ID: 985012134

View in Genome Browser
Species Human (GRCh38)
Location 4:185593622-185593644
Sequence TGCTTCAGTGATTCCTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985012134_985012139 28 Left 985012134 4:185593622-185593644 CCATCTTAGGAATCACTGAAGCA 0: 1
1: 0
2: 1
3: 17
4: 181
Right 985012139 4:185593673-185593695 AAATCTTCTCAGAGAACTATGGG 0: 1
1: 0
2: 1
3: 26
4: 256
985012134_985012138 27 Left 985012134 4:185593622-185593644 CCATCTTAGGAATCACTGAAGCA 0: 1
1: 0
2: 1
3: 17
4: 181
Right 985012138 4:185593672-185593694 AAAATCTTCTCAGAGAACTATGG 0: 1
1: 0
2: 1
3: 23
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985012134 Original CRISPR TGCTTCAGTGATTCCTAAGA TGG (reversed) Intronic
900006560 1:58759-58781 GTCATCAGTGTTTCCTAAGAAGG + Intergenic
907368124 1:53979448-53979470 TACTTCAGTGTTTCCTAACTTGG - Intergenic
907463773 1:54621891-54621913 TGCTTGTGTGACTCCCAAGAAGG + Intronic
908049444 1:60211969-60211991 TTCTTCAGTGATTTCTCAGATGG + Intergenic
909896197 1:81072569-81072591 TGCTTCAGTGATTGGCAAGAAGG - Intergenic
910005073 1:82386568-82386590 TTGTTCAGGGATTCCTTAGATGG - Intergenic
911131083 1:94389204-94389226 TACTACAGTGATGCCTAAGAGGG + Intergenic
911161280 1:94685168-94685190 TGCTTCAGTGACACCTAACATGG - Intergenic
912987332 1:114447133-114447155 TGCTAGAGTGAATCCTAAGTTGG - Intronic
913336038 1:117709671-117709693 GGCTTCAGTGAGTGCTAAGTGGG + Intergenic
914801542 1:150966144-150966166 TGGTTCAGTCATTCTTACGATGG + Exonic
915250564 1:154585340-154585362 TGCTTCTGGGATTCCTAGGTTGG - Exonic
915591930 1:156875651-156875673 TACTTCAGTGATGCCTGTGAGGG + Exonic
916214811 1:162385503-162385525 TACTGCAGTGACTCCTACGAGGG - Intronic
916483617 1:165237183-165237205 ACCCTCACTGATTCCTAAGAAGG + Intronic
917258557 1:173142211-173142233 GGCTTCAGTGACTCCCAGGATGG + Intergenic
1063571707 10:7221134-7221156 TACTTCAGTGATCCCATAGAAGG - Intronic
1073603776 10:104872621-104872643 TATTTCAGAGATTCCTAAGTTGG - Intronic
1075277681 10:121109399-121109421 TGTATCAGTGATTCCCAAGGTGG - Intergenic
1078449548 11:11430184-11430206 TGGTTCAGTGAGTTCAAAGAGGG - Intronic
1078541298 11:12215508-12215530 TGATTCAGTGAGTCTGAAGAAGG + Intronic
1079891239 11:26055693-26055715 TGCTTCATTGCTTCCTGAGTGGG - Intergenic
1082200767 11:49364084-49364106 TAGTTCAGTGATTCCTCAAATGG - Intergenic
1083485185 11:62979009-62979031 TGCTTATTTGAGTCCTAAGATGG - Intronic
1083566350 11:63720807-63720829 TGCTTCAGTACTTCTTCAGAAGG - Exonic
1085438496 11:76533981-76534003 TGCTACAGTGATACTTATGATGG + Intronic
1086654909 11:89342143-89342165 TAGTTCAGTGATTCCTCAAATGG + Exonic
1087602654 11:100336728-100336750 TCCTTTAGTGATTCTTAAGCTGG - Intronic
1088856101 11:113755177-113755199 TGCTACAGTGATTCCTCTGATGG + Intronic
1089004101 11:115076411-115076433 TGCTTCCCTCACTCCTAAGAAGG + Intergenic
1089146324 11:116331857-116331879 TGCTTCAGTGATTAGGAAAAAGG + Intergenic
1090153476 11:124410617-124410639 TGCATCAGTGAGGCCAAAGAGGG - Intergenic
1093823170 12:23647039-23647061 TGCCACAGTGATTCCTCTGATGG - Intronic
1095111255 12:38296698-38296720 TGCTCCAGCGATTGCTAAAAGGG - Intergenic
1097069724 12:56346077-56346099 TGCTTCAGTGAATCGTCAAAAGG - Intronic
1097069852 12:56346857-56346879 CGCTTCAGTGAATCGTCAGAAGG - Exonic
1098001077 12:65943962-65943984 TGTTTTAGTGCTTCCTAAGTTGG - Intronic
1098199000 12:68035063-68035085 TGCTTCAGTGGTTCCTATGGAGG + Intergenic
1098800568 12:74952146-74952168 TGCTACAGTGATTCCTCTAATGG - Intergenic
1101774026 12:107777540-107777562 TTCTTCAGTGTTTCAAAAGAGGG + Intergenic
1104156427 12:126137103-126137125 TGCCTCGGTGAATCCTAACATGG + Intergenic
1105554948 13:21438235-21438257 TGCCACAGTGATTCCTCTGATGG + Intronic
1105997792 13:25688703-25688725 TGATTCAGGGAGTCCTAAGAAGG + Intronic
1106014613 13:25856900-25856922 TGCTACAGTCATTTCTAAGCTGG + Intronic
1106066703 13:26359399-26359421 TGTTTAAGTGATTCATAATAAGG + Intronic
1107091004 13:36479306-36479328 TGCTGCAGTCTTTCCTAAAAAGG - Intergenic
1107332826 13:39320036-39320058 TGCTTCAGTTGTTTCTGAGAGGG - Intergenic
1107894508 13:44947670-44947692 TGCTTCTCTGTTTCTTAAGATGG - Intronic
1108088622 13:46822253-46822275 TTCTCCAGAGATTCCAAAGATGG + Intergenic
1110052290 13:70919376-70919398 TGCTTCAGTAATTAATAAGATGG + Intergenic
1115534868 14:34363481-34363503 TCCTCCAGTGATTCCCAGGAAGG - Intronic
1116286930 14:42985906-42985928 TGCTCCAGTGATACCTGAAAAGG - Intergenic
1118031252 14:61820402-61820424 TCCATCAGTCATTCCTGAGAGGG - Intergenic
1118105692 14:62657056-62657078 TGCTTCTGTGATTGCGAAGTCGG + Intergenic
1118503098 14:66381760-66381782 TCCTTCAGTAACTCCTTAGAGGG - Intergenic
1120700753 14:87696521-87696543 AGCTGCAGTGATTCCTGAGGAGG + Intergenic
1130028361 15:80289622-80289644 TTCTTCAGTGACTCCTGACAGGG - Intergenic
1130733540 15:86524286-86524308 AGGCTCAGTGATTCCTTAGAAGG + Intronic
1132291055 15:100704157-100704179 AACTCCATTGATTCCTAAGAAGG + Intergenic
1132446960 15:101932198-101932220 GTCATCAGTGTTTCCTAAGAAGG - Intergenic
1138645024 16:58418489-58418511 TTCTTTAGTGAGTCCAAAGAGGG + Intergenic
1140077040 16:71709751-71709773 GGCCTCAGTGATTCCTAATGGGG + Intronic
1140604137 16:76514200-76514222 TCCCTCAGTCATTCCTACGAAGG - Intronic
1140615411 16:76657096-76657118 TTCTTCAGAGATCCCTAAGGAGG + Intergenic
1141744520 16:85916578-85916600 TGCTTCAGAGACGCCTAAGCAGG - Intronic
1142734335 17:1885805-1885827 TGCCACAGTGATTCCTCTGATGG - Intronic
1143550826 17:7629508-7629530 TGATTCAGTGAATATTAAGAAGG - Intronic
1148473220 17:47908941-47908963 TGGTTAAGTGATTCCAGAGAAGG + Intronic
1152233831 17:79128262-79128284 TGCTTCAGTGACTCCTAGAGAGG + Intronic
1153835963 18:8964234-8964256 TGCTTCTGTGATTCCTGAGTTGG + Intergenic
1156520688 18:37720172-37720194 TGCTTCAGTGATTCTGCAGGTGG - Intergenic
1159631803 18:70757623-70757645 TCCTACAGTGTTTTCTAAGAAGG - Intergenic
1160638316 19:100335-100357 GTCATCAGTGTTTCCTAAGAAGG + Intergenic
1161715295 19:5872925-5872947 TACTTCACTGTCTCCTAAGAGGG - Intronic
1163041130 19:14603408-14603430 TGCTTCAGTGAGTCATGATAAGG + Intronic
1164498195 19:28788636-28788658 TTTTTTAGTGATTCCTAAGTGGG + Intergenic
1167733992 19:51280263-51280285 TGATTCAGTGATCCACAAGAAGG + Intergenic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
928258815 2:29748690-29748712 TCCCTCAGTGATTCAGAAGAAGG + Intronic
929965019 2:46528285-46528307 TGCTTCACTGCTTTCTAAGAAGG - Intronic
930391293 2:50764720-50764742 TGCTTCAGAAAATCCTAAGGAGG + Intronic
930414386 2:51072090-51072112 TAGTTCAGTGATTCCCAACACGG + Intergenic
931216075 2:60246027-60246049 TGCTTGAGTTGTGCCTAAGATGG + Intergenic
931798991 2:65740487-65740509 TTTTTCTGTGATTCCTAACATGG - Intergenic
932603104 2:73143651-73143673 TGCTCCAGTTTTTGCTAAGATGG - Intronic
932662086 2:73664007-73664029 TGCTTTAGTCATTCCTCACATGG + Intergenic
935500296 2:103830885-103830907 TGCTTGAGTGCCTCCTAAGCAGG + Intergenic
936710889 2:115130025-115130047 TGGTTTAGTGAGTCCTAAGCAGG - Intronic
939994813 2:148910133-148910155 TGCTGCAGGGAATCCAAAGATGG + Intronic
940591164 2:155729559-155729581 TGCTTCATTGATTCAGAGGAAGG - Intergenic
943098700 2:183460214-183460236 AGCATCAGTTAATCCTAAGAAGG - Intergenic
943356569 2:186863573-186863595 TGCTACAGTGATTAGTCAGAGGG - Intergenic
943898068 2:193393506-193393528 TGCTTAAGTGAAACCTAAAATGG + Intergenic
945562989 2:211361288-211361310 TTTTTCAGTGATTCTTCAGAGGG + Intergenic
945911110 2:215650800-215650822 TGCTTAAGTGATTCCTTAGGAGG + Intergenic
946841045 2:223820644-223820666 TGATTCAGTGATTCCAAACTAGG + Intronic
947163966 2:227242431-227242453 TGCTTCAGGGATTCTTATGGAGG + Intronic
1170814041 20:19697743-19697765 TTGTTCAGTTATTCCGAAGAAGG + Intronic
1172334457 20:34102763-34102785 TGCTAAAGTGATTCCTAGGCAGG + Intronic
1173310372 20:41891757-41891779 TGATTCAGTGTGTCCTAGGAGGG + Intergenic
1173366916 20:42394411-42394433 TGCTTAAGAGATTCTTAGGAAGG + Intronic
1175771019 20:61624411-61624433 TGCATCTGTGATTCCAGAGAGGG - Intronic
1182774389 22:32820071-32820093 TGCTTTTCTGATTCCTATGAAGG + Intronic
1183111819 22:35655320-35655342 TGGGTAAGTGATTCCTTAGATGG - Intronic
949949104 3:9214600-9214622 TATTTCAGTGATTTCTAAAATGG - Intronic
950887891 3:16376643-16376665 TACTTCAGTGCATACTAAGAAGG + Intronic
954181429 3:48884123-48884145 TGCTTCTGTGATTCCTTGCAGGG - Exonic
954325963 3:49864170-49864192 TGCTTGGGGGATTCCTCAGAGGG + Intronic
954980696 3:54742699-54742721 TGCTTCAGGGATTCCCTAGTAGG - Intronic
955376236 3:58399675-58399697 TCCTTCAGTATTTCCTAAGCTGG - Intronic
955609964 3:60746474-60746496 TGCTTCATTCATTCCTTACATGG + Intronic
956168429 3:66413752-66413774 GGTCTCAGTGATTCCTGAGAAGG - Intronic
957852444 3:85826702-85826724 TGGTTCATTGATTACTCAGATGG + Intronic
958919367 3:100086610-100086632 TGCTGCAATGATTCATAGGAAGG - Intronic
963693093 3:148529617-148529639 TCCCTCTGTGATTCCCAAGAGGG - Intergenic
963929959 3:150993387-150993409 TGCCACAGTGATTCCTCTGATGG - Intergenic
