ID: 985012134

View in Genome Browser
Species Human (GRCh38)
Location 4:185593622-185593644
Sequence TGCTTCAGTGATTCCTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985012134_985012139 28 Left 985012134 4:185593622-185593644 CCATCTTAGGAATCACTGAAGCA 0: 1
1: 0
2: 1
3: 17
4: 181
Right 985012139 4:185593673-185593695 AAATCTTCTCAGAGAACTATGGG 0: 1
1: 0
2: 1
3: 26
4: 256
985012134_985012138 27 Left 985012134 4:185593622-185593644 CCATCTTAGGAATCACTGAAGCA 0: 1
1: 0
2: 1
3: 17
4: 181
Right 985012138 4:185593672-185593694 AAAATCTTCTCAGAGAACTATGG 0: 1
1: 0
2: 1
3: 23
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985012134 Original CRISPR TGCTTCAGTGATTCCTAAGA TGG (reversed) Intronic