ID: 985004858

View in Genome Browser
Species Human (GRCh38)
Location 4:185524090-185524112
Sequence CAGTAGGACTGGAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 790
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985004858_985004866 15 Left 985004858 4:185524090-185524112 CCTACTTCCCTCCAGTCCTACTG 0: 1
1: 0
2: 3
3: 25
4: 366
Right 985004866 4:185524128-185524150 ACAGTGAGTGATCTGCCAGGTGG 0: 1
1: 1
2: 0
3: 8
4: 150
985004858_985004865 12 Left 985004858 4:185524090-185524112 CCTACTTCCCTCCAGTCCTACTG 0: 1
1: 0
2: 3
3: 25
4: 366
Right 985004865 4:185524125-185524147 AAGACAGTGAGTGATCTGCCAGG 0: 1
1: 0
2: 3
3: 17
4: 175
985004858_985004867 27 Left 985004858 4:185524090-185524112 CCTACTTCCCTCCAGTCCTACTG 0: 1
1: 0
2: 3
3: 25
4: 366
Right 985004867 4:185524140-185524162 CTGCCAGGTGGATGTGTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985004858 Original CRISPR CAGTAGGACTGGAGGGAAGT AGG (reversed) Intronic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG + Intergenic
902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG + Intergenic
903294050 1:22332473-22332495 CAGTAGGCTTTGAGGAAAGTAGG - Intergenic
903294050 1:22332473-22332495 CAGTAGGCTTTGAGGAAAGTAGG - Intergenic
903361232 1:22778684-22778706 CAGAAGGACTGGAAGTAAATGGG - Intronic
903361232 1:22778684-22778706 CAGAAGGACTGGAAGTAAATGGG - Intronic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
904615386 1:31746717-31746739 GAGAAGGGCTGCAGGGAAGTTGG - Intronic
904615386 1:31746717-31746739 GAGAAGGGCTGCAGGGAAGTTGG - Intronic
904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG + Intergenic
904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG + Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG + Intergenic
905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG + Intergenic
906967421 1:50472103-50472125 CCGTAGGTCTGGAGGGGAGCTGG + Intronic
906967421 1:50472103-50472125 CCGTAGGTCTGGAGGGGAGCTGG + Intronic
908220285 1:61999263-61999285 CCATAGGACAGGAAGGAAGTTGG - Intronic
908220285 1:61999263-61999285 CCATAGGACAGGAAGGAAGTTGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911189519 1:94933648-94933670 AAGTAGGTGTGGAGGTAAGTTGG + Intergenic
911189519 1:94933648-94933670 AAGTAGGTGTGGAGGTAAGTTGG + Intergenic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG + Intergenic
914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG + Intergenic
915461827 1:156075137-156075159 AAGCAGGACTGGGGGGAGGTGGG - Exonic
915461827 1:156075137-156075159 AAGCAGGACTGGGGGGAGGTGGG - Exonic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
921774782 1:219084403-219084425 TAATATGACTGGAGTGAAGTGGG - Intergenic
921774782 1:219084403-219084425 TAATATGACTGGAGTGAAGTGGG - Intergenic
921819447 1:219600599-219600621 CAGCAAGGCTGGAGGGGAGTGGG + Intergenic
921819447 1:219600599-219600621 CAGCAAGGCTGGAGGGGAGTGGG + Intergenic
922177248 1:223206229-223206251 CACTAGGAGTGGAGGGAGCTTGG + Intergenic
922177248 1:223206229-223206251 CACTAGGAGTGGAGGGAGCTTGG + Intergenic
922936507 1:229426898-229426920 TAGAAGGACTGCAGGGAAATGGG - Intergenic
922936507 1:229426898-229426920 TAGAAGGACTGCAGGGAAATGGG - Intergenic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
923554557 1:234990545-234990567 CAATATGACTGGAGGAAATTTGG - Intergenic
923554557 1:234990545-234990567 CAATATGACTGGAGGAAATTTGG - Intergenic
1063087565 10:2833275-2833297 CAGGAGGACAGGAGAGAAGCAGG - Intergenic
1063087565 10:2833275-2833297 CAGGAGGACAGGAGAGAAGCAGG - Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1068808140 10:61223864-61223886 TAGTAGGATTGGAGGGCAGGGGG + Intergenic
1068808140 10:61223864-61223886 TAGTAGGATTGGAGGGCAGGGGG + Intergenic
1068951180 10:62779149-62779171 CACAAGGGCTCGAGGGAAGTTGG + Intergenic
1068951180 10:62779149-62779171 CACAAGGGCTCGAGGGAAGTTGG + Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1070660948 10:78304835-78304857 CACCAGGACTGGTGGGCAGTGGG - Intergenic
1070660948 10:78304835-78304857 CACCAGGACTGGTGGGCAGTGGG - Intergenic
1071169759 10:82850213-82850235 TATTAGCACTGGAAGGAAGTTGG + Intronic
1071169759 10:82850213-82850235 TATTAGCACTGGAAGGAAGTTGG + Intronic
1071873124 10:89816719-89816741 CAGTAGGACAGGGGAGAAGATGG - Intergenic
1071873124 10:89816719-89816741 CAGTAGGACAGGGGAGAAGATGG - Intergenic
1072374911 10:94804361-94804383 CAGTTGGTCTGGAGGAAGGTAGG - Intronic
1072374911 10:94804361-94804383 CAGTTGGTCTGGAGGAAGGTAGG - Intronic
1072495580 10:95954862-95954884 CAATAGAACTGGAGGAAACTAGG - Intronic
1072495580 10:95954862-95954884 CAATAGAACTGGAGGAAACTAGG - Intronic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1073352511 10:102830119-102830141 CAGGAGGCCAGGAGGGAGGTTGG - Intergenic
1073352511 10:102830119-102830141 CAGGAGGCCAGGAGGGAGGTTGG - Intergenic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075753227 10:124791310-124791332 GAGTAGGAGGGGAGGGATGTGGG - Intronic
1075753227 10:124791310-124791332 GAGTAGGAGGGGAGGGATGTGGG - Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1077108444 11:851784-851806 CAGAATGACTGAAGGGCAGTGGG + Intronic
1077108444 11:851784-851806 CAGAATGACTGAAGGGCAGTGGG + Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078421110 11:11213701-11213723 CAGTATGATTGGAGGAAAGGAGG - Intergenic
1078421110 11:11213701-11213723 CAGTATGATTGGAGGAAAGGAGG - Intergenic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079188812 11:18260703-18260725 TAGTAAGACTGGAGAGAAGGTGG - Intergenic
1079188812 11:18260703-18260725 TAGTAAGACTGGAGAGAAGGTGG - Intergenic
1080156995 11:29122953-29122975 TAGTAGGAATTTAGGGAAGTGGG - Intergenic
1080156995 11:29122953-29122975 TAGTAGGAATTTAGGGAAGTGGG - Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1083854154 11:65384120-65384142 CAGCAAGGCTGTAGGGAAGTGGG - Intergenic
1083854154 11:65384120-65384142 CAGCAAGGCTGTAGGGAAGTGGG - Intergenic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084386341 11:68844878-68844900 CAGTAGGACTGGGCAGGAGTGGG - Intergenic
1084386341 11:68844878-68844900 CAGTAGGACTGGGCAGGAGTGGG - Intergenic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084777773 11:71388671-71388693 CATTAGGACTGTTGGGATGTTGG - Intergenic
1084777773 11:71388671-71388693 CATTAGGACTGTTGGGATGTTGG - Intergenic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089639849 11:119840471-119840493 CAGTAGGATTTGGGGGAATTTGG + Intergenic
1089639849 11:119840471-119840493 CAGTAGGATTTGGGGGAATTTGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092121949 12:6050546-6050568 GACTAAGACTGGAGGGAAGTTGG - Intronic
1092121949 12:6050546-6050568 GACTAAGACTGGAGGGAAGTTGG - Intronic
1092745569 12:11669334-11669356 CAGGAGGACGGGAGGAAAGGAGG - Intronic
1092745569 12:11669334-11669356 CAGGAGGACGGGAGGAAAGGAGG - Intronic
1092899819 12:13047818-13047840 GAGTAGGACTTAAGGCAAGTTGG + Intronic
1092899819 12:13047818-13047840 GAGTAGGACTTAAGGCAAGTTGG + Intronic
1095963018 12:47847193-47847215 GAGAAGGACTGGAGGACAGTAGG - Intronic
1095963018 12:47847193-47847215 GAGAAGGACTGGAGGACAGTAGG - Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1100494467 12:95111575-95111597 AAGTAGGACTGGAGATGAGTGGG - Intronic
