206752096-206752118 CATTTCAAAGAGATGGCTCCCGG + Intergenic
920684893 1:208101865-208101887 CTTTGCACAGAGCTGGCAGCAGG + Intronic
921078921 1:211723321-211723343 CTTTACCCAGAGATGACACATGG - Intergenic
1062838691 10:652796-652818 TTTTAAACAGAAATGGCACCAGG + Intronic
1063586765 10:7359154-7359176 CTTTACACAGACAAGGCCCCCGG - Intronic
1064181873 10:13124024-13124046 CCTTAAACAGAGATGTCACCTGG - Exonic
1068686998 10:59880911-59880933 AGTTGCACAGAGGTGGCACTGGG - Intronic
1071878718 10:89871193-89871215 CGTCACACAGACTTGGCCCCTGG - Intergenic
1072247596 10:93556975-93556997 CGTTTCACAGAGGAGGCAGCAGG - Intergenic
1076088805 10:127660264-127660286 AGTGACACAGACATGGCTCCTGG - Intergenic
1077116920 11:889351-889373 TGTCACCCAGAGATGGCAGCTGG - Intronic
1078749106 11:14143188-14143210 CTTTACACAGAGGTGGCCACTGG - Intronic
1083085835 11:60144080-60144102 AGTTACATAGCGATGGCAACTGG - Intergenic
1083610411 11:64001591-64001613 CTTTACTCAGAGCTGGCACCAGG + Intronic
1088711502 11:112512839-112512861 CTTTCCACAGGGATGGCTCCTGG - Intergenic
1088966202 11:114723950-114723972 AGGTACACAGAGATGACAGCTGG - Intergenic
1096182566 12:49558751-49558773 CTTAAGACAGAGGTGGCACCAGG + Intronic
1103837298 12:123832824-123832846 CATTTTACAGAGATGGCAACTGG - Intronic
1106004666 13:25757473-25757495 CGTTACACTGAACTGGCACATGG - Intronic
1109683433 13:65783594-65783616 CCTCACACAGACCTGGCACCTGG - Intergenic
1111030961 13:82597961-82597983 CATTTCAAAGAGATGGCTCCTGG + Intergenic
1112206417 13:97328057-97328079 CATTTCACAGATATGGCAGCTGG + Intronic
1112437122 13:99398529-99398551 CATTTCAAAGAGATGGCTCCTGG - Intergenic
1113167443 13:107458291-107458313 CTTTACTCAGAGAGGGGACCAGG + Intronic
1113782980 13:112987077-112987099 CCTTTTACACAGATGGCACCCGG + Intronic
1114737483 14:25057418-25057440 AGCTACACAGAGATGGGGCCTGG - Intergenic
1118288820 14:64502803-64502825 CGTTTTACAGAGAAGACACCAGG - Intronic
1119167988 14:72512020-72512042 GGCTACACAGAGAGGCCACCTGG - Intronic
1120245185 14:81997995-81998017 CGTCACCAAGAGATGGCACTGGG + Intergenic
1121280512 14:92694128-92694150 TGTTACACAGAGGTGGACCCGGG - Intergenic
1128769038 15:70268231-70268253 CTTTGCACAGAGTGGGCACCCGG + Intergenic
1129236286 15:74225644-74225666 TGTTGTACAGAGATGGAACCAGG - Intergenic
1135492410 16:22920994-22921016 CCTTACAAAAAGATGCCACCTGG - Intergenic
1142925781 17:3234910-3234932 TGTTACACAGAGATGTCAAATGG - Intergenic
1143684774 17:8504930-8504952 AGGCACTCAGAGATGGCACCCGG + Intronic
1149169604 17:53793083-53793105 CCTTGCACAAAGCTGGCACCTGG + Intergenic
1158119757 18:54036113-54036135 CATTACACACAGAGGCCACCAGG + Intergenic
1160036338 18:75304953-75304975 TGTTCCACAGAGAAGGCCCCTGG - Intergenic
1160474067 18:79166969-79166991 CCTCACACAGAGCCGGCACCTGG - Intronic
1161764022 19:6196562-6196584 GGATACACAGTGATGGCACCAGG + Intronic
1165435656 19:35793317-35793339 CAGGACACAGAGATGGAACCTGG - Intergenic
1165898787 19:39158743-39158765 GGGGACACAGAGATGGCCCCAGG + Intronic
925294267 2:2767330-2767352 GGTCACACAGACATGGCAACAGG - Intergenic
926142630 2:10377469-10377491 CGTGACACTCAGATGGCAGCAGG - Intronic
928200316 2:29243626-29243648 CTTTACACAGAGGTGGGCCCTGG - Intronic
928514657 2:32034493-32034515 CATTACCAAAAGATGGCACCAGG + Intronic
929763797 2:44827683-44827705 GGCTACACGGAGCTGGCACCTGG - Intergenic
934679402 2:96271918-96271940 CGTTACGCTGTGATGGCAACTGG + Intronic
936082486 2:109443357-109443379 CGTCACACAGAGATGACAGGAGG - Intronic
937547966 2:123048172-123048194 CGTTGCAGACAGATGGCCCCTGG + Intergenic
937861275 2:126712862-126712884 CTTTCCACAGAGAGAGCACCGGG + Intergenic
