ID: 985007903

View in Genome Browser
Species Human (GRCh38)
Location 4:185552620-185552642
Sequence CTTTAGGGCCCTTGTTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985007894_985007903 16 Left 985007894 4:185552581-185552603 CCTCTGAATCTGTGTGTTTACTC No data
Right 985007903 4:185552620-185552642 CTTTAGGGCCCTTGTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985007903 Original CRISPR CTTTAGGGCCCTTGTTCTCC TGG Intergenic