1100494467 12:95111575-95111597 AAGTAGGACTGGAGATGAGTGGG - Intronic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG + Intergenic
1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG + Intergenic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1113429990 13:110241322-110241344 CAGCAGGGCTGGAGCCAAGTTGG - Intronic
1113429990 13:110241322-110241344 CAGCAGGGCTGGAGCCAAGTTGG - Intronic
1114539928 14:23447511-23447533 CAGTAGGCCTGGAAGGACCTGGG - Intergenic
1114539928 14:23447511-23447533 CAGTAGGCCTGGAAGGACCTGGG - Intergenic
1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG + Intronic
1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG + Intronic
1118254741 14:64195833-64195855 CAGTGGGACTGGAAGGATTTAGG + Intronic
1118254741 14:64195833-64195855 CAGTGGGACTGGAAGGATTTAGG + Intronic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1119951999 14:78754706-78754728 CAGTAGGTCTAGAGTGGAGTGGG - Intronic
1119951999 14:78754706-78754728 CAGTAGGTCTAGAGTGGAGTGGG - Intronic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1121244297 14:92451175-92451197 CAGAAAGTGTGGAGGGAAGTGGG + Intronic
1121244297 14:92451175-92451197 CAGAAAGTGTGGAGGGAAGTGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1125517804 15:40332506-40332528 CAGAAGGGCTGTGGGGAAGTAGG - Intronic
1125517804 15:40332506-40332528 CAGAAGGGCTGTGGGGAAGTAGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127376548 15:58390114-58390136 CTGTTGGACTGGAAGGGAGTTGG - Intronic
1127376548 15:58390114-58390136 CTGTTGGACTGGAAGGGAGTTGG - Intronic
1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG + Intergenic
1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG + Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1132049705 15:98596836-98596858 CAGGACGACTGGAGGGCAGCAGG - Intergenic
1132049705 15:98596836-98596858 CAGGACGACTGGAGGGCAGCAGG - Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG + Intronic
1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG + Intronic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137753755 16:50885651-50885673 CAGTAGGGCTGGAATGCAGTAGG - Intergenic
1137753755 16:50885651-50885673 CAGTAGGGCTGGAATGCAGTAGG - Intergenic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG + Intronic
1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG + Intronic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG + Intergenic
1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG + Intergenic
1146086340 17:29833730-29833752 AAGAAGGAAGGGAGGGAAGTAGG - Intronic
1146086340 17:29833730-29833752 AAGAAGGAAGGGAGGGAAGTAGG - Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1147257835 17:39192660-39192682 GAGGAGGACTGCAGGGATGTAGG + Intronic
1147257835 17:39192660-39192682 GAGGAGGACTGCAGGGATGTAGG + Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1149999420 17:61424349-61424371 CAGTAGGTCAGGATGGAACTTGG - Intergenic
1149999420 17:61424349-61424371 CAGTAGGTCAGGATGGAACTTGG - Intergenic
1150636972 17:66919828-66919850 CAGGAGGAATGAAGGGATGTGGG - Intergenic
1150636972 17:66919828-66919850 CAGGAGGAATGAAGGGATGTGGG - Intergenic
1151426253 17:74032799-74032821 TGGTTGAACTGGAGGGAAGTCGG - Intergenic
1151426253 17:74032799-74032821 TGGTTGAACTGGAGGGAAGTCGG - Intergenic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153527877 18:6014957-6014979 CAGTAGGAGTGGACTGAAGTGGG + Intronic
1153527877 18:6014957-6014979 CAGTAGGAGTGGACTGAAGTGGG + Intronic
1156788810 18:40947712-40947734 CACTAGGACATGAGAGAAGTGGG + Intergenic
1156788810 18:40947712-40947734 CACTAGGACATGAGAGAAGTGGG + Intergenic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1157147323 18:45177174-45177196 GAGTAGGAATGGCAGGAAGTGGG - Intergenic
1157147323 18:45177174-45177196 GAGTAGGAATGGCAGGAAGTGGG - Intergenic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1162878759 19:13641130-13641152 CCGTAGTGGTGGAGGGAAGTAGG - Intergenic
1162878759 19:13641130-13641152 CCGTAGTGGTGGAGGGAAGTAGG - Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG + Exonic
1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG + Exonic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166763771 19:45240452-45240474 CAATAGGACTGGAGAGAACGGGG + Intronic
1166763771 19:45240452-45240474 CAATAGGACTGGAGAGAACGGGG + Intronic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG + Intronic
927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG + Intronic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935723524 2:106000586-106000608 GAGTGGGACCGGAGGGAGGTAGG - Intergenic
935723524 2:106000586-106000608 GAGTGGGACCGGAGGGAGGTAGG - Intergenic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936611082 2:114002630-114002652 CAATAGGTCTGGAGTGTAGTTGG + Intergenic
936611082 2:114002630-114002652 CAATAGGTCTGGAGTGTAGTTGG + Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
939728215 2:145750232-145750254 CAGTATGACTGGAAAGAAGCTGG - Intergenic
939728215 2:145750232-145750254 CAGTATGACTGGAAAGAAGCTGG - Intergenic
941463590 2:165799738-165799760 CAGTTGGGCTGGAGGGGATTTGG - Intergenic
941463590 2:165799738-165799760 CAGTTGGGCTGGAGGGGATTTGG - Intergenic
942008525 2:171734559-171734581 CAGTAACACTGGAGGGATGTTGG - Intronic
942008525 2:171734559-171734581 CAGTAACACTGGAGGGATGTTGG - Intronic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
945022061 2:205583830-205583852 CAGTAGAACTGGAGGTGAGGTGG - Intronic
945022061 2:205583830-205583852 CAGTAGAACTGGAGGTGAGGTGG - Intronic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
946309451 2:218874671-218874693 TATTTGGACTGGAGGAAAGTTGG - Intergenic
946309451 2:218874671-218874693 TATTTGGACTGGAGGAAAGTTGG - Intergenic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
948025282 2:234771554-234771576 AAGTAGGACAGGAGGAAGGTAGG + Intergenic
948025282 2:234771554-234771576 AAGTAGGACAGGAGGAAGGTAGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1170106886 20:12761094-12761116 TAATAAGACTGGAGGGATGTAGG + Intergenic
1170106886 20:12761094-12761116 TAATAAGACTGGAGGGATGTAGG + Intergenic
1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG + Intronic
1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG + Intronic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1173465960 20:43281630-43281652 CAGTAGGAGAGAGGGGAAGTGGG - Intergenic
1173465960 20:43281630-43281652 CAGTAGGAGAGAGGGGAAGTGGG - Intergenic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1174618456 20:51855122-51855144 GGTTAGGCCTGGAGGGAAGTGGG - Intergenic
1174618456 20:51855122-51855144 GGTTAGGCCTGGAGGGAAGTGGG - Intergenic
1175004918 20:55671669-55671691 CATGAGGACTGGCGAGAAGTTGG + Intergenic
1175004918 20:55671669-55671691 CATGAGGACTGGCGAGAAGTTGG + Intergenic
1175121842 20:56721901-56721923 GGGTAGGACGGGAGGGAAGGCGG - Intergenic
1175121842 20:56721901-56721923 GGGTAGGACGGGAGGGAAGGCGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175691296 20:61067711-61067733 CAGTAGAACTGGGGGCAACTGGG - Intergenic
1175691296 20:61067711-61067733 CAGTAGAACTGGGGGCAACTGGG - Intergenic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1179390210 21:40981858-40981880 TAGTAGGACTGGAGGTAAATTGG - Intergenic
1179390210 21:40981858-40981880 TAGTAGGACTGGAGGTAAATTGG - Intergenic
