ID: 985004866

View in Genome Browser
Species Human (GRCh38)
Location 4:185524128-185524150
Sequence ACAGTGAGTGATCTGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 150}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985004863_985004866 -1 Left 985004863 4:185524106-185524128 CCTACTGAGGCCACTGCAGAAGA 0: 1
1: 0
2: 2
3: 109
4: 835
Right 985004866 4:185524128-185524150 ACAGTGAGTGATCTGCCAGGTGG 0: 1
1: 1
2: 0
3: 8
4: 150
985004861_985004866 7 Left 985004861 4:185524098-185524120 CCTCCAGTCCTACTGAGGCCACT 0: 1
1: 0
2: 0
3: 17
4: 149
Right 985004866 4:185524128-185524150 ACAGTGAGTGATCTGCCAGGTGG 0: 1
1: 1
2: 0
3: 8
4: 150
985004854_985004866 26 Left 985004854 4:185524079-185524101 CCCTAGACCTCCCTACTTCCCTC 0: 1
1: 0
2: 1
3: 51
4: 417
Right 985004866 4:185524128-185524150 ACAGTGAGTGATCTGCCAGGTGG 0: 1
1: 1
2: 0
3: 8
4: 150
985004856_985004866 19 Left 985004856 4:185524086-185524108 CCTCCCTACTTCCCTCCAGTCCT 0: 1
1: 0
2: 8
3: 323
4: 4474
Right 985004866 4:185524128-185524150 ACAGTGAGTGATCTGCCAGGTGG 0: 1
1: 1
2: 0
3: 8
4: 150
985004857_985004866 16 Left 985004857 4:185524089-185524111 CCCTACTTCCCTCCAGTCCTACT 0: 1
1: 0
2: 0
3: 33
4: 475
Right 985004866 4:185524128-185524150 ACAGTGAGTGATCTGCCAGGTGG 0: 1
1: 1
2: 0
3: 8
4: 150
985004858_985004866 15 Left 985004858 4:185524090-185524112 CCTACTTCCCTCCAGTCCTACTG 0: 1
1: 0
2: 3
3: 25
4: 366
Right 985004866 4:185524128-185524150 ACAGTGAGTGATCTGCCAGGTGG 0: 1
1: 1
2: 0
3: 8
4: 150
985004862_985004866 4 Left 985004862 4:185524101-185524123 CCAGTCCTACTGAGGCCACTGCA 0: 1
1: 0
2: 1
3: 18
4: 188
Right 985004866 4:185524128-185524150 ACAGTGAGTGATCTGCCAGGTGG 0: 1
1: 1
2: 0
3: 8
4: 150
985004860_985004866 8 Left 985004860 4:185524097-185524119 CCCTCCAGTCCTACTGAGGCCAC 0: 1
1: 0
2: 0
3: 19
4: 158
Right 985004866 4:185524128-185524150 ACAGTGAGTGATCTGCCAGGTGG 0: 1
1: 1
2: 0
3: 8
4: 150
985004855_985004866 25 Left 985004855 4:185524080-185524102 CCTAGACCTCCCTACTTCCCTCC 0: 1
1: 0
2: 5
3: 85
4: 1296
Right 985004866 4:185524128-185524150 ACAGTGAGTGATCTGCCAGGTGG 0: 1
1: 1
2: 0
3: 8
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985004866 Original CRISPR ACAGTGAGTGATCTGCCAGG TGG Intronic
903181101 1:21605225-21605247 ACAGTCAGTGATCACACAGGAGG + Intronic
904388569 1:30163857-30163879 ACAGTCAGTCATCTGCAAGCTGG - Intergenic
905424814 1:37874860-37874882 AGTGTGAGTGATCTTCCATGTGG + Intronic
905702642 1:40029901-40029923 AGAGTGAGTGATCTAGGAGGTGG - Intergenic
907485740 1:54776898-54776920 ACAGTGAGTCTTCTGAAAGGAGG - Intergenic
907715723 1:56924222-56924244 ACAAGGAGTCATCTGGCAGGAGG + Intergenic
910066048 1:83151906-83151928 ATTGTGAGTGGCCTGCCAGGAGG + Intergenic
