ID: 985007829

View in Genome Browser
Species Human (GRCh38)
Location 4:185551794-185551816
Sequence CAATCAAATAAGTGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985007829_985007832 14 Left 985007829 4:185551794-185551816 CCAGCTTCTCACTTATTTGATTG No data
Right 985007832 4:185551831-185551853 ACATGTCTAGCATTGTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985007829 Original CRISPR CAATCAAATAAGTGAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr