ID: 985004867

View in Genome Browser
Species Human (GRCh38)
Location 4:185524140-185524162
Sequence CTGCCAGGTGGATGTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985004862_985004867 16 Left 985004862 4:185524101-185524123 CCAGTCCTACTGAGGCCACTGCA 0: 1
1: 0
2: 1
3: 18
4: 188
Right 985004867 4:185524140-185524162 CTGCCAGGTGGATGTGTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 114
985004857_985004867 28 Left 985004857 4:185524089-185524111 CCCTACTTCCCTCCAGTCCTACT 0: 1
1: 0
2: 0
3: 33
4: 475
Right 985004867 4:185524140-185524162 CTGCCAGGTGGATGTGTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 114
985004858_985004867 27 Left 985004858 4:185524090-185524112 CCTACTTCCCTCCAGTCCTACTG 0: 1
1: 0
2: 3
3: 25
4: 366
Right 985004867 4:185524140-185524162 CTGCCAGGTGGATGTGTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 114
985004860_985004867 20 Left 985004860 4:185524097-185524119 CCCTCCAGTCCTACTGAGGCCAC 0: 1
1: 0
2: 0
3: 19
4: 158
Right 985004867 4:185524140-185524162 CTGCCAGGTGGATGTGTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 114
985004864_985004867 1 Left 985004864 4:185524116-185524138 CCACTGCAGAAGACAGTGAGTGA 0: 1
1: 0
2: 1
3: 27
4: 306
Right 985004867 4:185524140-185524162 CTGCCAGGTGGATGTGTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 114
985004863_985004867 11 Left 985004863 4:185524106-185524128 CCTACTGAGGCCACTGCAGAAGA 0: 1
1: 0
2: 2
3: 109
4: 835
Right 985004867 4:185524140-185524162 CTGCCAGGTGGATGTGTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 114
985004861_985004867 19 Left 985004861 4:185524098-185524120 CCTCCAGTCCTACTGAGGCCACT 0: 1
1: 0
2: 0
3: 17
4: 149
Right 985004867 4:185524140-185524162 CTGCCAGGTGGATGTGTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985004867 Original CRISPR CTGCCAGGTGGATGTGTTAC TGG Intronic
903131896 1:21284879-21284901 CTCCCAGGTGGCTGGGTTTCTGG - Intronic
907973358 1:59406973-59406995 CTGCAAGGGTGCTGTGTTACAGG + Intronic
920337449 1:205254685-205254707 CTGCCAGGTGCCTGTGTTGGGGG + Intronic
921885227 1:220298628-220298650 CTGGGAGGTGGATGTGTCAAAGG - Intergenic
923024481 1:230194082-230194104 GAGCCTGGTGGATGGGTTACGGG + Intronic
923377219 1:233376521-233376543 CAGCCAGGTAAATGTGTTTCAGG + Exonic
923465661 1:234246137-234246159 CTGTTAGGAAGATGTGTTACTGG + Intronic
1062789222 10:290885-290907 CTGCCAGGTGCATCTGATTCCGG - Intronic
1064057054 10:12106559-12106581 CTGTCAGGTTAATGTGTTACTGG + Intronic
1064338715 10:14467663-14467685 CTTCATGGTGCATGTGTTACAGG + Intergenic
1064487396 10:15808571-15808593 CTTCCAGTGGGATCTGTTACTGG - Intronic
1070704505 10:78628155-78628177 ATGGCATGTGGATGTGTCACAGG - Intergenic