912857970 1:113188784-113188806 AAAGTGAGGGATCTCCCTGGAGG - Intergenic
918148139 1:181775945-181775967 ATAGTCAGGGATCTGCAAGGAGG - Intronic
921427568 1:215022033-215022055 ACAGTGTGTCATCTGCAAGCTGG - Intronic
923991745 1:239445357-239445379 ACAGAGAGTGATCAGCCGTGTGG + Intronic
1063674726 10:8130611-8130633 GCAGTGACAGCTCTGCCAGGAGG - Intergenic
1065844580 10:29735041-29735063 ACAGTGAGTGAGCGGCGGGGAGG - Intronic
1068544279 10:58328398-58328420 GCTGTGACTGATCTGACAGGAGG + Intergenic
1071778041 10:88811003-88811025 ACTGTGAGTGAAGGGCCAGGAGG - Intronic
1072761490 10:98060606-98060628 TCAGTGAGTGAAATGCCTGGCGG - Intergenic
1074896388 10:117781091-117781113 AGAGAGAGTGAGCTGCCAGCTGG - Intergenic
1075121776 10:119669777-119669799 ACAGTGTTTCCTCTGCCAGGAGG + Intronic
1075397710 10:122139953-122139975 TCAGTGAGGGATCTGCCTAGCGG + Intronic
1076165544 10:128279568-128279590 ACAGTGAGCCGTTTGCCAGGTGG + Intergenic
1077015147 11:396014-396036 ACAGTGAGTGGACAGACAGGTGG - Intronic
1079300511 11:19275111-19275133 GCAGTGGGTGAGCTGCCACGAGG + Intergenic
1080512421 11:32988081-32988103 GCCGTGACTGATCTGACAGGAGG - Intronic
1081441349 11:43085003-43085025 ACAGTGAGTGAATTCTCAGGAGG - Intergenic
1084972096 11:72777589-72777611 ACAGGGACTGAACTGTCAGGAGG + Intronic
1086134102 11:83429765-83429787 ACAGTGAGTGGTCTGCCCATTGG + Intergenic
1087584125 11:100096507-100096529 ACAGTGATGGAGCTCCCAGGTGG - Intronic
1092777308 12:11955085-11955107 CCAGGGAGTGTTCTGGCAGGTGG - Intergenic
1092942761 12:13425872-13425894 ACACTGAGTCATTTGCCACGGGG - Intergenic
1100333492 12:93607820-93607842 ACAGTGAGGGGTATTCCAGGGGG - Intergenic
1100598790 12:96094432-96094454 AGAGTGAGTGAACTGCCTGAGGG + Intergenic
1101680285 12:106956866-106956888 GCAGTGAGTGACGTGGCAGGAGG - Intronic
1101844859 12:108355205-108355227 ACAGTGAGGGCTGTGCCAAGTGG - Intergenic
1102986068 12:117279739-117279761 ACAGTTAGTGCTCAGCCAAGTGG + Intronic
1104247120 12:127054586-127054608 ACAGTGAGGGAGCTGCCTGCAGG + Intergenic
1105677603 13:22689859-22689881 ACAGTGAGTTATTTGACAGCTGG - Intergenic
1107635432 13:42387688-42387710 AGAGTGAGTGATATTCAAGGAGG + Intergenic
1111078647 13:83272978-83273000 ACTGTGAGTGATTTCCAAGGTGG + Intergenic
1111338055 13:86847646-86847668 ACAGGGAGTGTTCAGCCAGCGGG - Intergenic
1112487901 13:99836197-99836219 ACAGTGTGGACTCTGCCAGGGGG + Intronic
1114827961 14:26104677-26104699 ACAGTGATATATTTGCCAGGTGG - Intergenic
1117204178 14:53424183-53424205 TCTGAGATTGATCTGCCAGGTGG + Intergenic
1117467959 14:56013246-56013268 ACAGTGAATGTTTTGCCAGCAGG + Intergenic
1119267313 14:73270638-73270660 ACAGTGAGAGAACTGTCAAGAGG + Intronic
