ID: 985009080

View in Genome Browser
Species Human (GRCh38)
Location 4:185563891-185563913
Sequence GTTCAGTCTGTTGAGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985009074_985009080 7 Left 985009074 4:185563861-185563883 CCAGAGTTCTCTTGGCCCTGGAG No data
Right 985009080 4:185563891-185563913 GTTCAGTCTGTTGAGGAGTTAGG No data
985009078_985009080 -9 Left 985009078 4:185563877-185563899 CCTGGAGGAGGTCTGTTCAGTCT No data
Right 985009080 4:185563891-185563913 GTTCAGTCTGTTGAGGAGTTAGG No data
985009077_985009080 -8 Left 985009077 4:185563876-185563898 CCCTGGAGGAGGTCTGTTCAGTC No data
Right 985009080 4:185563891-185563913 GTTCAGTCTGTTGAGGAGTTAGG No data
985009072_985009080 10 Left 985009072 4:185563858-185563880 CCTCCAGAGTTCTCTTGGCCCTG No data
Right 985009080 4:185563891-185563913 GTTCAGTCTGTTGAGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985009080 Original CRISPR GTTCAGTCTGTTGAGGAGTT AGG Intergenic
No off target data available for this crispr