ID: 985017492

View in Genome Browser
Species Human (GRCh38)
Location 4:185651692-185651714
Sequence CTCAAACAGAAGGGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 2, 2: 4, 3: 50, 4: 520}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985017487_985017492 6 Left 985017487 4:185651663-185651685 CCTCCTAATATATGAACTGAAAA 0: 1
1: 0
2: 2
3: 18
4: 266
Right 985017492 4:185651692-185651714 CTCAAACAGAAGGGGAAAAAAGG 0: 1
1: 2
2: 4
3: 50
4: 520
985017486_985017492 9 Left 985017486 4:185651660-185651682 CCTCCTCCTAATATATGAACTGA 0: 1
1: 0
2: 1
3: 10
4: 127
Right 985017492 4:185651692-185651714 CTCAAACAGAAGGGGAAAAAAGG 0: 1
1: 2
2: 4
3: 50
4: 520
985017488_985017492 3 Left 985017488 4:185651666-185651688 CCTAATATATGAACTGAAAACAT 0: 1
1: 0
2: 0
3: 37
4: 498
Right 985017492 4:185651692-185651714 CTCAAACAGAAGGGGAAAAAAGG 0: 1
1: 2
2: 4
3: 50
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985017492 Original CRISPR CTCAAACAGAAGGGGAAAAA AGG Intronic
900886051 1:5416165-5416187 CTCAAAAAGAAAAGGAAAGAAGG - Intergenic
901631518 1:10650447-10650469 CTCCATCTGAAGGGAAAAAAAGG + Intronic
901645068 1:10712580-10712602 CTCAAGCAGAGGGGGAAAGAGGG - Intronic
902351400 1:15858124-15858146 CTCAAAAAGAAAGAGAAACAAGG + Intronic
902997965 1:20242270-20242292 ATCAACCAAAAGGGGAAGAAGGG + Intergenic
903755030 1:25654646-25654668 CTCAAAAAAAAAAGGAAAAAAGG - Intronic
904103787 1:28058800-28058822 TTCAAACAAAAAAGGAAAAATGG + Intronic
905607426 1:39314917-39314939 ATCACACTGAAGGGGAAGAAAGG - Intronic
905777644 1:40679557-40679579 GTTAAATAGAAAGGGAAAAATGG - Intergenic
906482014 1:46205264-46205286 CAAAAAAAGAAGGGGAAGAAGGG + Intronic
907108056 1:51901859-51901881 AAAAAACAGAAGGGGCAAAAAGG - Intergenic
907900623 1:58738166-58738188 CCTAAACAGAAGGAAAAAAATGG + Intergenic
908218045 1:61975494-61975516 CTCAAAGAGCTGGAGAAAAAAGG - Intronic
908436557 1:64112623-64112645 CTCAAAGAGGTGGGAAAAAAGGG - Intronic
909117665 1:71559377-71559399 CTGAAACAGATGAGGAAGAAAGG - Intronic
909938749 1:81586266-81586288 TCCAAACAGAAGGGGATAATCGG + Intronic
910729731 1:90381493-90381515 ATGAAAAAGAAGGGGAAAAGTGG - Intergenic
911193681 1:94972658-94972680 CTCAAACAAAAGAAGAGAAAAGG - Intergenic
911310573 1:96287936-96287958 CTGAAAGAGAAGGGGAGAAGGGG - Intergenic
911575854 1:99577142-99577164 CTCAATAAGAAGGAAAAAAATGG + Intergenic
911581474 1:99638506-99638528 TTCAAACTTAAGGAGAAAAAGGG + Intergenic
912033806 1:105285055-105285077 TTTAAACACAAGGGAAAAAATGG - Intergenic
912100611 1:106200184-106200206 CTTAAACAGAATGGGGATAATGG + Intergenic
912173186 1:107125618-107125640 TTCAAAAGGAAGGAGAAAAAAGG + Intergenic
912580105 1:110713197-110713219 CTCAAACAGAAGGGACAGCAGGG - Intergenic
912778972 1:112526332-112526354 GTTAATCTGAAGGGGAAAAAAGG - Intronic
913457982 1:119053213-119053235 TTAAAAAAGAAGAGGAAAAATGG + Intronic
914402148 1:147331755-147331777 CACATAAAGAAGGGGAAAAAAGG + Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
916200718 1:162268910-162268932 CTAAAACAGAACAGAAAAAAAGG + Intronic
918149001 1:181782179-181782201 CTCAAAAGGAAGGGAAATAATGG + Intronic
918218947 1:182418238-182418260 TTCAAACAGCAGGGGAAGACAGG + Intergenic
918464715 1:184809345-184809367 AGCAGACAGAAGAGGAAAAATGG + Intronic
918551005 1:185741825-185741847 TTCAAAGAGAATGGGAAAAGAGG + Intronic
918677383 1:187304422-187304444 CTCAAAAAGGAGAGGAAATATGG + Intergenic
919188106 1:194180772-194180794 GTTATACAGAAAGGGAAAAAAGG + Intergenic
919560248 1:199109466-199109488 CTCACACAGAATGGGAGAGAGGG - Intergenic
