ID: 985009079

View in Genome Browser
Species Human (GRCh38)
Location 4:185563884-185563906
Sequence GAGGTCTGTTCAGTCTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985009072_985009079 3 Left 985009072 4:185563858-185563880 CCTCCAGAGTTCTCTTGGCCCTG No data
Right 985009079 4:185563884-185563906 GAGGTCTGTTCAGTCTGTTGAGG No data
985009070_985009079 26 Left 985009070 4:185563835-185563857 CCAGGAAATCAGTTTTTCAGGTT No data
Right 985009079 4:185563884-185563906 GAGGTCTGTTCAGTCTGTTGAGG No data
985009074_985009079 0 Left 985009074 4:185563861-185563883 CCAGAGTTCTCTTGGCCCTGGAG No data
Right 985009079 4:185563884-185563906 GAGGTCTGTTCAGTCTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985009079 Original CRISPR GAGGTCTGTTCAGTCTGTTG AGG Intergenic
No off target data available for this crispr