ID: 985010590

View in Genome Browser
Species Human (GRCh38)
Location 4:185578716-185578738
Sequence CCATGGAAGCAGCCCTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985010584_985010590 -1 Left 985010584 4:185578694-185578716 CCTTTTATTGAGGGTGTTGCCCC No data
Right 985010590 4:185578716-185578738 CCATGGAAGCAGCCCTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985010590 Original CRISPR CCATGGAAGCAGCCCTTGCA AGG Intergenic
No off target data available for this crispr