919885314 1:201929470-201929492 TTTAAACTGAAGGGGAAATATGG + Intronic
920000771 1:202797130-202797152 CTCCAACAGATGGGGAAAGAGGG + Intronic
921378597 1:214500688-214500710 CTCTCACAGAAGGGGAAAAGGGG + Intronic
921453424 1:215337729-215337751 CTCAGACTGAAGGGTAAAAGTGG - Intergenic
921470246 1:215539460-215539482 ATGAAACGGAAGGGGAAAGAAGG - Intergenic
922587580 1:226746714-226746736 CTCAAAGAGGAGGAGACAAAAGG - Intergenic
922920415 1:229297017-229297039 CTCAGAGAAAAGGGGAATAATGG + Intronic
923125841 1:231033678-231033700 TTTAAACAAAAGGGAAAAAAAGG + Intronic
923475290 1:234325932-234325954 CTCAAAAAAAAGAGGAAAAGAGG + Intergenic
923822938 1:237466490-237466512 ATCAAAAAGAAAAGGAAAAAAGG - Intronic
924076047 1:240338368-240338390 CTCAAACATAAGGGGAAAAAAGG - Intronic
924131162 1:240910010-240910032 CACAAACAGAAGGGACAGAAGGG - Intronic
924298672 1:242614489-242614511 CTAAAACAGGAGGGAAAAAGGGG - Intergenic
924311091 1:242743942-242743964 CTTAAAGAGAAGGGAAAAAATGG + Intergenic
924721084 1:246623759-246623781 CTCAAAAAAAAAGGGAAAATAGG + Intronic
924827432 1:247555299-247555321 CTCCAGGAAAAGGGGAAAAAAGG + Intronic
924918244 1:248596937-248596959 TTTAAAAACAAGGGGAAAAAAGG + Intergenic
1063062464 10:2570714-2570736 CACAAACAGCAGCAGAAAAATGG - Intergenic
1063711478 10:8483077-8483099 CTCAAAAGTAAGGGGGAAAACGG + Intergenic
1064635851 10:17366248-17366270 GTCAACCAGCATGGGAAAAAGGG + Intronic
1065958241 10:30711538-30711560 CCCATGCAGAAAGGGAAAAAGGG - Intergenic
1066363685 10:34755779-34755801 TTGAGACAGAAGGGGAAAAATGG - Intronic
1066652791 10:37674478-37674500 TTCAAACAGTAGAGGAAAGATGG - Intergenic
1066772241 10:38855859-38855881 CTCAAATGGAATGGAAAAAATGG + Intergenic
1067235752 10:44447714-44447736 CTGCAGGAGAAGGGGAAAAAAGG + Intergenic
1067256657 10:44648454-44648476 CTCAAACAGAAGGAGACAGGAGG + Intergenic
1067720466 10:48724050-48724072 GTCAAAGAGAAGAGGAAAGATGG - Intronic
1068400677 10:56523870-56523892 TTCTAACAGAAGGAGAAAATGGG - Intergenic
1068554268 10:58440441-58440463 CCCAAACAGAAGGTGTTAAACGG + Intergenic
1068579313 10:58721123-58721145 CACGAAGAGAAGGGGAAAATGGG - Intronic
1068590408 10:58847169-58847191 CTCCAACTGAAAGGGGAAAATGG + Intergenic
1068633727 10:59325358-59325380 TTCATACAAAAGGGGTAAAATGG + Intronic
1068695994 10:59968727-59968749 ACCAAACAGGAGGGCAAAAAGGG + Intergenic
1068856342 10:61801536-61801558 CTCAAACAGAGAGGAAAAATTGG + Intergenic
1068963496 10:62888774-62888796 TTCAAATAGAAGGTGAAAAATGG - Intronic
1070941625 10:80353475-80353497 TTAAAACAGAAAAGGAAAAATGG + Intronic
1071360287 10:84839607-84839629 CTTAAAAATAATGGGAAAAAGGG - Intergenic
1071807042 10:89134163-89134185 TTTAAAAAGAGGGGGAAAAAAGG + Intergenic
1072077867 10:91996151-91996173 TTCAAAAAGAAGGGAAAAAAAGG - Intronic
1072263353 10:93703181-93703203 CTTAAAAAGAAGAAGAAAAAAGG + Intergenic
1072288069 10:93935871-93935893 TAAACACAGAAGGGGAAAAAAGG + Intronic
1072324597 10:94285563-94285585 CGCAACCAGAAGGGAATAAAGGG - Intronic
1072355233 10:94603832-94603854 CTCAAAAAAAGGGGAAAAAAAGG - Intronic
1072847342 10:98846488-98846510 CTCAACAACAAGGAGAAAAATGG - Intronic
1072882418 10:99240837-99240859 TTCTTACAGAAGGGGAAAATGGG - Intergenic
1072977052 10:100067851-100067873 GTCATATAGAAGGGGAAAAGGGG + Intronic
1073155176 10:101340769-101340791 CACACACAGAAAAGGAAAAAAGG - Intergenic
1074245271 10:111684644-111684666 GTAGAACAGAAGGAGAAAAAGGG - Intergenic
1074545405 10:114398613-114398635 CTCATACAGATGAGGAAACAAGG + Intronic
1074549780 10:114431850-114431872 CTCAAAAAGAAGGGGGGAAATGG - Intronic
1075492493 10:122884463-122884485 CTGAAGCAGAAGGGGAATAGGGG + Intergenic
