ID: 985004865

View in Genome Browser
Species Human (GRCh38)
Location 4:185524125-185524147
Sequence AAGACAGTGAGTGATCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 175}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985004856_985004865 16 Left 985004856 4:185524086-185524108 CCTCCCTACTTCCCTCCAGTCCT 0: 1
1: 0
2: 8
3: 323
4: 4474
Right 985004865 4:185524125-185524147 AAGACAGTGAGTGATCTGCCAGG 0: 1
1: 0
2: 3
3: 17
4: 175
985004862_985004865 1 Left 985004862 4:185524101-185524123 CCAGTCCTACTGAGGCCACTGCA 0: 1
1: 0
2: 1
3: 18
4: 188
Right 985004865 4:185524125-185524147 AAGACAGTGAGTGATCTGCCAGG 0: 1
1: 0
2: 3
3: 17
4: 175
985004854_985004865 23 Left 985004854 4:185524079-185524101 CCCTAGACCTCCCTACTTCCCTC 0: 1
1: 0
2: 1
3: 51
4: 417
Right 985004865 4:185524125-185524147 AAGACAGTGAGTGATCTGCCAGG 0: 1
1: 0
2: 3
3: 17
4: 175
985004860_985004865 5 Left 985004860 4:185524097-185524119 CCCTCCAGTCCTACTGAGGCCAC 0: 1
1: 0
2: 0
3: 19
4: 158
Right 985004865 4:185524125-185524147 AAGACAGTGAGTGATCTGCCAGG 0: 1
1: 0
2: 3
3: 17
4: 175
985004861_985004865 4 Left 985004861 4:185524098-185524120 CCTCCAGTCCTACTGAGGCCACT 0: 1
1: 0
2: 0
3: 17
4: 149
Right 985004865 4:185524125-185524147 AAGACAGTGAGTGATCTGCCAGG 0: 1
1: 0
2: 3
3: 17
4: 175
985004858_985004865 12 Left 985004858 4:185524090-185524112 CCTACTTCCCTCCAGTCCTACTG 0: 1
1: 0
2: 3
3: 25
4: 366
Right 985004865 4:185524125-185524147 AAGACAGTGAGTGATCTGCCAGG 0: 1
1: 0
2: 3
3: 17
4: 175
985004857_985004865 13 Left 985004857 4:185524089-185524111 CCCTACTTCCCTCCAGTCCTACT 0: 1
1: 0
2: 0
3: 33
4: 475
Right 985004865 4:185524125-185524147 AAGACAGTGAGTGATCTGCCAGG 0: 1
1: 0
2: 3
3: 17
4: 175
985004855_985004865 22 Left 985004855 4:185524080-185524102 CCTAGACCTCCCTACTTCCCTCC 0: 1
1: 0
2: 5
3: 85
4: 1296
Right 985004865 4:185524125-185524147 AAGACAGTGAGTGATCTGCCAGG 0: 1
1: 0
2: 3
3: 17
4: 175
985004863_985004865 -4 Left 985004863 4:185524106-185524128 CCTACTGAGGCCACTGCAGAAGA 0: 1
1: 0
2: 2
3: 109
4: 835
Right 985004865 4:185524125-185524147 AAGACAGTGAGTGATCTGCCAGG 0: 1
1: 0
2: 3
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985004865 Original CRISPR AAGACAGTGAGTGATCTGCC AGG Intronic
900160887 1:1223227-1223249 AGGAAAGTGAGTGCTCAGCCAGG - Exonic
903033362 1:20478932-20478954 TAAACAGTGAGTCATCTGTCTGG + Intergenic
903478443 1:23636291-23636313 AAGACAGTGATGGATCCGGCTGG + Intronic
905454398 1:38077909-38077931 GAGCCAGTGAGTGATGTTCCAGG + Intergenic
906288215 1:44602322-44602344 AAGACACTGAGTCCACTGCCTGG + Intronic
906915572 1:50005325-50005347 AAGAGAGTAAGAGTTCTGCCTGG + Intronic
