ID: 985007896

View in Genome Browser
Species Human (GRCh38)
Location 4:185552605-185552627
Sequence ACTTCCCCTCCATCCCTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985007891_985007896 25 Left 985007891 4:185552557-185552579 CCATTACCTCCAGAACTTTTTGT No data
Right 985007896 4:185552605-185552627 ACTTCCCCTCCATCCCTTTAGGG No data
985007890_985007896 28 Left 985007890 4:185552554-185552576 CCTCCATTACCTCCAGAACTTTT No data
Right 985007896 4:185552605-185552627 ACTTCCCCTCCATCCCTTTAGGG No data
985007894_985007896 1 Left 985007894 4:185552581-185552603 CCTCTGAATCTGTGTGTTTACTC No data
Right 985007896 4:185552605-185552627 ACTTCCCCTCCATCCCTTTAGGG No data
985007892_985007896 19 Left 985007892 4:185552563-185552585 CCTCCAGAACTTTTTGTGCCTCT No data
Right 985007896 4:185552605-185552627 ACTTCCCCTCCATCCCTTTAGGG No data
985007893_985007896 16 Left 985007893 4:185552566-185552588 CCAGAACTTTTTGTGCCTCTGAA No data
Right 985007896 4:185552605-185552627 ACTTCCCCTCCATCCCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985007896 Original CRISPR ACTTCCCCTCCATCCCTTTA GGG Intergenic