1075575953 10:123577676-123577698 CACACACAGGAAGGGAAAAAAGG + Intergenic
1076033308 10:127177492-127177514 CTCAAACACAAGGGGGGAAAAGG - Intronic
1078215503 11:9308445-9308467 GTCCAACAGAAGGGAGAAAATGG - Intronic
1078488234 11:11743534-11743556 CTCTAAAAAAAGGGAAAAAAAGG + Intergenic
1079016741 11:16875445-16875467 CTCAAACAAAAGAAAAAAAAAGG - Intronic
1081134812 11:39427296-39427318 CAGAAACAAAAGGGGAAAAAGGG - Intergenic
1083605872 11:63978618-63978640 GTCAAACAGAGGAGGAGAAAGGG - Intronic
1084276586 11:68054442-68054464 CTAGAACAGAAGGGGAGAAGAGG + Intronic
1084511955 11:69611614-69611636 CAGAAACAGAAGAAGAAAAAAGG - Intergenic
1086127198 11:83361044-83361066 CTCAAACAGAGGGATAAGAAGGG + Intergenic
1087142198 11:94775857-94775879 CCAAAACAGAAGTGGTAAAATGG - Intronic
1087436804 11:98130248-98130270 CTCATACAGAAGAGAAAACATGG - Intergenic
1087857030 11:103104420-103104442 ATCAAACATAATGGGTAAAATGG + Intergenic
1087863730 11:103197263-103197285 CTGAAATAGAAGGAGGAAAATGG + Intronic
1088242206 11:107784178-107784200 CTCAAAAAAAAAAGGAAAAAAGG + Intergenic
1088690083 11:112318814-112318836 CTCAAAAACAAGCAGAAAAATGG - Intergenic
1088702332 11:112424559-112424581 CTGAAAGAGAAGTGGGAAAAAGG + Intergenic
1088903897 11:114139576-114139598 CTCAAACAGATGGCGAGAGATGG + Intronic
1090810934 11:130242141-130242163 AACAAATAGAAGGGGAGAAATGG - Intronic
1091767359 12:3130304-3130326 GTTAAATAGAGGGGGAAAAATGG - Intronic
1091834170 12:3573176-3573198 CTTAAACACAAAGAGAAAAAAGG - Intronic
1092056198 12:5510242-5510264 CTGATACAGAATGGGAAGAACGG - Intronic
1092529690 12:9334241-9334263 CTAAAACAGAGGAGGAAACAAGG + Intergenic
1092669371 12:10845668-10845690 CTAGGACAGAAGGGGAACAATGG + Intronic
1092774527 12:11930866-11930888 CTAAAACAGAAGAAGAAGAAAGG + Intergenic
1093768404 12:22991816-22991838 CTCAAAGTGGAGGGAAAAAAAGG + Intergenic
1093857625 12:24125524-24125546 GGAAAACAGAAGGGGCAAAATGG - Intergenic
1093936340 12:25005028-25005050 TTAAAACAGAAAGGGAAAGATGG - Intergenic
1094366220 12:29684961-29684983 TTGAAATAGAAAGGGAAAAAAGG - Intronic
1095499142 12:42817390-42817412 GTGAAACAGAATGGGAAAGATGG - Intergenic
1095506422 12:42903965-42903987 TTCAACCAGAAATGGAAAAAAGG - Intergenic
1096209795 12:49756132-49756154 CTCAAAAAAAAAGGAAAAAAAGG - Intronic
1096797076 12:54084665-54084687 CTCATAAAGAAGGAGATAAATGG - Intergenic
1097579474 12:61436512-61436534 CAGAAACAAAAAGGGAAAAAAGG + Intergenic
1097817618 12:64092091-64092113 ATCAAACACTAGAGGAAAAATGG + Intronic
1098125919 12:67292835-67292857 CTTGGCCAGAAGGGGAAAAAAGG - Intronic
1098177654 12:67809646-67809668 CTGACACACAAGGAGAAAAAGGG + Intergenic
1099591554 12:84597805-84597827 CTGATAGAGAAGGGGAAAAGTGG + Intergenic
1100565112 12:95788512-95788534 TTAAAACAGAGGGGGAAAGAGGG + Intronic
1100692372 12:97052051-97052073 CTCAAACAGAAAGAGAGAGATGG + Intergenic
1100724558 12:97395071-97395093 CCAAAATAGAAGGGGAAAAAAGG + Intergenic
1100939706 12:99712751-99712773 AGAAAATAGAAGGGGAAAAAGGG + Intronic
1101058331 12:100943586-100943608 CTCCAAGAGAATTGGAAAAATGG + Intronic
1101270557 12:103139518-103139540 CTCAAAAAGAAGAGCAAAAAGGG + Intergenic
1101405063 12:104421284-104421306 AACAAGCAGGAGGGGAAAAAAGG - Intergenic
1101483479 12:105127106-105127128 CTGAAACAGAAAAGGGAAAAGGG - Intronic
1102154033 12:110710203-110710225 CCCAAAGAGAATAGGAAAAAGGG + Intergenic
1102208712 12:111108688-111108710 GGCAAAGAGAAGGGGGAAAATGG - Intronic
1103279329 12:119742347-119742369 CTAAAACAGAGGAGGAAAAGGGG - Intronic