1073293972 10:102427407-102427429 CTGCCACGTGTATGTTTTACAGG + Intronic
1075659443 10:124183273-124183295 CTGCCACCTGCACGTGTTACTGG - Intergenic
1076059336 10:127401247-127401269 CTCCCACGTGGCGGTGTTACTGG + Intronic
1078193503 11:9113896-9113918 CTGACAGGTGGAAGGATTACTGG + Intronic
1079093195 11:17494822-17494844 CTGGCAGGTGGCTGTGAAACTGG - Intronic
1084639458 11:70415934-70415956 CTCCGAGGGGGATGTGTAACGGG - Intronic
1085405095 11:76256972-76256994 CTCACAGTTGGATGTGTTTCTGG - Intergenic
1089067833 11:115675341-115675363 CAGCCACGTGGCTGTGTTGCCGG - Intergenic
1089317925 11:117604873-117604895 CTGCCATGGGGATGTGAGACAGG + Intronic
1096584092 12:52608317-52608339 CTGCCTGGGGGCTGTGTCACTGG - Exonic
1100089636 12:90954412-90954434 CTGCCCGGTGCAAGTGTTTCGGG - Exonic
1100118470 12:91339540-91339562 CTGCCAGGTGGATGTCTCCAGGG + Intergenic
1104069022 12:125328729-125328751 GTTCCAGGTGGATGTGTTTTGGG + Intronic
1104288861 12:127450018-127450040 CTTCCAGGTGGATGTGTTGGAGG - Intergenic
1106414481 13:29534989-29535011 TTGCTGGGTGGATGTGTTACAGG + Intronic
1115233817 14:31189078-31189100 CTGCCACCTGGATATGTTTCAGG + Intronic
1117996803 14:61485382-61485404 CTGTCAAGTGGATGTATTCCAGG - Intronic
1119867083 14:77982673-77982695 CTGCCAGGTGAATGTGTGGCTGG + Intergenic
1123924329 15:25093146-25093168 CTGCCTGGGGGTTGTGTGACAGG + Intergenic
1125259594 15:37807941-37807963 CTGCAAGGTAGATGTGGTAGTGG - Intergenic
1128559112 15:68652922-68652944 CTGCCATTTGGATGTCTTAGAGG + Intronic
1128608580 15:69056485-69056507 CCTCCAGGTGGTTGTGTCACTGG + Intronic
1131503894 15:92998631-92998653 CTGCCAGCTGGTTGTTTTTCAGG + Intronic
1133131016 16:3676168-3676190 AAGCCAGGTGGATGTGACACTGG + Intronic
1133642622 16:7732410-7732432 CTGTTTGGTGGATGTGTTCCTGG - Intergenic
1133704723 16:8342927-8342949 CAGCCAGGTGAATGTAATACCGG - Intergenic
1138494448 16:57399166-57399188 CTGCCACCTGGATGTTTTCCTGG + Intergenic
1140389069 16:74569462-74569484 TTACGAGGTGGATGTGTTCCAGG - Intronic
1140690961 16:77483351-77483373 CTGCTAGGTGGCTGTGTGGCAGG - Intergenic
1141898488 16:86974195-86974217 CTGCCAGCTGGACTTGTTAATGG - Intergenic
1142337437 16:89498969-89498991 CTGCCTTGTGGATGTGTAACTGG + Intronic
1143386034 17:6531042-6531064 CTGCCAGGAGATAGTGTTACTGG - Intronic
1149777166 17:59367048-59367070 CTGCCAGGTACCTGTGTGACTGG + Intronic
1151132678 17:71914389-71914411 CTGCCTTGTGCATGTGTTATGGG - Intergenic
1153225305 18:2895328-2895350 CTTCCAGGAGGAGGTGTTACTGG + Intronic
1156309180 18:35907197-35907219 CTGCCTGGTGGCTCTGTGACAGG - Intergenic
1158321328 18:56267568-56267590 CTGGCAGGTGGCTGGGTGACGGG + Intergenic
1158546949 18:58404995-58405017 ATGCCGGGATGATGTGTTACAGG - Intergenic
1160980858 19:1815960-1815982 CGGCCAGGTGGACGGGTTACCGG + Exonic
1165300433 19:34964736-34964758 CTACCAGGTAGATGGGATACAGG + Intergenic
1166459297 19:42972138-42972160 TGACCAGGTGGATATGTTACAGG - Intronic
1168549497 19:57281105-57281127 TGGCCAGGTGGATGGGGTACGGG - Intronic
926654048 2:15379777-15379799 CAGCCAGGTGGATGTTTTCAAGG + Exonic
929420097 2:41781552-41781574 CTGCCAGATGGATGTCTTTGAGG - Intergenic
932744082 2:74317178-74317200 CTGCAAGGTGGCCATGTTACAGG - Intronic
934647180 2:96065763-96065785 CTGCCAGGTTGCTGTGTTCCAGG - Intergenic
934950285 2:98571243-98571265 CTGCCAAGTGGGTGTGAAACCGG - Intronic
935970931 2:108530211-108530233 CAGGCAGGTAGTTGTGTTACTGG + Intergenic
936419205 2:112347360-112347382 CAGGCAGGTAGTTGTGTTACTGG - Intergenic
938766210 2:134462065-134462087 CTGCTAGGTGGGTGTGTTGCCGG - Intronic
939069864 2:137526143-137526165 CGGCCAGGTAGAAGTGGTACGGG - Intronic
939702496 2:145411163-145411185 CTGCTAGTTGTATGAGTTACAGG - Intergenic
946870407 2:224079385-224079407 TTGCCAGGTGGAGGTGGTAAGGG - Intergenic
1170666869 20:18394194-18394216 CTGCCAAGTCCATGTGTTCCTGG + Intronic
1172153900 20:32810402-32810424 CTCCCAAGTTGATGTGTTGCAGG + Intergenic
1173155883 20:40608298-40608320 CAGCCAGGTAGACGTGTTTCAGG - Intergenic
1173547439 20:43909795-43909817 CTTCCAGGTGGAAGTTTTAAGGG - Intergenic
1173818576 20:46006236-46006258 CTGGCAGGGGGAGGTGCTACTGG + Intergenic
1174311346 20:49657596-49657618 GTGAAAGGGGGATGTGTTACAGG + Intronic
1175916954 20:62430459-62430481 CTGCCTGGTATTTGTGTTACTGG + Intergenic
1176128236 20:63485435-63485457 CCTCCAGGTGGGTGTGTTTCTGG - Intergenic
1179095980 21:38314668-38314690 CTGAGAGGTGGATGTGAAACCGG - Intergenic
1179298721 21:40087870-40087892 CTGCCAGGGGCATCTGGTACTGG + Intronic
1179536573 21:42056639-42056661 CTTCCAGCTGCAGGTGTTACCGG + Intergenic
1182106186 22:27691448-27691470 CTGCCTGGAGGATGGGTTAGTGG - Intergenic
1183673636 22:39287857-39287879 CTGCAAGGAGGGTGTGTTTCTGG + Intergenic
1183779389 22:39988989-39989011 GTGCCTGGGGGATGTGTGACTGG + Intergenic
1184453215 22:44595018-44595040 CTGCCAGGTGCATGTGAGCCAGG + Intergenic
954161412 3:48725357-48725379 CTGACAGGTGGAAGTTTTAGTGG + Intronic
957227377 3:77467410-77467432 GTACCAGGTAGGTGTGTTACAGG - Intronic
957296844 3:78343874-78343896 GTGCCATGTGGAAGTGTTACTGG + Intergenic
958486271 3:94714422-94714444 CAGTCATGAGGATGTGTTACAGG - Intergenic
959117783 3:102197817-102197839 CTGCCAGGTGGCTGAGCTCCTGG + Intronic
967563755 3:190948973-190948995 ATGCCAGTTGGATGTCTTAATGG + Intergenic
968615280 4:1574949-1574971 GTGCCAGGTGGATGAGTGACAGG + Intergenic
968727556 4:2255407-2255429 GGGCCAGGTGGACCTGTTACTGG - Intronic
969211239 4:5689080-5689102 CTTCCAGGTGAATGTGTTCTGGG - Intronic
974799983 4:66804410-66804432 CTGACAGATGGATGTGTTCAAGG - Intergenic
978369882 4:108019554-108019576 CTGCAAGGAGGAAGTGTTGCTGG - Exonic
978713493 4:111813867-111813889 CTGATAGGTGGATGTGTTTGTGG - Intergenic
985004867 4:185524140-185524162 CTGCCAGGTGGATGTGTTACTGG + Intronic
998217304 5:140246971-140246993 CTGCCTGGTGACTGTATTACTGG - Intronic
1002072128 5:176685886-176685908 ATGCTAGGAGGATTTGTTACTGG + Intergenic
1002947772 6:1779284-1779306 CGGCCAGGAGGCTGTGTTAGTGG - Intronic
1003966401 6:11256310-11256332 CTGCCAGGTGTATGTGCAGCAGG + Intronic
1006352920 6:33534388-33534410 CTTCCAAGTGGCTGGGTTACAGG - Intergenic
1006521726 6:34574873-34574895 CTGCCAGGAGGATCTGTCCCGGG + Intergenic
1007212507 6:40206618-40206640 CCTCCAGGTGGGTGTGTTGCAGG + Intergenic
1012931415 6:105321408-105321430 CTGCCAGGTGCCTGTGGCACTGG - Intronic
1013464066 6:110401198-110401220 CTTCCAGGTGGTTGTGGTAGAGG + Intronic
1013700560 6:112764508-112764530 CTGTCAGGTGGATGTGAGAGAGG + Intergenic
1015818025 6:137230389-137230411 CTGCCAGGTGGCTGGTTTGCTGG + Intergenic
1016113426 6:140254222-140254244 CTGCCAGGGAGATGTGCTATGGG + Intergenic
1018967935 6:168503199-168503221 CTTCCATGTGGATGGATTACAGG + Intronic
1020220308 7:6231521-6231543 CTGAGAGGTGGATCTGTTCCTGG - Intronic
1027364983 7:77447987-77448009 CTGCAATGTGAACGTGTTACAGG + Intergenic
1032778144 7:135137027-135137049 CTGCCAGGTGGAGGAGATGCTGG - Intronic
1033036821 7:137883021-137883043 CTGGCAGGGGGATGAGGTACAGG + Intronic
1034346207 7:150386819-150386841 CTGCCACCTGCATTTGTTACGGG + Intronic
1034647471 7:152661526-152661548 CTGCCAGGTGAATGGGGCACAGG + Intronic
1036285932 8:7444098-7444120 CTGCCAAATGCATGTGTTCCTGG - Intronic
1036335541 8:7867431-7867453 CTGCCAAATGCATGTGTTCCTGG + Intronic
1047281457 8:123449723-123449745 GTGCCAGTTGGATGTCTAACAGG + Intronic
1050418253 9:5436628-5436650 CTCCCAGGTGGAAGGGTTAAAGG + Exonic
1055772996 9:79737139-79737161 TAGCCAGGTGGTTGTGTTTCAGG - Intergenic
1056967789 9:91179093-91179115 CTGCCACCTGGAGGTGTCACAGG + Intergenic
1057569497 9:96193755-96193777 TTTCCAGGTGGATGTGCTCCAGG - Intergenic
1062008273 9:134252650-134252672 CTGGCAGGAGGAGGTGTCACGGG + Intergenic
1186185879 X:7019271-7019293 TGACCAGGTGGATATGTTACAGG - Intergenic
1187058210 X:15760892-15760914 ATGGCAGTTGGATATGTTACAGG + Intronic
1192112198 X:68376514-68376536 CTGTTTGGTGGGTGTGTTACTGG + Intronic
1193479541 X:82010529-82010551 CTGCCAGCTGGATGTTTCCCTGG + Intergenic
1195942173 X:110175639-110175661 CTGACAGGTGGATCTGTCTCTGG - Exonic
1198057495 X:133009390-133009412 CTGCAAGGTGGGGGTGTTCCTGG + Intergenic
1198209093 X:134499353-134499375 CTCCCAGGTAGCTGGGTTACAGG - Intronic