ID: 985007895

View in Genome Browser
Species Human (GRCh38)
Location 4:185552604-185552626
Sequence TACTTCCCCTCCATCCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985007894_985007895 0 Left 985007894 4:185552581-185552603 CCTCTGAATCTGTGTGTTTACTC No data
Right 985007895 4:185552604-185552626 TACTTCCCCTCCATCCCTTTAGG No data
985007891_985007895 24 Left 985007891 4:185552557-185552579 CCATTACCTCCAGAACTTTTTGT No data
Right 985007895 4:185552604-185552626 TACTTCCCCTCCATCCCTTTAGG No data
985007890_985007895 27 Left 985007890 4:185552554-185552576 CCTCCATTACCTCCAGAACTTTT No data
Right 985007895 4:185552604-185552626 TACTTCCCCTCCATCCCTTTAGG No data
985007892_985007895 18 Left 985007892 4:185552563-185552585 CCTCCAGAACTTTTTGTGCCTCT No data
Right 985007895 4:185552604-185552626 TACTTCCCCTCCATCCCTTTAGG No data
985007893_985007895 15 Left 985007893 4:185552566-185552588 CCAGAACTTTTTGTGCCTCTGAA No data
Right 985007895 4:185552604-185552626 TACTTCCCCTCCATCCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985007895 Original CRISPR TACTTCCCCTCCATCCCTTT AGG Intergenic