908141080 1:61185586-61185608 AAGACACTGCATGATCTGTCTGG + Intronic
909074593 1:71037956-71037978 ATGAAAGTGTGTGATCTGCCAGG + Intronic
910928817 1:92422505-92422527 AAGAAAGTTAGGGATGTGCCAGG - Intergenic
912602750 1:110954488-110954510 AAGTCAGTGTGTGACCAGCCTGG - Intronic
915104523 1:153525197-153525219 AAGAGAGAGAGAGATCAGCCTGG + Intergenic
916798855 1:168195128-168195150 ATGACAGTGACTTAACTGCCTGG - Intronic
917032040 1:170703763-170703785 AAGACAGTGAGTGACAGGTCTGG + Intronic
917390911 1:174535438-174535460 TAGTCAGTGAGTGATTTGCCAGG + Intronic
923435089 1:233960511-233960533 AAGCCAGAGAGCCATCTGCCAGG - Intronic
923894777 1:238258000-238258022 ACGCCAGTCAGTGATCTTCCTGG - Intergenic
924606351 1:245538750-245538772 AAGGAAGACAGTGATCTGCCAGG - Intronic
1063056219 10:2507376-2507398 AAGCCAGGGAGTGAGATGCCAGG + Intergenic
1063192743 10:3712928-3712950 GAGAGAGAGAGAGATCTGCCAGG + Intergenic
1063580690 10:7304089-7304111 ATGTCAGTGAGTGATTTGCTTGG - Intronic
1064635368 10:17360157-17360179 CAGACAGGGAGAGATCTACCAGG - Intronic
1066629787 10:37447921-37447943 AAGGCAGTGAGTGATAGGACCGG - Intergenic
1068433974 10:56967429-56967451 AAGAAAGTGAGTTATCATCCTGG - Intergenic
1069038300 10:63668703-63668725 CAGAAAGTGAGCTATCTGCCCGG - Intergenic
1070539356 10:77405124-77405146 CATACAGTGAGTGTTCTGCCTGG + Intronic
1070787534 10:79170720-79170742 AAGACAGGGAGGGCTCTGCGGGG - Intronic
1073391829 10:103184417-103184439 AGGACAGTGAGTGATGTGTGTGG - Intronic
1078445346 11:11400630-11400652 AAGACAGTGGTTGATGAGCCAGG - Intronic
1078858787 11:15228438-15228460 AGGACAGTGGGTGACGTGCCTGG - Intronic
1080006147 11:27409247-27409269 AACACTGTGAGTGATGTGCTGGG - Intronic
1080701493 11:34648091-34648113 AAAAGAGTGAGCAATCTGCCTGG - Intronic
1080953295 11:37062660-37062682 AAGAAAGAGAGTGATCTACTGGG + Intergenic
1084142901 11:67245453-67245475 TTGGCAGTGAGTGATCTGCTGGG + Exonic
1084599692 11:70137485-70137507 GAGACAGGGAGGGATCTGACCGG - Intronic
1087184261 11:95170182-95170204 AAGCCAGTGAGGCACCTGCCTGG + Exonic
1087280571 11:96205288-96205310 AAGACTGTGAGTGAACTCCCAGG + Intronic
1087996081 11:104810633-104810655 ATCACAGAGAGTGATCAGCCTGG + Intergenic
1090241471 11:125184985-125185007 TAAACAGTGAGTAACCTGCCTGG - Intronic
1090359465 11:126162573-126162595 CACACTGTGAGTGACCTGCCAGG + Intergenic
1093138903 12:15484220-15484242 AACACAGTGATTGATCTGGATGG - Exonic
1093657907 12:21718317-21718339 AAGACAACAAGTGATGTGCCTGG + Intronic
1093675591 12:21936038-21936060 AAGATAGTGAGTGACATGTCTGG - Intronic
1095354692 12:41257678-41257700 AATTCAGTAAGTGATTTGCCAGG + Intronic
1096174370 12:49502789-49502811 GAGACAATGAGTAATCTGGCAGG - Intronic
1100693381 12:97064050-97064072 AACACAGTGTGTGATTTGCGGGG + Intergenic
1102019539 12:109672496-109672518 CAGACAATGAGTGAGGTGCCTGG - Intergenic
1103129196 12:118452180-118452202 AAGGCAGTGAGTGACCAGCCAGG + Intergenic
1103162799 12:118744111-118744133 TAGACAGAGAGTGATCTGGTGGG + Intergenic
1103645895 12:122392460-122392482 AAGAGAGTGAGTGAGTTACCAGG + Intronic
1104367735 12:128193134-128193156 AAGGCACTGAGTGATGGGCCAGG - Intergenic
1107339889 13:39394909-39394931 AAGAAAGTACTTGATCTGCCTGG + Intronic
1111779264 13:92700867-92700889 AAGACAGAGAATGATCTGAATGG - Intronic
1113557773 13:111252334-111252356 AAGATAGTGAGTGCTCTCTCAGG + Intronic
1113557885 13:111253110-111253132 AAGATAGTGAGTGCTCTCTCAGG + Intronic
1119278865 14:73386534-73386556 AATACAGTGACTACTCTGCCTGG + Intronic
1119796915 14:77406890-77406912 AAGACAGGGAGTGCAATGCCAGG + Intronic
1122570002 14:102690710-102690732 AAGACAGTGAGTGGTTTGTGTGG - Intronic
1123870627 15:24568451-24568473 TAGACATTGAGTCATCTACCAGG - Intergenic
1124416898 15:29479757-29479779 AAGTCAATGAGAGATCTGCCAGG + Intronic
1124618040 15:31256649-31256671 AAGCCAGTGGGTGAGGTGCCTGG - Intergenic
1124847433 15:33305312-33305334 AGGACAGGGACTGATCTGCAAGG + Intergenic
1125009108 15:34850921-34850943 AAGGCATTGGGTGATTTGCCTGG - Intergenic
1125477711 15:40058655-40058677 AAGACAGTGAGTGACCTTGGAGG + Intergenic
1127968562 15:63941990-63942012 AAGACAGTGAGACATCTCCCTGG + Intronic
1128182357 15:65615285-65615307 AAGAGAGTGAGTGGTGAGCCTGG - Intronic
1130560447 15:84954130-84954152 AAGAATGTGATTGATCTGTCAGG + Intergenic
1130620988 15:85462255-85462277 AAGAAAGAGAGTGCCCTGCCAGG + Intronic
1133167455 16:3958171-3958193 AAGCCAGTGTTTGTTCTGCCTGG + Intronic
1137553020 16:49453321-49453343 AGAGCAGTGAGTGGTCTGCCTGG - Intergenic
1138551160 16:57749317-57749339 AAGACAGTAAGTGATTGGCCAGG + Intronic
1139036326 16:62951092-62951114 GAGCTAGTAAGTGATCTGCCTGG - Intergenic
1142690780 17:1605176-1605198 GAGGCAGTGAGTGAACAGCCCGG - Intronic
1144761223 17:17708685-17708707 TAGAAAGAGAGTGAGCTGCCAGG - Intronic
1148665872 17:49374385-49374407 AAGACAGTGAGTGATGGGGGTGG - Intronic
1149962939 17:61132011-61132033 AACACGGTGAGGTATCTGCCAGG - Intronic
1150336463 17:64334174-64334196 CAGACAGTGGGGGAGCTGCCTGG - Intronic
1151670867 17:75571095-75571117 AGGACAGTGAGTGGCCAGCCTGG + Exonic
1152305461 17:79517880-79517902 AAGAAGGTGAGGGATCTGCCGGG - Intergenic
1153231123 18:2937245-2937267 AAGAAAGTGAGTGACGGGCCTGG + Intronic
1157182987 18:45513915-45513937 AACACACAGAGTGCTCTGCCTGG + Intronic
1161656353 19:5517911-5517933 AAGCCAGGGAGTGCTCTTCCAGG + Intergenic
1163730871 19:18948590-18948612 AACACAGTGAGCCCTCTGCCGGG + Intergenic