965166292 3:165196846-165196868 TGCTTCCTTGCTTCCTAAGCCGG - Intronic
967812490 3:193772586-193772608 TGCTTCAGTGGTTTCAAACAAGG - Intergenic
968138790 3:196238936-196238958 TGCTTCAGTGATGATTAAGTAGG - Intronic
969947655 4:10801053-10801075 TTCTTCAGTATTTCCTGAGAAGG + Intergenic
971327751 4:25657955-25657977 TGCTTCAAAAATTCCCAAGAGGG - Intronic
973972732 4:56229601-56229623 TGCTTGAGTTATTCCTCAGTTGG - Intronic
975461918 4:74663776-74663798 TGCTTGAGTGATTCTGAATAAGG - Intergenic
976617578 4:87093950-87093972 TGACACAGTGATTCCTCAGAAGG - Intronic
977619436 4:99119949-99119971 TGCAGCAGTGATTGCTCAGAGGG + Intergenic
980767113 4:137321209-137321231 TGCTTCAGTCATAGCTAAAAGGG - Intergenic
982978963 4:162106117-162106139 TGATTTAATAATTCCTAAGAGGG - Intronic
983476901 4:168223873-168223895 TGCATCATTGATGCCTAAAATGG - Intronic
985012134 4:185593622-185593644 TGCTTCAGTGATTCCTAAGATGG - Intronic
985743057 5:1631130-1631152 TGCTTCCGTGATTCCTGGCACGG - Intergenic
986506887 5:8461072-8461094 TGCTTCATTTCTTCCTAAAATGG + Intergenic
986855109 5:11859219-11859241 TGCTTCAGTCATTCATAGGAAGG - Intronic
987008101 5:13731808-13731830 TCTTTCAGTCATTTCTAAGATGG - Intronic
990491530 5:56307778-56307800 GGCTTCAGTGATTTCTTAGAAGG + Intergenic
991061500 5:62381149-62381171 TTCTTCAGTCATCTCTAAGAGGG - Exonic
992180791 5:74196323-74196345 TTCTGCCCTGATTCCTAAGACGG - Intergenic
993274306 5:85836518-85836540 TGCTTCAGTGATTCTTAACAAGG + Intergenic
996254492 5:121382097-121382119 TGATTCAGCAATTCCAAAGAAGG - Intergenic
996703392 5:126472280-126472302 TGCTTCAGTGGTTCCTCCGTTGG - Exonic
1000291368 5:159874452-159874474 TGCTGCACTGACACCTAAGAAGG - Intergenic
1000728087 5:164797449-164797471 TCCTTCAGTGAACCCTAAAAAGG - Intergenic
1001131564 5:169068628-169068650 TTCTTCAGTGAATCCTGAAAAGG + Intronic
1003701565 6:8471711-8471733 TGCTTCACTTAATCCTAACAAGG + Intergenic
1003980257 6:11382586-11382608 TGCTTCAGTGCGGCCTAGGAGGG - Intergenic
1004403473 6:15310500-15310522 TGCTGTAGGGATTCTTAAGATGG + Intronic
1006409857 6:33866719-33866741 TGCTTCTGAGAGTCCTCAGATGG + Intergenic
1007457080 6:41987287-41987309 TACTTCAGTGATACCTTGGAAGG + Intronic
1007786192 6:44280817-44280839 TGCTTCTGTCAGTCCCAAGATGG - Intronic
1007978451 6:46125788-46125810 AGCTTCAGTGATTGCTAAATAGG + Intergenic
1008046151 6:46853592-46853614 TACTTCAGTGAATTCTAAGAAGG - Exonic
1008245094 6:49161686-49161708 TGCTCTAGTCATTCCTAAAATGG - Intergenic
1008673923 6:53799406-53799428 TGTGTCAGTGAGTCCTAACATGG + Intronic
1009007043 6:57799984-57800006 TGCTTCAGTGTTTCATGACAAGG - Intergenic
1010286723 6:74086519-74086541 AACTTCAGTGATCCCCAAGAAGG + Intergenic
1010845505 6:80702342-80702364 TGCTTCAGTCATGACTAAAAGGG + Intergenic
1014919090 6:127191393-127191415 TGATTCAGTGGTTCTTATGAGGG - Intronic
1015237908 6:130992139-130992161 TTCTTCAGTAATTATTAAGAGGG + Intronic
1015820041 6:137250885-137250907 GCCATCAGTGATTCCTTAGATGG + Intergenic