1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG + Intronic
1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG + Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1183043750 22:35203295-35203317 CAGAAGGACTGCTGGGCAGTTGG - Intergenic
1183043750 22:35203295-35203317 CAGAAGGACTGCTGGGCAGTTGG - Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184281186 22:43438388-43438410 CACTAGGAGTGTTGGGAAGTGGG + Intronic
1184281186 22:43438388-43438410 CACTAGGAGTGTTGGGAAGTGGG + Intronic
1184974433 22:48051078-48051100 CAGCATGACTGGAGAGAAATGGG + Intergenic
1184974433 22:48051078-48051100 CAGCATGACTGGAGAGAAATGGG + Intergenic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
950248017 3:11439613-11439635 CACTAGGACTGCAAGGCAGTGGG + Intronic
950248017 3:11439613-11439635 CACTAGGACTGCAAGGCAGTGGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951752155 3:26048442-26048464 CACTAAGAATGGAGGGAAGGGGG - Intergenic
951752155 3:26048442-26048464 CACTAAGAATGGAGGGAAGGGGG - Intergenic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
952038571 3:29234134-29234156 CATCAGGACTTGGGGGAAGTAGG + Intergenic
952038571 3:29234134-29234156 CATCAGGACTTGGGGGAAGTAGG + Intergenic
952423242 3:33149571-33149593 CAGCAGGATTTTAGGGAAGTTGG - Intergenic
952423242 3:33149571-33149593 CAGCAGGATTTTAGGGAAGTTGG - Intergenic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG + Intronic
954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG + Intronic
955390894 3:58521508-58521530 CAGAAGGCCTGGAGACAAGTGGG - Intronic
955390894 3:58521508-58521530 CAGAAGGCCTGGAGACAAGTGGG - Intronic
956590383 3:70908333-70908355 CAGTTGACCTGGATGGAAGTGGG + Intergenic
956590383 3:70908333-70908355 CAGTTGACCTGGATGGAAGTGGG + Intergenic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
958806714 3:98819774-98819796 AAGGAGGACTGGATTGAAGTTGG - Intronic
958806714 3:98819774-98819796 AAGGAGGACTGGATTGAAGTTGG - Intronic
959619975 3:108389509-108389531 AAGCAGGACTGGAGGGTTGTGGG - Intronic
959619975 3:108389509-108389531 AAGCAGGACTGGAGGGTTGTGGG - Intronic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
961129601 3:124453632-124453654 CTTTTGGACTGGAGGAAAGTGGG - Intronic
961129601 3:124453632-124453654 CTTTTGGACTGGAGGAAAGTGGG - Intronic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG + Intronic
961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG + Intronic
962081586 3:132145040-132145062 CAATATGAGTGGAGGGTAGTGGG - Intronic
962081586 3:132145040-132145062 CAATATGAGTGGAGGGTAGTGGG - Intronic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964187042 3:153958682-153958704 CAGTCAGACTGGAGTGCAGTGGG + Intergenic
964187042 3:153958682-153958704 CAGTCAGACTGGAGTGCAGTGGG + Intergenic
964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG + Intronic
964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG + Intronic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967128502 3:186448252-186448274 CAGTAGTACTGATGGGAAGTGGG + Intergenic
967128502 3:186448252-186448274 CAGTAGTACTGATGGGAAGTGGG + Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971150481 4:24026218-24026240 AACTGGGACTGGTGGGAAGTGGG - Intergenic
971150481 4:24026218-24026240 AACTGGGACTGGTGGGAAGTGGG - Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG + Intronic
972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG + Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
982201271 4:152963308-152963330 CTATAGGGCTGAAGGGAAGTGGG + Intronic