1164546421 19:29168432-29168454 AATAAGGTGAGTGATCTTCCTGG + Intergenic
1164891246 19:31825618-31825640 CAGACAGTGAGTCACCTGCAAGG + Intergenic
1165964036 19:39559540-39559562 ATGACAGTGAGGAATGTGCCAGG - Intergenic
1167356388 19:49006805-49006827 CAGACAGTGAGTGAGAAGCCAGG - Intronic
925367789 2:3322907-3322929 AAGCGAGTGGGTGATCTGGCTGG + Intronic
925820012 2:7791073-7791095 AAGAGAGTCAGAGATCTGCTTGG + Intergenic
927592612 2:24369742-24369764 AAAAAAAAGAGTGATCTGCCAGG - Intergenic
928625270 2:33133422-33133444 AAGACAGCCAGTCATCTGTCAGG - Intronic
929595786 2:43174775-43174797 AGGACAGTGAGGGATTTGCTGGG - Intergenic
930027868 2:47040351-47040373 ATGAAAGTGAGTGTTCTGTCTGG - Intronic
932837463 2:75050783-75050805 AAGACAGTGAGAGATCAGAGAGG + Intronic
933390312 2:81658384-81658406 AAGAGAGTGAGTGGTTTGGCAGG + Intergenic
933993588 2:87651194-87651216 AAGACAGTGAGAGAGCTCTCTGG - Intergenic
936675140 2:114706129-114706151 AAGTCAGTGAAAGAGCTGCCTGG + Intronic
937026061 2:118698668-118698690 CAGACATTGAGTGGTCTGACAGG + Intergenic
944869355 2:203894197-203894219 AAGACAGGGAGTGATTTCCCAGG - Intergenic
946815184 2:223569859-223569881 AATACAGTGTGTGCTCTTCCTGG - Intergenic
1169915434 20:10678078-10678100 AAGATAGTTATTGATTTGCCAGG + Intergenic
1172117730 20:32582558-32582580 AAGCCAGTGAGCCAGCTGCCAGG + Intronic
1173403603 20:42745911-42745933 AAGACAGTCAGTGAAGTGTCTGG + Intronic
1173428970 20:42968632-42968654 ATGAAAGTGATTGATCAGCCCGG - Intronic
1173544587 20:43885159-43885181 TAGACATTCAGTCATCTGCCTGG + Intergenic
1175814769 20:61877707-61877729 AAGACAGAAACTGATCTTCCTGG - Intronic
1176291406 21:5046983-5047005 TAGAAAGAGAGTGAGCTGCCGGG - Intergenic
1177928421 21:27248938-27248960 AAAACACTGTGAGATCTGCCAGG - Intergenic
1179456312 21:41503221-41503243 AGGACAGTGGGTGACCTCCCAGG + Intronic
1179865849 21:44216658-44216680 TAGAAAGAGAGTGAGCTGCCGGG + Intergenic
1179947476 21:44687968-44687990 AGCACAGTGAGTGACGTGCCAGG + Intronic
1182053989 22:27335220-27335242 GAGGCAGTGAGTGATTTGCTGGG + Intergenic
1182409384 22:30170271-30170293 AATACAGTGAGTTGTGTGCCTGG - Intronic
1182749717 22:32631986-32632008 AAGACAGAGAGTGAAGAGCCAGG + Intronic
1183580670 22:38724460-38724482 ACCACAGTGAGTGATGGGCCTGG + Intronic
1183778779 22:39985257-39985279 AAGCCAGTGACTGATCTGGGTGG - Intergenic
1184165427 22:42724438-42724460 AAAGAAGAGAGTGATCTGCCTGG + Intergenic
1184396986 22:44248128-44248150 AAGGCAGTGAGTGCTCTGCCGGG - Exonic
1184974114 22:48048721-48048743 AAAACTGTGAGAGATTTGCCTGG + Intergenic
949534715 3:4986915-4986937 CAGACAGGGCGTGATCCGCCGGG + Intergenic
954131660 3:48564188-48564210 CCCACAGTGAGTCATCTGCCAGG + Exonic
955117213 3:56017596-56017618 AAGAAAGTGAGTGGTGAGCCAGG - Intronic
955959650 3:64327229-64327251 AAGGCACTGACTGATCAGCCAGG + Intronic
956284948 3:67598276-67598298 AAGACAGTGAGAGTTTTGGCCGG - Intronic
957759782 3:84539858-84539880 AAGATAGTGAGTGAGTTCCCAGG + Intergenic
960054491 3:113267527-113267549 AAGACAAAGAGGAATCTGCCAGG - Intronic
961449236 3:126995010-126995032 AAGACAGGGAGTGGTAAGCCTGG - Intronic
962756621 3:138469862-138469884 AAGGCAGGGAGTGGTTTGCCAGG - Intronic
963262338 3:143205639-143205661 AAGACAGTGAGAGAGCTCTCTGG + Intergenic
963318179 3:143783484-143783506 AAGTCAGTAAGTGCTGTGCCAGG - Intronic
967369509 3:188728466-188728488 AAGAGAGTGATTAATTTGCCTGG + Intronic
968012411 3:195293086-195293108 AAGACAATCACTGATATGCCAGG + Intronic
971399349 4:26261722-26261744 AAGACAGTGAGTGCTCTATCAGG + Intronic
976457464 4:85264988-85265010 AAGAGATTGAGTGATCTGCCTGG + Intergenic
976622326 4:87141717-87141739 AAGGCAGTGAGTGTTCCGGCTGG - Intergenic
979174953 4:117651703-117651725 AAGCCAGGGGGTGCTCTGCCTGG + Intergenic
980929900 4:139176070-139176092 AGGACAGGGAGGGCTCTGCCAGG - Intronic
981077561 4:140606494-140606516 AAGACACTGAGTTATATGCCTGG - Intergenic
981450131 4:144887384-144887406 TAGAAAGTGAATGATCTCCCTGG + Intergenic
984931384 4:184850450-184850472 CAGACAGTGAGAAATCTGCTGGG + Intergenic
985004865 4:185524125-185524147 AAGACAGTGAGTGATCTGCCAGG + Intronic
986318277 5:6606032-6606054 AAGACAGTAAGTGACCGCCCTGG + Intronic
988955155 5:36308908-36308930 AAGAATGTGAGTTATCTGCCTGG + Intergenic
989105453 5:37858880-37858902 CAGACAGTGAGAGATCTGCCAGG - Intergenic
990632946 5:57690991-57691013 AAGACTGTGAGTTATTTGCATGG + Intergenic
993545802 5:89211581-89211603 AAGTCAGGGAGTGAACTGCAAGG - Intergenic
993598713 5:89892388-89892410 AAGACAGTAAGTGACCTTCTTGG - Intergenic
994943556 5:106356502-106356524 ATGACAGTGAGTGAGCTTTCAGG - Intergenic
995548173 5:113253377-113253399 AAGGGAGCAAGTGATCTGCCAGG + Intronic
997756710 5:136406417-136406439 AAGACAGAGAGTGCTTTACCAGG + Intergenic
1002174006 5:177391236-177391258 CAGGCAGAGAGTGAACTGCCGGG - Intronic
1004424314 6:15497223-15497245 AAGACTGTGAGGGAACTGCAGGG - Intronic
1004453494 6:15769650-15769672 AAGACACTGAGTGATCTGATTGG - Intergenic
1005427338 6:25716616-25716638 GAGCCAGTAAGTGATCTCCCAGG + Intergenic
1007281752 6:40717903-40717925 AACAGAGTGAGTGATCAGGCTGG + Intergenic
1008750280 6:54724936-54724958 AAGACCCTGAGAGACCTGCCGGG + Intergenic
1011583306 6:88896455-88896477 GAGACAGTTAATGATCTCCCAGG + Intronic
1012909931 6:105106735-105106757 AAGACAGAGAAGGATCTGCAGGG - Intronic
1012996880 6:105983103-105983125 AAGACAGTGGCTAATCTGCAAGG + Intergenic
1013334546 6:109142147-109142169 AAAACAGTGAGTAATTTCCCTGG + Intronic
1013744443 6:113328349-113328371 AAGATAGAGAATGATTTGCCAGG - Intergenic
1015336222 6:132041966-132041988 AAGACTGTGAGCGATCTGTCTGG + Intergenic
1016873998 6:148846929-148846951 AAGGAAGTGAGTGACCAGCCAGG + Intronic
1020377562 7:7505113-7505135 ATGACAGTGTGTGATTTACCAGG - Intronic
1025030247 7:55551050-55551072 AAGACACTGAGTGCTCTGGTTGG + Intronic
1028839439 7:95411897-95411919 AAGACAGAGAATGATCTGTTAGG - Intronic
1029186089 7:98739866-98739888 AAGAGAGTTTGTGATCAGCCTGG - Intergenic
1029597490 7:101545485-101545507 AAGACAGTGAGTAATGCCCCTGG + Exonic
1030689547 7:112518249-112518271 AAGAAAGTCAGTGGTCGGCCAGG - Intergenic
1031465067 7:122099500-122099522 AAGACAGAAAGTCATCTGCCTGG - Intronic
1032279329 7:130488169-130488191 AAGACAATGAATGACCTGCAAGG - Intronic
1033779792 7:144654912-144654934 AGAACAGAGAGTGAACTGCCTGG - Intronic
1034306017 7:150046321-150046343 GAGACATTGAGTGATTTCCCAGG - Intergenic
1034800822 7:154054325-154054347 GAGACATTGAGTGATTTCCCAGG + Intronic
1038330462 8:26604366-26604388 AAGCCAATGAGTATTCTGCCAGG + Intronic
1038439087 8:27559178-27559200 GAGAGGGTGAGTGATTTGCCTGG + Intergenic
1038482873 8:27913793-27913815 CAGATCGTGAGTGATCTGCAGGG - Intronic
1039514965 8:38124974-38124996 AAGACAGGGAGGGAGGTGCCAGG + Intronic
1042704560 8:71652411-71652433 AAGGCAGTCAGTGGTCTGCGGGG + Intergenic
1042875461 8:73437085-73437107 AATACAGTGTGTGAACTGTCAGG - Intronic
1042890770 8:73608044-73608066 AAGACCATGAGGGATCTGCCTGG - Intronic
1044880125 8:96715245-96715267 AACACAGTGAGTTCTCTGCAGGG + Intronic
1047311842 8:123698567-123698589 AAGACAGTGAGAGACGTGCTGGG + Intronic
1047491900 8:125382097-125382119 GAGCCAGTGAGTGATGGGCCAGG + Intergenic
1048405123 8:134111186-134111208 AAGAGAGTGAGTGATCGGAGAGG + Intergenic
1049274764 8:141714653-141714675 AGGACTGTGAGTGTCCTGCCAGG + Intergenic
1049743366 8:144251679-144251701 AAAACAGTGATTGATGAGCCAGG - Intronic
1050880116 9:10688802-10688824 AAGACAGTGAGAGCTATGACAGG + Intergenic
1056231508 9:84550212-84550234 AAGACAGAGAGTAATTTACCAGG - Intergenic
1056679929 9:88708281-88708303 AAGTCAGTGAGAGCTGTGCCAGG - Intergenic
1057840194 9:98480154-98480176 CAGACAGTGACTCACCTGCCTGG + Intronic
1187270007 X:17771463-17771485 AAGACAGTAAAAGATATGCCTGG - Intergenic
1188141583 X:26558037-26558059 AAGACGGTGAGTGAAAAGCCGGG - Intergenic
1195053545 X:101121169-101121191 AAGATAATGAGTGATAGGCCAGG - Intronic
1196057071 X:111367397-111367419 AAGACAGTGGGTTATTTGCAAGG - Intronic
1198117140 X:133555207-133555229 AAGACAGAGAGTGGCCAGCCTGG - Intronic
1199704842 X:150414993-150415015 CAGCCAGTGAATGATCTCCCTGG + Intronic