1016099216 6:140076682-140076704 TGCTTCAATAATTTCTAAGTGGG - Intergenic
1016377514 6:143438292-143438314 TGCTTGAGTGAAACCCAAGAGGG - Intronic
1018888524 6:167962910-167962932 TGGTTCAGTGATTGCTTAAATGG + Exonic
1019064455 6:169285056-169285078 TGCCTCAGTGATTCTTCAGCAGG - Intergenic
1019949226 7:4357734-4357756 TGCTTCACTGAATCTTAAGTGGG + Intergenic
1020153534 7:5702470-5702492 TGTTTCAGTGATTATTCAGAAGG - Intronic
1022807365 7:33836097-33836119 TCCTTCAGTGTTTCCCAACAGGG + Intergenic
1027630273 7:80595640-80595662 AGATTCAGTGATTCTTAACAAGG - Intronic
1027723826 7:81777286-81777308 TCTTTAAGTAATTCCTAAGAAGG - Intergenic
1028447879 7:90945538-90945560 TGCCTAAGTTATTCCTTAGAAGG - Intronic
1028662791 7:93300468-93300490 TAATTCAGTGATACCTAAAAAGG + Intronic
1030172846 7:106621687-106621709 TGCTACAGTGATCCCTCTGATGG - Intergenic
1030800285 7:113841663-113841685 TCCTTCAGTGATTCATGTGAAGG - Intergenic
1032180797 7:129675454-129675476 TGCTATAGTGATTCCTCTGATGG - Intronic
1033310747 7:140260128-140260150 TGCTACAGGGGTTCCCAAGAGGG + Intergenic
1038971851 8:32645646-32645668 TGCTTCAGGGACTCATATGATGG + Intronic
1039322643 8:36449611-36449633 TGCTCCAGTGATGACTAACAAGG - Intergenic
1040712974 8:50211770-50211792 TGCTTCAGTGAGATCAAAGAAGG + Intronic
1041384312 8:57281803-57281825 TGCTTGAGAGGTTCCTAGGAAGG - Intergenic
1045514876 8:102850184-102850206 TGTTTCAGAGATACCTAAGCAGG + Intronic
1046034510 8:108824233-108824255 TGCTTCAGTGATTCCCTAATTGG - Intergenic
1046159800 8:110346271-110346293 TGGTTTAGTGATTCTTTAGAGGG + Intergenic
1050673838 9:8029042-8029064 TGCTCCAGTGATTCTCAACAGGG - Intergenic
1052550624 9:29942806-29942828 AACTTCAGTGATTACCAAGAAGG - Intergenic
1053117298 9:35516643-35516665 TTCCTCAGTGACTCCTCAGAGGG + Intronic
1053651236 9:40171707-40171729 TACTTCAGTGAATTCTAAGAAGG + Intergenic
1053901630 9:42801064-42801086 TACTTCAGTGAATTCTAGGAAGG + Intergenic
1054533344 9:66204496-66204518 TACTTCAGTGAATTCTAAGAAGG - Intergenic
1055087548 9:72329437-72329459 TCCTTCTCTGATTCCTAAGGTGG + Intergenic
1058979112 9:110152775-110152797 AGCCTGTGTGATTCCTAAGATGG + Intronic
1187510504 X:19913466-19913488 TTCTTCATTGGTTCCTAAAAGGG + Exonic
1188334780 X:28917546-28917568 TGATTCAGTGATTCTTAGTAGGG + Intronic
1189621437 X:42844552-42844574 TGCCTCACTGATTCCAAATAAGG - Intergenic
1189950272 X:46222800-46222822 TGCTTAAGTCATTCAAAAGAAGG + Intergenic
1191786398 X:64921303-64921325 TGCTTGAATAATTCCAAAGAGGG + Intronic
1193226441 X:78989614-78989636 AGCTCCAGTCATGCCTAAGAGGG + Intergenic
1194946591 X:100075481-100075503 TGCATCATTGAGTCATAAGATGG - Intergenic
1195320111 X:103714802-103714824 TGCTTCAATGATTCTTAACTGGG + Intronic
1195561195 X:106286081-106286103 TACTCCTGTGATTCCTCAGAAGG - Intergenic
1196187959 X:112764602-112764624 TGCTTGAGTGCTTCCTGAGGTGG - Intergenic
1197850760 X:130857588-130857610 TGCTTTAAATATTCCTAAGAGGG + Intronic
1198313801 X:135446531-135446553 TTCTTCAGTGATTCCCAACATGG + Intergenic