ID: 985009072

View in Genome Browser
Species Human (GRCh38)
Location 4:185563858-185563880
Sequence CAGGGCCAAGAGAACTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985009072_985009081 23 Left 985009072 4:185563858-185563880 CCTCCAGAGTTCTCTTGGCCCTG No data
Right 985009081 4:185563904-185563926 AGGAGTTAGGATTTTATTTTTGG No data
985009072_985009079 3 Left 985009072 4:185563858-185563880 CCTCCAGAGTTCTCTTGGCCCTG No data
Right 985009079 4:185563884-185563906 GAGGTCTGTTCAGTCTGTTGAGG No data
985009072_985009080 10 Left 985009072 4:185563858-185563880 CCTCCAGAGTTCTCTTGGCCCTG No data
Right 985009080 4:185563891-185563913 GTTCAGTCTGTTGAGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985009072 Original CRISPR CAGGGCCAAGAGAACTCTGG AGG (reversed) Intergenic
No off target data available for this crispr