982201271 4:152963308-152963330 CTATAGGGCTGAAGGGAAGTGGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984340850 4:178454155-178454177 CATTAGGACAGGAGGTTAGTTGG + Intergenic
984340850 4:178454155-178454177 CATTAGGACAGGAGGTTAGTTGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986648408 5:9940727-9940749 CTGTAGGACTTCAGGCAAGTTGG - Intergenic
986648408 5:9940727-9940749 CTGTAGGACTTCAGGCAAGTTGG - Intergenic
989342184 5:40388410-40388432 CAGCTGGACTGGAGCAAAGTAGG - Intergenic
989342184 5:40388410-40388432 CAGCTGGACTGGAGCAAAGTAGG - Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990510780 5:56487547-56487569 CAATAGGACTAGTGGGAAGTTGG + Intergenic
990510780 5:56487547-56487569 CAATAGGACTAGTGGGAAGTTGG + Intergenic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
992519857 5:77539436-77539458 CAGTAGGTCTGGGGTGGAGTGGG + Intronic
992519857 5:77539436-77539458 CAGTAGGTCTGGGGTGGAGTGGG + Intronic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
995077124 5:107999017-107999039 CAGCAGACCTGGAGGGAAATGGG - Intronic
995077124 5:107999017-107999039 CAGCAGACCTGGAGGGAAATGGG - Intronic
995095001 5:108225428-108225450 AAGTTGTACTGGAGTGAAGTGGG + Intronic
995095001 5:108225428-108225450 AAGTTGTACTGGAGTGAAGTGGG + Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
998400691 5:141847359-141847381 GAGTAGAAATGGAGGGGAGTTGG - Intergenic
998400691 5:141847359-141847381 GAGTAGAAATGGAGGGGAGTTGG - Intergenic
999452468 5:151688643-151688665 TTGAAGGACTGGAAGGAAGTTGG - Intergenic
999452468 5:151688643-151688665 TTGAAGGACTGGAAGGAAGTTGG - Intergenic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1001048207 5:168391983-168392005 AAGTAAGACTGAAGGGAAGAGGG + Intronic
1001048207 5:168391983-168392005 AAGTAAGACTGAAGGGAAGAGGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1003528673 6:6919870-6919892 CAGAAGCACTGGGTGGAAGTAGG - Intergenic
1003528673 6:6919870-6919892 CAGAAGCACTGGGTGGAAGTAGG - Intergenic
1006547248 6:34790485-34790507 CAGTCCTACTGGAGGGGAGTGGG + Intergenic
1006547248 6:34790485-34790507 CAGTCCTACTGGAGGGGAGTGGG + Intergenic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1007277860 6:40688922-40688944 GAGAAGGCTTGGAGGGAAGTAGG - Intergenic
1007277860 6:40688922-40688944 GAGAAGGCTTGGAGGGAAGTAGG - Intergenic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1007670639 6:43550404-43550426 CAGTAGGACTTCAGAAAAGTGGG - Intronic
1007670639 6:43550404-43550426 CAGTAGGACTTCAGAAAAGTGGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1009566204 6:65313991-65314013 CAGCAAGGCTGGAGGGGAGTGGG - Intronic
1009566204 6:65313991-65314013 CAGCAAGGCTGGAGGGGAGTGGG - Intronic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1010973354 6:82286621-82286643 AAGTGGGACAGGAAGGAAGTGGG + Intergenic
1010973354 6:82286621-82286643 AAGTGGGACAGGAAGGAAGTGGG + Intergenic
1012690138 6:102300088-102300110 CAGTAGGGCTTCAGGGATGTGGG - Intergenic
1012690138 6:102300088-102300110 CAGTAGGGCTTCAGGGATGTGGG - Intergenic
1013508760 6:110825845-110825867 GAGTAGGACTGGGAGGCAGTGGG + Intronic
1013508760 6:110825845-110825867 GAGTAGGACTGGGAGGCAGTGGG + Intronic
1014715458 6:124859954-124859976 CAGTATGACTGGAGAGAATGTGG - Intergenic
1014715458 6:124859954-124859976 CAGTATGACTGGAGAGAATGTGG - Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1017359002 6:153543660-153543682 AAGAAAGACTAGAGGGAAGTGGG - Intergenic
1017359002 6:153543660-153543682 AAGAAAGACTAGAGGGAAGTGGG - Intergenic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1020832601 7:13110304-13110326 GAGAAGCACTGGAGGGAGGTTGG - Intergenic
1020832601 7:13110304-13110326 GAGAAGCACTGGAGGGAGGTTGG - Intergenic