938127081 2:128682408-128682430 AGTGACACTGAGATGGAACCTGG + Intergenic
938163182 2:129004840-129004862 CGTTTCACAGAGAGGGAAACTGG + Intergenic
940192287 2:151054662-151054684 TGTTAGACAGAGATGCCACCTGG - Intergenic
1168797651 20:622233-622255 TGTTACACAGAGGTGGTAACGGG + Intergenic
1171480642 20:25453449-25453471 CTTTACACAGAGAGGGCTGCGGG + Exonic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1178022309 21:28423058-28423080 CGTTCCACTGACATGGCTCCAGG + Intergenic
1180611188 22:17099200-17099222 AGTTACACAAAGATGGCAGGAGG - Intronic
1182328902 22:29536380-29536402 CGTTACCCAGAGAAGGCCTCTGG + Intronic
1183944175 22:41315031-41315053 CATGACTCAGAGAAGGCACCTGG - Intronic
950591157 3:13936349-13936371 CAGTACACAGAGATGGAAACAGG - Intergenic
951090768 3:18571353-18571375 CGATATACAAAGATGGCATCTGG - Intergenic
954659334 3:52218641-52218663 GGGTACTCAGAGATGGCTCCAGG - Intergenic
955502386 3:59598125-59598147 AGTTAAATAGAGATGGCAGCTGG - Intergenic
958019559 3:87979826-87979848 GGTTGCACAGAGGTGGCACCTGG - Intergenic
961326367 3:126111725-126111747 GGTTTCAGAGAGATGGTACCTGG - Intronic
963902715 3:150747460-150747482 TGTTACTGAGAGAAGGCACCTGG + Intronic
969298757 4:6285083-6285105 CGCTGCTCAGAGATGGCATCAGG - Intronic
974658632 4:64858175-64858197 TGTTTCAAAGAGATGGCTCCCGG + Intergenic
980308627 4:131099258-131099280 CCTCACACAGAGCTGGCACAAGG - Intergenic
985003461 4:185508580-185508602 CGTTACACAGAGATGGCACCGGG + Intronic
989177468 5:38542650-38542672 AGGTGCACAGAGATGGCACTGGG - Intronic
989987196 5:50714711-50714733 AGTCACACAGAGAAGGAACCAGG + Intronic
998591027 5:143478544-143478566 CGTCTCACACAGATGGCAGCAGG - Intergenic
999696888 5:154195166-154195188 TCTTACACAGAGATGGCATCAGG + Intronic
1001668691 5:173455505-173455527 TGTCACACAGAGATAGCAACTGG + Intergenic
1002535239 5:179872270-179872292 CCTTCCACAGAGCTGGCACCAGG - Intronic
1011822529 6:91270793-91270815 CCTCACACAGAGCTGGCACCTGG - Intergenic
1020281175 7:6650827-6650849 CGGGACACAGGGATGACACCTGG - Intronic
1027526640 7:79277834-79277856 CGTTTCAAAGAGATGACTCCAGG - Intronic
1027924931 7:84447972-84447994 CCTCACACAGAGCTGGCACCTGG + Intronic
1030305399 7:108013208-108013230 CTAAACACAGAGCTGGCACCTGG + Intergenic
1031859205 7:126958469-126958491 CCTTGCACAGAGCTGGCGCCTGG + Intronic
1032016740 7:128384817-128384839 CATAACACAAAGATGGCACTTGG - Intergenic
1032618078 7:133497037-133497059 TGTTAGACAGAGATGACCCCAGG - Intronic
1035161665 7:156955026-156955048 CATGACACAGAAAGGGCACCAGG - Intronic
1036419583 8:8583394-8583416 CCCTACACAGAGAAGTCACCAGG + Intergenic
1036702306 8:11020815-11020837 TGTTGCACAGAGAGGTCACCTGG - Intronic
1038754418 8:30327390-30327412 GGTTACACAAGGAGGGCACCAGG + Intergenic
1042049928 8:64692402-64692424 CGGTGCACAGAGATGGAGCCCGG + Intronic
1043621368 8:82197010-82197032 CGTGAGACAGAAAGGGCACCAGG + Intergenic
1049826730 8:144673889-144673911 CCTCGCACAGAGCTGGCACCTGG - Intergenic
1049864513 8:144925264-144925286 TGTTACACTGAGATGGGCCCTGG + Intergenic
1050484065 9:6115243-6115265 CCTCACAGAGAGCTGGCACCTGG + Intergenic
1056897405 9:90563855-90563877 GGTTACACAGAGGTGGGAGCAGG - Intergenic
1060832332 9:126724254-126724276 CTTGCCACATAGATGGCACCAGG + Intergenic
1062620078 9:137416697-137416719 GGTCACACCGAGGTGGCACCAGG + Intronic
1190190426 X:48272462-48272484 CGTTTCAAAGAGATGGCTCAAGG + Intronic
1199302022 X:146223796-146223818 CGTCTCACATAGATGGCAGCAGG + Intergenic
1199608108 X:149592760-149592782 CGGTACCCAGAGATGGCAAAAGG + Exonic
1199631012 X:149776600-149776622 CGGTACCCAGAGATGGCAAAAGG - Exonic