1103552804 12:121748533-121748555 CTCAGATTGAAGGGGAAAGAGGG + Intronic
1103627845 12:122234276-122234298 CTCAAAAAGAAAAAGAAAAAGGG - Intronic
1104208679 12:126665783-126665805 ATCACACAGTGGGGGAAAAAAGG + Intergenic
1104523280 12:129495381-129495403 CTCAGACAGAAGGGGGAGATCGG + Intronic
1105901725 13:24760788-24760810 CTCAAACAGAAAGTGAGCAAAGG + Intergenic
1106976303 13:35220815-35220837 CTCTAACAGAAGGATAAAATGGG - Intronic
1107629010 13:42324152-42324174 CTCAAAAAGAATGGGAAATGTGG + Intergenic
1107658350 13:42614469-42614491 CTATAGCAGCAGGGGAAAAAAGG + Intergenic
1108263372 13:48679983-48680005 CTGAGACAGAGGGGGAAAACTGG - Intronic
1109072992 13:57792787-57792809 ATGAGACAGGAGGGGAAAAAAGG - Intergenic
1109245711 13:59952563-59952585 CTAAAACAGAAGGAAAAAAAAGG + Intronic
1109424232 13:62150655-62150677 CTCTCTCTGAAGGGGAAAAATGG + Intergenic
1109558073 13:64007377-64007399 CTCAAAGACAATGGGAAAAGAGG + Intergenic
1110495121 13:76159365-76159387 CTGCAATAGAAAGGGAAAAAGGG - Intergenic
1110621234 13:77598318-77598340 ATCAAAGAGAAGGAGAAAACAGG + Intronic
1112389719 13:98971705-98971727 CTCAAAAAGAAAGGAAAATAGGG + Intronic
1112871557 13:103977230-103977252 CTCCAAAAGAAAGTGAAAAAAGG + Intergenic
1113006935 13:105716581-105716603 CTCCTAAAGAAGGTGAAAAATGG - Intergenic
1113077780 13:106484903-106484925 CAAAAACAGTAGGGAAAAAAAGG - Intergenic
1113280910 13:108786424-108786446 CCTAAACAGCAGGGGAAAAAAGG - Intronic
1113557405 13:111249437-111249459 AACAAGCAGGAGGGGAAAAAAGG + Intronic
1115155632 14:30336149-30336171 CTCAAAGAGATGGAGGAAAAGGG + Intergenic
1115460141 14:33651015-33651037 ATCAAACACAAAGGGAAGAAAGG + Intronic
1115655230 14:35437627-35437649 CTCTAAAAGAAAGGGAAATAGGG - Intergenic
1115731854 14:36278005-36278027 CTGAAAAACAAGGGAAAAAATGG + Intergenic
1116416371 14:44682592-44682614 CTCAAGCAGAAGATGAGAAATGG - Intergenic
1117410703 14:55448304-55448326 CTGAAATAGAAGTGAAAAAAAGG - Intronic
1117738956 14:58796035-58796057 ATCCATCAGAAGGGGAAAGAAGG - Intergenic
1118497648 14:66324708-66324730 CAAAGATAGAAGGGGAAAAATGG + Intergenic
1119867357 14:77985098-77985120 CTCAAAAAGAAAGGGAAAGATGG - Intergenic
1119977310 14:79039544-79039566 CTCAAACATAACAGAAAAAATGG - Intronic
1120129315 14:80786341-80786363 GTGAAACAGGAGGGAAAAAAAGG + Intronic
1121229828 14:92349037-92349059 CACAAACAAAAAGGGGAAAATGG + Intronic
1123453524 15:20392016-20392038 CCCAAACAGAAGGCAGAAAAAGG - Intergenic
1125076651 15:35626932-35626954 CTCAAAGAGAAGAGGAGGAATGG - Intergenic
1126606799 15:50486184-50486206 CACAGAAAGAGGGGGAAAAAAGG + Intronic
1126656024 15:50978771-50978793 GTGGAACAGAAGGAGAAAAATGG - Intronic
1127342447 15:58062126-58062148 CTAAAATAGAAGAGGCAAAAAGG - Intronic
1128355595 15:66924176-66924198 AAAAAAAAGAAGGGGAAAAAAGG - Intergenic
1129157097 15:73725100-73725122 CTCAAAAAGAAAAGAAAAAAAGG - Intergenic
1130297560 15:82657865-82657887 CTCTCACAGAAGGAGAACAAAGG - Intergenic
1130696227 15:86134560-86134582 CTTAAAGTGGAGGGGAAAAAAGG - Intergenic
1130760967 15:86819291-86819313 CACAAAGATAAGGAGAAAAAGGG + Intronic
1131019882 15:89088786-89088808 CTCGGGCAGAAGGGGACAAAGGG - Intronic
1131146681 15:90018544-90018566 TTCAAAGAGGAGGCGAAAAAAGG - Intronic
1131295270 15:91142577-91142599 AACAAACAGAAGGGGAAGGAAGG + Intronic
1131791872 15:95973938-95973960 ATCAGAAAGAAGGGGAAAAAGGG - Intergenic
1132212488 15:100034697-100034719 CCCAAACAGAACTGGAGAAAGGG + Intronic
1132421176 15:101671134-101671156 TTGAAAAAGCAGGGGAAAAAAGG - Intronic
1133624002 16:7553091-7553113 TTAAAAAGGAAGGGGAAAAAAGG - Intronic
1134052712 16:11147952-11147974 GTCAAAAAGAAATGGAAAAAAGG - Intronic
1134100651 16:11449343-11449365 CCCAAACTGAAGAGGAGAAAAGG - Intronic
1134506748 16:14813888-14813910 GTCAAACAGAAAGGGAAAAAGGG - Intronic
1134573810 16:15314933-15314955 GTCAAACAGAAAGGGAAAAAGGG + Intergenic
1134728610 16:16441385-16441407 GTCAAACAGAAAGGGAAAAAGGG - Intergenic
1135769879 16:25209412-25209434 CTGACAAAGAAGGGGAAAACAGG - Intergenic
1136145653 16:28314977-28314999 CTCAAAAAAAAGGGAAAAAAGGG + Intronic
1138324207 16:56148903-56148925 CTCAGAAGGAAGGGGAAAAATGG + Intergenic
1138961947 16:62037554-62037576 CAAGAACAGAAGGGGGAAAAAGG + Intergenic
1139502381 16:67377633-67377655 CTCAAAAAAAAGAAGAAAAAAGG - Intronic
1139632327 16:68238028-68238050 CTCAGGCTGAAGAGGAAAAAGGG - Intronic
1139670053 16:68486505-68486527 CTCATCCAGATGGTGAAAAAAGG + Intergenic
1140062620 16:71584201-71584223 ATGATACAGAGGGGGAAAAATGG + Intergenic
1141272156 16:82551121-82551143 ACCAAACAGAAGTGGAAGAAGGG + Intergenic
1142260668 16:89041169-89041191 CTCAAACAGGAGGGGAGGGAAGG - Intergenic
1142736105 17:1900783-1900805 CTCAAAAAAAGGGGGAGAAAGGG + Intergenic
1142765201 17:2060585-2060607 ATCAACTAGAAGGGGAAGAAGGG + Exonic
1143149260 17:4797312-4797334 CTCAAAGAAAAAGGAAAAAAAGG + Intronic
1143604153 17:7971635-7971657 CTTAGACAGAAGGTGAAGAAAGG + Intergenic
1143798524 17:9358352-9358374 TCTAAACAGAAGGGAAAAAAAGG + Intronic
1144775894 17:17784397-17784419 GTCAAACAGAAAGGGGAACAAGG - Intronic
1145802726 17:27700040-27700062 CAAAAGCAGAAGTGGAAAAATGG + Intergenic
1146977561 17:37127920-37127942 CACAAAAAAAAGGGGAAAGAAGG + Intronic
1148373474 17:47120183-47120205 CTCAAAGAGAAGAGGCAATATGG + Intronic
1148558738 17:48593967-48593989 CTCCGAGAGAGGGGGAAAAAAGG + Intronic
1149073818 17:52575026-52575048 CTCTCTCTGAAGGGGAAAAATGG + Intergenic
1149075239 17:52589044-52589066 CTAACACAGAAGTGGATAAATGG - Intergenic
1149330539 17:55576803-55576825 CTCAGACAAAAGGAGACAAAAGG + Intergenic
1150501921 17:65659394-65659416 CTCAAACATAAGGAGATAATTGG - Intronic
1150569413 17:66373056-66373078 CTCAAAAAAGAGGGGAACAAAGG + Intronic
1151028397 17:70706104-70706126 CCCACAAAGAATGGGAAAAAGGG + Intergenic
1151478948 17:74358965-74358987 ATAAGACAGAAGGGCAAAAAGGG - Intronic
1151649265 17:75456291-75456313 TTTAAAAAGAAAGGGAAAAAAGG + Intronic
1151764398 17:76124712-76124734 CTCAAACAGAAGAGCCAAAAAGG + Intergenic
1153589990 18:6663697-6663719 CAGAAACAGAAGAAGAAAAAAGG - Intergenic
1153734040 18:8045831-8045853 CTCAAAAAGATGTTGAAAAAAGG + Intronic
1154375757 18:13808408-13808430 CTGGCACAGCAGGGGAAAAAGGG + Intergenic
1154973031 18:21429341-21429363 CTCAAAAAGAAAAGGAAGAAAGG - Intronic
1155310793 18:24520952-24520974 CTCAAACTGTTGGGCAAAAATGG + Intergenic
1155516599 18:26629611-26629633 CTCAAAGATGAGGAGAAAAATGG + Intronic
1156634536 18:39011552-39011574 CACAGAAGGAAGGGGAAAAAAGG - Intergenic
1158056090 18:53282407-53282429 CTCATACAGAAGAGGCAAGAAGG + Intronic
1158600362 18:58851179-58851201 CTCAAAAAGAAAAGAAAAAAAGG + Intergenic
1159291476 18:66428164-66428186 CTCAAAAAAAAGGGAAGAAAGGG - Intergenic
1159924639 18:74256854-74256876 CTGACACAGTAGGGGAAAAAAGG + Intronic
1160024535 18:75207309-75207331 CTTTATCAGAAGGAGAAAAAGGG + Intronic
1160270663 18:77380587-77380609 CTCAAACAAGAGGAGAAATAAGG - Intergenic
1160305634 18:77733001-77733023 CTGACAAAGATGGGGAAAAAAGG - Intergenic
1160985919 19:1838680-1838702 CTGAAACAGAAGGGTACAAATGG + Intronic
1161057902 19:2199867-2199889 CTCCAACTGAAAGGGAAAACAGG - Exonic
1161905356 19:7152501-7152523 ATCGCACAAAAGGGGAAAAATGG - Intronic