1021656902 7:22881706-22881728 AAGAAAGACTGGAGGGAAGAGGG - Intergenic
1021656902 7:22881706-22881728 AAGAAAGACTGGAGGGAAGAGGG - Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024706535 7:51967221-51967243 CAGTAGGACAGGAAGGACGGGGG + Intergenic
1024706535 7:51967221-51967243 CAGTAGGACAGGAAGGACGGGGG + Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1027569689 7:79848390-79848412 CATCAGGACTGGGGGGCAGTAGG - Intergenic
1027569689 7:79848390-79848412 CATCAGGACTGGGGGGCAGTAGG - Intergenic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1028229014 7:88283817-88283839 CAGGAGCACTGGATGCAAGTCGG - Exonic
1028229014 7:88283817-88283839 CAGGAGCACTGGATGCAAGTCGG - Exonic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1030990927 7:116298978-116299000 TGATAGGGCTGGAGGGAAGTGGG + Intronic
1030990927 7:116298978-116299000 TGATAGGGCTGGAGGGAAGTGGG + Intronic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1034548973 7:151808397-151808419 CAGTTGGACTGTAGGCAAGAAGG + Intronic
1034548973 7:151808397-151808419 CAGTTGGACTGTAGGCAAGAAGG + Intronic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1036155377 8:6337400-6337422 AAGTAGAACTCGAAGGAAGTGGG - Intergenic
1036155377 8:6337400-6337422 AAGTAGAACTCGAAGGAAGTGGG - Intergenic
1036699828 8:11005394-11005416 TGGAAGGGCTGGAGGGAAGTGGG + Intronic
1036699828 8:11005394-11005416 TGGAAGGGCTGGAGGGAAGTGGG + Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037609162 8:20462003-20462025 CCCTAGGACCGGTGGGAAGTGGG + Intergenic
1037609162 8:20462003-20462025 CCCTAGGACCGGTGGGAAGTGGG + Intergenic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1038347840 8:26748344-26748366 CAGCAGGGCTGGACGGATGTTGG - Exonic
1038347840 8:26748344-26748366 CAGCAGGGCTGGACGGATGTTGG - Exonic
1038735711 8:30167150-30167172 CAGAAGGAAGGGAGGGAGGTAGG + Intronic
1038735711 8:30167150-30167172 CAGAAGGAAGGGAGGGAGGTAGG + Intronic
1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG + Intergenic
1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG + Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042368059 8:67959234-67959256 TGGCAGGACTTGAGGGAAGTGGG + Intronic
1042368059 8:67959234-67959256 TGGCAGGACTTGAGGGAAGTGGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044003839 8:86917555-86917577 CAGTAGGACTGATGGGTGGTAGG + Intronic
1044003839 8:86917555-86917577 CAGTAGGACTGATGGGTGGTAGG + Intronic
1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG + Intergenic
1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG + Intergenic
1046732998 8:117745919-117745941 TAGTAGGACTGGGAGGGAGTGGG - Intergenic
1046732998 8:117745919-117745941 TAGTAGGACTGGGAGGGAGTGGG - Intergenic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047756903 8:127926084-127926106 GACCATGACTGGAGGGAAGTGGG - Intergenic
1047756903 8:127926084-127926106 GACCATGACTGGAGGGAAGTGGG - Intergenic
1047927633 8:129696981-129697003 AAGAAGGATTGGAGGGAGGTGGG + Intergenic
1047927633 8:129696981-129697003 AAGAAGGATTGGAGGGAGGTGGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048505837 8:135020519-135020541 CAGGAGTGTTGGAGGGAAGTGGG - Intergenic
1048505837 8:135020519-135020541 CAGGAGTGTTGGAGGGAAGTGGG - Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1050176330 9:2873048-2873070 GGGTAGCACTGGGGGGAAGTCGG - Intergenic
1050176330 9:2873048-2873070 GGGTAGCACTGGGGGGAAGTCGG - Intergenic
1051326508 9:15977028-15977050 CAGGAGGACTGGAGGAATGGAGG - Intronic
