ID: 985009450

View in Genome Browser
Species Human (GRCh38)
Location 4:185567694-185567716
Sequence TTTCTTTTTTCCCCAAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985009449_985009450 24 Left 985009449 4:185567647-185567669 CCTCTTAATCTGTTGGCAGCTGA No data
Right 985009450 4:185567694-185567716 TTTCTTTTTTCCCCAAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985009450 Original CRISPR TTTCTTTTTTCCCCAAACCA AGG Intergenic
No off target data available for this crispr