1122605866 14:102947407-102947429 ACAGCGTGTGCACTGCCAGGCGG - Intronic
1124017699 15:25891596-25891618 ATAGAGAGTGAGCTCCCAGGGGG - Intergenic
1124610787 15:31206978-31207000 ACAGTGAGAGCTTTTCCAGGTGG - Intergenic
1125089137 15:35770439-35770461 ACAGAGAATTATCTTCCAGGTGG - Intergenic
1125501040 15:40240446-40240468 CCAGTGAGTAAGCTGCCAGAGGG + Intronic
1125533677 15:40430128-40430150 ACCCTGACTGCTCTGCCAGGTGG - Intronic
1125933310 15:43615413-43615435 AGTGTGAGTGCTCTGCCAGAGGG - Exonic
1125946408 15:43714875-43714897 AGTGTGAGTGCTCTGCCAGAGGG - Intergenic
1127110909 15:55669404-55669426 ACAGAGAGTGATGTGTCTGGAGG - Intronic
1129557446 15:76527460-76527482 ACAGTTACTGAGCTGGCAGGTGG + Intronic
1132480907 16:165709-165731 AAAGTTACTGCTCTGCCAGGAGG - Intronic
1140455772 16:75104809-75104831 TGAGTGTGTGATCTGCCTGGAGG + Exonic
1141045700 16:80714525-80714547 ATAGTGAGTAACCAGCCAGGTGG - Intronic
1142026719 16:87818380-87818402 ACAGAGAGGGATCTGCCAACGGG + Intergenic
1142167753 16:88601907-88601929 ACTGTCAGGGTTCTGCCAGGAGG + Intronic
1144839800 17:18178893-18178915 ACAGTGAGTCTTCTGGCAGAAGG - Exonic
1151552590 17:74830651-74830673 ACAAGGACTGAGCTGCCAGGAGG - Intronic
1152233233 17:79125350-79125372 ACAATGACTCATCTGCCTGGAGG + Intronic
1158643017 18:59219615-59219637 AGAGAGAGAGATCTGCAAGGAGG + Intergenic
1158649828 18:59274462-59274484 ACAGTGACTGATCGGCCACTTGG + Intergenic
1162045030 19:7993429-7993451 ACAGTGAGTGAGCTGGAAAGAGG + Intronic
1164546422 19:29168435-29168457 AAGGTGAGTGATCTTCCTGGAGG + Intergenic
1164853464 19:31502979-31503001 GCAGAGGGTGATCTGCCAGAGGG - Intergenic
926706622 2:15842036-15842058 AGAGTGAGTACTCTGCCAGAGGG - Intergenic
930221285 2:48749194-48749216 GCTGTGAGTGGTTTGCCAGGAGG + Intronic
933274940 2:80273652-80273674 ACAGTGAGAGATTTGCAAGGGGG - Intronic
933892127 2:86781620-86781642 ACAGTGAATAAGTTGCCAGGTGG - Intergenic
934659292 2:96134620-96134642 GCAGTGAGTGCTCGGGCAGGTGG - Intronic
936525978 2:113241988-113242010 ACAGTGAGTGCTGGGACAGGAGG - Exonic
941700635 2:168600609-168600631 AGAGTGAGTGAGATGCCAAGGGG - Intronic
946815183 2:223569856-223569878 ACAGTGTGTGCTCTTCCTGGTGG - Intergenic
1172167583 20:32908410-32908432 TCAGTGAGTGCTGTCCCAGGAGG + Intronic
1173241144 20:41298364-41298386 ACAGTGAGTGACATGCTATGAGG + Intronic
1174960889 20:55155612-55155634 ACAGTGGGTATTCTGACAGGAGG + Intergenic
1180195153 21:46189686-46189708 AGGGAGAGTGATCAGCCAGGGGG + Exonic
1184397389 22:44250918-44250940 AGAGTGAGTGATACGCCAAGAGG + Intronic
1185185002 22:49393715-49393737 TCAGTCAGTGATCTGCCCAGTGG - Intergenic
950680550 3:14582204-14582226 ACAGTGGGATACCTGCCAGGAGG - Intergenic
951651489 3:24955849-24955871 ACACTAAGAGATCGGCCAGGGGG - Intergenic
953690735 3:45116497-45116519 ACATTAACTGATTTGCCAGGTGG + Intronic
954371535 3:50171697-50171719 ACTGTGGGTGAGCAGCCAGGCGG + Intronic
955531603 3:59878847-59878869 ACAGTGAATTAGCTGCCATGGGG - Intronic
957869844 3:86077312-86077334 TTAGTGAGTTATCTGACAGGAGG + Intergenic
960587439 3:119333361-119333383 ACAGTGAGTAATATGCTAGTGGG - Intronic
961485341 3:127211973-127211995 ACAGGGACTGATGTGCCACGGGG - Intergenic
962644256 3:137420335-137420357 ACAGTGGCTGTTCTGCCAGTGGG - Intergenic
962810031 3:138951712-138951734 ACAGTGAGTGCCTTGCCAGTAGG + Exonic
964209650 3:154212750-154212772 GCTGTGACTGATCTGACAGGAGG + Intronic
965771346 3:172184644-172184666 GCAGTGTGTGATCATCCAGGAGG + Intronic
967043149 3:185712486-185712508 AGAGTGAGAGATATGCCAAGTGG + Intronic
973305587 4:48645439-48645461 ACAGTGAGAAATATGCCAAGTGG - Intronic
973826522 4:54712530-54712552 CCAGTGTGTGGTCTGCCAGTTGG + Intronic
974938537 4:68436715-68436737 AAAGGAAGTGTTCTGCCAGGCGG + Intergenic
981450132 4:144887387-144887409 AAAGTGAATGATCTCCCTGGAGG + Intergenic
984860526 4:184233884-184233906 ACAGAGAATGATTTGCCAGTTGG + Intergenic
984927960 4:184823192-184823214 ACAGGCGGTGATCTGACAGGAGG - Intronic
985004866 4:185524128-185524150 ACAGTGAGTGATCTGCCAGGTGG + Intronic
989105452 5:37858877-37858899 ACAGTGAGAGATCTGCCAGGAGG - Intergenic
989369580 5:40692093-40692115 GCAGTGAGAGGTCTGGCAGGAGG - Exonic
995545476 5:113225843-113225865 AAAGTGAGAGAGCTGGCAGGTGG + Intronic
995548174 5:113253380-113253402 GGAGCAAGTGATCTGCCAGGAGG + Intronic
997667837 5:135646311-135646333 AAAATGAGTGATCTGCCATAAGG - Intergenic
1002174005 5:177391233-177391255 GCAGAGAGTGAACTGCCGGGAGG - Intronic
1002620467 5:180484535-180484557 TCAGTGATTAATCTGCCAGCAGG + Intergenic
1004307142 6:14511199-14511221 ACAGTCAGTGATGTGCTATGGGG - Intergenic
1005336790 6:24804980-24805002 CCAGTGAGTGATTTCCCTGGGGG + Exonic
1007420580 6:41716849-41716871 ACTCTGAGTGATGGGCCAGGGGG - Intronic
1008907937 6:56700074-56700096 GCAGTGGCTGATCTGACAGGAGG - Intronic
1012914051 6:105149561-105149583 ACACTGAGTGGTCTGATAGGTGG + Intergenic
1013104401 6:107014367-107014389 AAAGTGAGTGTCCTGCCAGGGGG - Intergenic
1017417919 6:154241708-154241730 AGAGTGAGGGAGCTGCCAGAAGG - Intronic
1017517894 6:155174106-155174128 AAAGGGAGTTAACTGCCAGGCGG + Intronic
1019280955 7:200006-200028 ACACTGATTGATCTGCCAAAAGG + Intronic
1019309687 7:353955-353977 CCAGGGAGTGAGATGCCAGGAGG + Intergenic
1020083306 7:5297761-5297783 AAAGGGAGTGGTCTCCCAGGTGG + Intronic
1020411533 7:7896860-7896882 ACAGTGAGTAGTCTCCTAGGGGG + Intronic
1021624249 7:22576938-22576960 AGATTCAGTGATTTGCCAGGAGG - Intronic
1023771335 7:43559346-43559368 AGAGTGAGTCACCTGCCAGTAGG + Intronic