1051326508 9:15977028-15977050 CAGGAGGACTGGAGGAATGGAGG - Intronic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1055353841 9:75417433-75417455 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353841 9:75417433-75417455 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353907 9:75417929-75417951 CACTAGGAGTGGAGGGCTGTGGG + Intergenic
1055353907 9:75417929-75417951 CACTAGGAGTGGAGGGCTGTGGG + Intergenic
1055353914 9:75417971-75417993 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353914 9:75417971-75417993 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353921 9:75418013-75418035 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353921 9:75418013-75418035 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353928 9:75418055-75418077 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353928 9:75418055-75418077 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353935 9:75418097-75418119 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353935 9:75418097-75418119 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353960 9:75418223-75418245 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353960 9:75418223-75418245 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353967 9:75418265-75418287 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353967 9:75418265-75418287 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353974 9:75418307-75418329 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353974 9:75418307-75418329 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353981 9:75418349-75418371 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353981 9:75418349-75418371 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055725698 9:79226022-79226044 AAGTAGGAATGAAGGGAAGGAGG - Intergenic
1055725698 9:79226022-79226044 AAGTAGGAATGAAGGGAAGGAGG - Intergenic
1056590615 9:87963546-87963568 TGGTAGGACTGGAGGAAACTGGG - Intergenic
1056590615 9:87963546-87963568 TGGTAGGACTGGAGGAAACTGGG - Intergenic
1057326087 9:94065452-94065474 CAGTAGGACTAAAGTGAAGGTGG - Intronic
1057326087 9:94065452-94065474 CAGTAGGACTAAAGTGAAGGTGG - Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1059780026 9:117516421-117516443 AGGAAGGACTGGAGTGAAGTGGG + Intergenic
1059780026 9:117516421-117516443 AGGAAGGACTGGAGTGAAGTGGG + Intergenic
1060988600 9:127835642-127835664 CAGTAGGACTGGATGGCCATGGG - Intronic
1060988600 9:127835642-127835664 CAGTAGGACTGGATGGCCATGGG - Intronic
1061050227 9:128191033-128191055 TAGCAGGACTGGAGGTAACTTGG - Intronic
1061050227 9:128191033-128191055 TAGCAGGACTGGAGGTAACTTGG - Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1186577699 X:10784484-10784506 CAGTCAGACTGGAGTGCAGTGGG + Intronic
1186577699 X:10784484-10784506 CAGTCAGACTGGAGTGCAGTGGG + Intronic
1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG + Intronic
1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG + Intronic
1187418106 X:19111015-19111037 TAGTAGGAGTAGAGAGAAGTGGG + Intronic
1187418106 X:19111015-19111037 TAGTAGGAGTAGAGAGAAGTGGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1188041044 X:25369924-25369946 CAGTAGGACTCCAGGGATGTGGG + Intergenic
1188041044 X:25369924-25369946 CAGTAGGACTCCAGGGATGTGGG + Intergenic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1196429192 X:115604424-115604446 CATTAGGACCTGGGGGAAGTAGG + Intronic
1196429192 X:115604424-115604446 CATTAGGACCTGGGGGAAGTAGG + Intronic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1197899307 X:131352749-131352771 CATTACGACTGGAGAGAGGTAGG + Intronic
1197899307 X:131352749-131352771 CATTACGACTGGAGAGAGGTAGG + Intronic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic