ID: 985007894

View in Genome Browser
Species Human (GRCh38)
Location 4:185552581-185552603
Sequence GAGTAAACACACAGATTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985007894_985007896 1 Left 985007894 4:185552581-185552603 CCTCTGAATCTGTGTGTTTACTC No data
Right 985007896 4:185552605-185552627 ACTTCCCCTCCATCCCTTTAGGG No data
985007894_985007895 0 Left 985007894 4:185552581-185552603 CCTCTGAATCTGTGTGTTTACTC No data
Right 985007895 4:185552604-185552626 TACTTCCCCTCCATCCCTTTAGG No data
985007894_985007903 16 Left 985007894 4:185552581-185552603 CCTCTGAATCTGTGTGTTTACTC No data
Right 985007903 4:185552620-185552642 CTTTAGGGCCCTTGTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985007894 Original CRISPR GAGTAAACACACAGATTCAG AGG (reversed) Intergenic