1023998749 7:45177673-45177695 GCCGTGAGTGATGTGCCAGGGGG - Intronic
1025210971 7:57019442-57019464 AAAGGGAGTGGTCTCCCAGGTGG - Intergenic
1025660984 7:63557405-63557427 AAAGGGAGTGGTCTCCCAGGTGG + Intergenic
1027278062 7:76582869-76582891 ATTGTGAGTGGCCTGCCAGGAGG - Intergenic
1028667825 7:93366998-93367020 ACAGGAAGTGATCTGCAAGTGGG + Intergenic
1029455703 7:100670635-100670657 ACACAGAATGATCTGCCTGGTGG - Intergenic
1030093293 7:105876574-105876596 ACATTGAGTGTTCTGAAAGGGGG + Exonic
1031478302 7:122248934-122248956 CCAGTGACTGATCAACCAGGAGG - Intergenic
1034130523 7:148711960-148711982 AGAGGGAGAGACCTGCCAGGAGG + Intronic
1034731112 7:153388354-153388376 ACAGTGAGTGAGCTCTCATGAGG - Intergenic
1035026157 7:155827654-155827676 ACAGAAAGTCCTCTGCCAGGAGG - Intergenic
1035544479 8:468862-468884 ATAGTGAGTGTTCTGTGAGGTGG + Exonic
1035635185 8:1139014-1139036 ACAGTGCGTAACCAGCCAGGGGG - Intergenic
1037784307 8:21893424-21893446 CCAGCTGGTGATCTGCCAGGGGG + Intergenic
1042186047 8:66137145-66137167 CCAGGGAGTGATCAGCCAGCTGG + Exonic
1047491902 8:125382100-125382122 CCAGTGAGTGATGGGCCAGGAGG + Intergenic
1047846915 8:128816126-128816148 ACAAGGAGTGATCTGCCACAAGG - Intergenic
1049519031 8:143078942-143078964 AGAGTGAGTGTGCAGCCAGGTGG - Intergenic
1049743365 8:144251676-144251698 ACAGTGATTGATGAGCCAGGCGG - Intronic
1050279631 9:4036771-4036793 ACTGTGGGTGATATACCAGGAGG + Intronic
1050312924 9:4371589-4371611 CCAGTGAGAGATCAGCAAGGAGG - Intergenic
1052630669 9:31034624-31034646 AGAGTGAGTGAGCTGCCACGTGG - Intergenic
1052799901 9:32957305-32957327 ACAGTGTGTGATCTGCCCAGAGG - Intergenic
1053210094 9:36220311-36220333 ACAGTGTGTGCTGGGCCAGGGGG - Intronic
1055397872 9:75892549-75892571 ACCCTGCGTGCTCTGCCAGGGGG + Intronic
1055845755 9:80561092-80561114 ACAGTGAATGATGTGTCAGTTGG + Intergenic
1056076341 9:83044917-83044939 ACAAAGACTGATCTCCCAGGAGG + Intronic
1056896846 9:90559213-90559235 ACAGTGAGTGAACCTGCAGGTGG + Intergenic
1057215343 9:93224788-93224810 ACATTGAGTGAGCAGCCAGGAGG + Intronic
1058995906 9:110298520-110298542 AGAGTGATTGATTTGCCTGGAGG - Intergenic
1059957676 9:119535183-119535205 ACAGTGAGTGAGATGGGAGGAGG + Intergenic
1062438144 9:136556252-136556274 AGAGTGTGAGCTCTGCCAGGAGG + Intergenic
1187426271 X:19180182-19180204 ACATTTAGAGATCTACCAGGAGG + Intergenic
1191152471 X:57234687-57234709 GCAGCCAGTGATCTGACAGGAGG + Intergenic
1194366015 X:93014685-93014707 ACTTTGAGTTATCTACCAGGTGG - Intergenic
1197046808 X:122007560-122007582 ACAGTCAGTGATGTGCCGAGTGG - Intergenic
1197464417 X:126785025-126785047 ACAGTGAGTGAGCTCTCATGAGG + Intergenic
1199070755 X:143472442-143472464 ACAGAGAGAGAACAGCCAGGAGG - Intergenic