1162015884 19:7846318-7846340 CTCGAACAGAAGGGGCAGCATGG + Intronic
1162241419 19:9357799-9357821 ATCAAAAAGAAGAAGAAAAAAGG - Intronic
1162722807 19:12672606-12672628 CTCAAACAAAAGGAAGAAAAGGG + Intronic
1164095650 19:22007801-22007823 CTCAAACAGCACGGTAAACATGG + Intronic
1164257893 19:23545216-23545238 GTCAAAAAGAAGAAGAAAAAAGG + Intronic
1164799900 19:31067797-31067819 CTCAAACTGGAGAGGAAAAGAGG + Intergenic
925549234 2:5052131-5052153 CAGAAACAGAAGGGAAAGAAAGG + Intergenic
925913597 2:8588664-8588686 CTCATACAGGAGGGGAAGGAAGG + Intergenic
926987803 2:18642931-18642953 CTAAAAAAGAAAGAGAAAAAAGG + Intergenic
927109469 2:19853876-19853898 ATCATAGAGAAGGGGAGAAAGGG + Intergenic
927345000 2:22027806-22027828 CTGAAATGGAAGGGGAAAAGAGG + Intergenic
927401573 2:22718123-22718145 CTCAAAAAGAAAAGAAAAAAAGG + Intergenic
929488890 2:42379003-42379025 CTCAAAAAAAAGAGAAAAAAGGG + Intronic
929505177 2:42522736-42522758 CTCAGAAAGATGGGAAAAAAAGG + Intronic
930285209 2:49419396-49419418 CTCAAACAGAATAGAAAAATGGG + Intergenic
930564184 2:52999044-52999066 CTCACACAGACTGGGAAAGAGGG + Intergenic
930738525 2:54804316-54804338 CTTAAAGAGAGGAGGAAAAAAGG + Intronic
931574905 2:63708924-63708946 CTTAAACAGAATGGGAAATTTGG + Intronic
932465290 2:71918666-71918688 CTCAAGCACAAAGGAAAAAAAGG + Intergenic
932930686 2:76034420-76034442 CACAAAGAAAAGGGGAAGAAAGG + Intergenic
933255376 2:80074678-80074700 CTTAAACCTAAGGGGAAATAAGG + Intronic
933794132 2:85906405-85906427 CTCAAAAAGAAAGGGAAGGAAGG - Intergenic
933845956 2:86327536-86327558 TTTAAACAGCAGGGGAAAGATGG + Intronic
936096364 2:109533134-109533156 CTAAAACAGAAAGGGAGGAAGGG + Intergenic
936394612 2:112112876-112112898 CTGAAATAAAAGGGAAAAAAAGG - Intronic
936973550 2:118197370-118197392 CTGAAAAAGAAAGGGACAAAGGG + Intergenic
937429973 2:121830051-121830073 CTAAAAGAGAAGAAGAAAAAAGG - Intergenic
938603635 2:132869551-132869573 CTCAGGAAGAAGGGAAAAAATGG - Intronic
939017034 2:136914576-136914598 CGAAAACAGCAGGGGAAAGACGG - Intronic
940743163 2:157535329-157535351 CACAAACACATGAGGAAAAAAGG + Intronic
941230701 2:162908534-162908556 TGCAAAGAGAAAGGGAAAAATGG - Intergenic
941838775 2:170055780-170055802 CTCAAATATAAAGGGATAAAAGG - Intronic
943133663 2:183887285-183887307 CTCTCTCTGAAGGGGAAAAATGG + Intergenic
943469268 2:188273419-188273441 CTCAAAAAAAAAGGAAAAAAAGG + Intergenic
943540689 2:189210216-189210238 AACAAAAAGAAGAGGAAAAAAGG + Intergenic
943988282 2:194652418-194652440 ACCAAACAAAAAGGGAAAAATGG + Intergenic
944395202 2:199258921-199258943 CAGAAAAAGGAGGGGAAAAAAGG + Intergenic
944517608 2:200527862-200527884 ATAAAACAGAAGGGGAGAATGGG + Intronic
946080874 2:217117171-217117193 CACAAGCAGCAGGGGAAGAAGGG + Intergenic
946968442 2:225065653-225065675 CTCAAACAAAAGGATAAATAAGG - Intergenic
947059611 2:226148624-226148646 ATAAAACAGGACGGGAAAAAAGG + Intergenic
947392337 2:229651979-229652001 CTCAATTAGAAAAGGAAAAATGG + Intronic
947635128 2:231676563-231676585 CTCAGAGAGAAGGGGAAGAAAGG + Intergenic
947952621 2:234161202-234161224 TACAAACAGAAGTGGCAAAATGG + Intergenic
948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG + Intronic
1168747213 20:253839-253861 CTGGAAAGGAAGGGGAAAAAGGG + Intergenic
1168776854 20:455184-455206 CTCAGACAGATGAGGACAAATGG - Intronic
1169222441 20:3832914-3832936 CTCAAAAAAAAGGAAAAAAATGG - Intergenic
1169419582 20:5449148-5449170 CCCAAGGAGAAGGGGAAACAGGG - Intergenic
1170482176 20:16776805-16776827 CTCAATGAGAAGGTGAAAATTGG - Intergenic
1171161546 20:22929106-22929128 ATCAAATAGAAAGGGAAAAATGG - Intergenic
1171848931 20:30294522-30294544 CTCACAAAGAAGGAGATAAATGG - Intergenic
1172002726 20:31792642-31792664 CTCTACCCAAAGGGGAAAAAAGG + Intronic
1172297576 20:33824197-33824219 CTCTAAAAAAAGGGAAAAAATGG - Intronic
1172513794 20:35518562-35518584 CTCAAAGAGAAAGGGAAAACTGG - Exonic
1172824145 20:37766120-37766142 ATCATAAAGAAGGGGAAACATGG + Intronic
1173201980 20:40961098-40961120 CTGAAACAGAAGGGCAGATATGG + Intergenic
1173258333 20:41411071-41411093 CTAAAGCAAGAGGGGAAAAAAGG + Intronic
1173394781 20:42669181-42669203 CTCAAAAAGATGTGGAGAAAGGG - Intronic
1174402658 20:50284237-50284259 CTCTTACAGAAGAGGAAAAGAGG - Intergenic
1174888717 20:54365789-54365811 CCCAAACTGAAGTGGAAATATGG - Intergenic
1175104272 20:56603354-56603376 CTCCAATGGAGGGGGAAAAAAGG + Intergenic
1175411272 20:58771056-58771078 CACAAAGAGAAGGCAAAAAAAGG + Intergenic
1175473190 20:59248818-59248840 CAGAAATAGAAAGGGAAAAAAGG - Intronic
1175867404 20:62186892-62186914 CTGAAATAAAGGGGGAAAAAAGG - Intronic
1176007988 20:62876599-62876621 CCTAACCAGAAGGGGAGAAAAGG - Intergenic
1177033003 21:16006087-16006109 CTAAAATGAAAGGGGAAAAAAGG - Intergenic
1177794416 21:25758554-25758576 ATCAAACAGAAGGCAACAAATGG - Intronic
1177885767 21:26743498-26743520 CTCTAACAAAAGGAGCAAAAAGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179259025 21:39742151-39742173 CTCAAACAGGAGACGACAAATGG + Intergenic
1181577645 22:23805503-23805525 CTCAAAAAAAAGAAGAAAAACGG - Intronic
1181577858 22:23807149-23807171 TTCACCCAGAAGGGGAACAAGGG + Intronic
1182021173 22:27082972-27082994 ATCACAAAGAAGGGGAAAATTGG - Intergenic
1182140082 22:27946933-27946955 CTCTAACATACGGGGAAGAATGG - Intergenic
1182145882 22:27996436-27996458 CTTAAAAGGAAGGGGACAAAAGG - Intronic
1182193761 22:28492528-28492550 CAAAAACAGGAAGGGAAAAAGGG + Intronic
1182550931 22:31100417-31100439 CAGAAAGAGAAGGGGAAAGAAGG - Intronic
1182730964 22:32492876-32492898 CTAAAACATAAAGGGAATAAGGG + Intronic
1183694100 22:39410106-39410128 CTCAAAAAGAAGAAGAAAAACGG - Intronic
1183710967 22:39502851-39502873 CTTAAACAGTTGAGGAAAAATGG + Intronic
1184448710 22:44570152-44570174 CTCAAGCAGAAAGAGAAAAGGGG - Intergenic
949349458 3:3110763-3110785 ATCAAACAGAAATGGAACAAAGG - Intronic
949428360 3:3944224-3944246 CTCAAAAAGAAGAAAAAAAAAGG - Intronic
950956584 3:17059865-17059887 GTCAAAAAGAAGGAGAAACATGG + Intronic
951539224 3:23766407-23766429 CTCAAAAAGAAGAAGAAAAAGGG - Intergenic
952076102 3:29699915-29699937 CTCAAATAGCAGGGGTATAAAGG + Intronic
952092084 3:29899559-29899581 CTCAAAACCAAGGGTAAAAAGGG - Intronic
952330357 3:32359090-32359112 CTCATGCAAAAGGGGAAATAAGG - Intronic
953098963 3:39807582-39807604 CTCAAGCTGAAAGGGAAGAATGG + Intergenic
955067024 3:55542689-55542711 GTCAATGAGAAGGGGAGAAAGGG - Intronic
955081520 3:55661930-55661952 ATTAAACAGAAAGTGAAAAAGGG - Intronic
955893112 3:63671097-63671119 CTCAAACAGAAGGGGTAGAAAGG + Intronic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
956538545 3:70307562-70307584 ATCAAAGAGAAGGAGAAAATAGG - Intergenic
956616304 3:71176257-71176279 CCCAAACACAAGGGCAATAAAGG + Intronic
956813794 3:72889493-72889515 CTGAGACAGAAGGGAAACAAAGG - Intronic
956911221 3:73819634-73819656 CCAAAACAGAAGAGGAAGAAGGG - Intergenic
956929202 3:74023540-74023562 GTCAAACAGAAGCAGAAAATGGG + Intergenic
956970048 3:74512405-74512427 TTCAAAAAGAGGGGGAAAAGGGG + Intronic
957743226 3:84302440-84302462 CTCAGACATTGGGGGAAAAAGGG - Intergenic
957749810 3:84399949-84399971 CTCAAAATGAAGCAGAAAAAGGG + Intergenic
959450573 3:106494345-106494367 GAAAAACAGAAGGGCAAAAAGGG + Intergenic
959902101 3:111673021-111673043 CTGAAAAATAAGGGGAAAAAAGG + Intergenic
960013874 3:112863236-112863258 CACAAACAAAAGTAGAAAAATGG - Intergenic
961165528 3:124760914-124760936 AGCAAACAGATGGGGAAAAACGG - Intergenic
961504042 3:127358454-127358476 TTCAAACCAAAGGGGAAAGATGG - Intergenic
963625998 3:147673339-147673361 CTCAACAAGAAAAGGAAAAATGG + Intergenic
963639789 3:147844523-147844545 CTGAAACAGAAAGGCAGAAAAGG + Intergenic
963840673 3:150102649-150102671 AGGAAACAAAAGGGGAAAAAAGG + Intergenic
964542668 3:157797007-157797029 CTCTAATTTAAGGGGAAAAAAGG + Intergenic
965008391 3:163055553-163055575 CTCAGTCAAAAGGGGAAACAGGG - Intergenic
965099787 3:164280429-164280451 TTCAAACATAAAGGGAAATAAGG + Intergenic
965153490 3:165013745-165013767 CTCTAAAGGAAGGGGAGAAATGG + Intronic
965165628 3:165192647-165192669 CTGAAGCAAAAGGGGATAAAGGG + Intronic
965334198 3:167416042-167416064 CTAAAACAGAAGTTAAAAAAAGG - Intergenic
965619556 3:170629329-170629351 CACAAAGAGCAGGGGAAATAGGG + Intronic
965943739 3:174214963-174214985 CTGTAAAAGAAGGGGAAAATGGG + Intronic
966435118 3:179875452-179875474 TTCAAACACAACTGGAAAAATGG - Exonic
966497314 3:180595839-180595861 CTCAAACAGTGGGGCCAAAAAGG + Intergenic
967086543 3:186099753-186099775 CTGAAAGAGGAGGGGATAAATGG + Intronic
967117726 3:186356889-186356911 CTGGAAGAGAAGGGGGAAAAGGG - Intronic
967118034 3:186359969-186359991 CTGGAAGAGAAGGGGGAAAAGGG - Intronic
967386718 3:188919218-188919240 CTCTTACAGAAGGGGAGAAAAGG - Intergenic
967587921 3:191237055-191237077 AGCAAGCAGGAGGGGAAAAATGG + Intronic
967742556 3:193019125-193019147 TTAATACAGAAGGGTAAAAATGG + Intergenic
968172650 3:196522963-196522985 CTCAAAAAGAAAGAAAAAAAAGG - Intergenic
970683384 4:18536601-18536623 CCCAAACAGATGGGTAACAATGG - Intergenic
971379850 4:26086579-26086601 ATCAAACAGAACCGGAAAAGTGG + Intergenic
971677925 4:29658428-29658450 CTCAAAAACAAGGAGAATAAGGG - Intergenic
972282321 4:37614613-37614635 TTCTAGCAGAGGGGGAAAAAAGG + Intronic
972846777 4:43000812-43000834 CTAAAACATATGGGGAAAAGTGG + Intronic
973338098 4:48976559-48976581 CACAAGCAGAAGAGGAAAGAGGG + Intergenic
973957589 4:56078405-56078427 CTCAAAAAGAAAGGAAAAAAGGG - Intergenic
974316525 4:60289241-60289263 CCCAAACAGAAAGAAAAAAATGG - Intergenic
974579627 4:63779370-63779392 CTCCATGAGAAGGAGAAAAATGG - Intergenic
975190932 4:71461347-71461369 CAATAACAGAAGGGGAAAAAAGG - Intronic
975554154 4:75643582-75643604 CTCATTCAAAGGGGGAAAAAGGG + Exonic
975567422 4:75773182-75773204 CTCAAATAAAAGTTGAAAAAAGG - Intronic
975624190 4:76326628-76326650 TTAAAGCAAAAGGGGAAAAAAGG + Intronic
976622133 4:87139616-87139638 CAAGAACAGGAGGGGAAAAAAGG - Exonic
976623250 4:87150631-87150653 CCTACAAAGAAGGGGAAAAAAGG - Intergenic
976687587 4:87832110-87832132 GACAAGCAGAAGGGCAAAAAGGG + Intronic
977043689 4:92043931-92043953 TTCGAAAAAAAGGGGAAAAAAGG - Intergenic
977196502 4:94067810-94067832 CTCAAAATAAAGGAGAAAAAAGG + Intergenic
978063912 4:104372440-104372462 CTGAAACAGAAGTGTAAAAGTGG - Intergenic
978480353 4:109182857-109182879 CTACAATATAAGGGGAAAAAAGG + Intronic
978804393 4:112785372-112785394 CTCAAAAAAAAAGGAAAAAAAGG - Intergenic
979541781 4:121891951-121891973 GATAAACAGGAGGGGAAAAAAGG - Intronic
980350222 4:131674704-131674726 CTAAAAAATAATGGGAAAAATGG + Intergenic
980953211 4:139402025-139402047 CTTTAACAAAAGAGGAAAAAAGG - Intronic
981268319 4:142814135-142814157 AAAAGACAGAAGGGGAAAAATGG + Intronic
981642794 4:146964872-146964894 CTGAAACAGAATGCAAAAAAAGG + Intergenic
982074455 4:151724644-151724666 CTCAAGCAGATGAGGAAGAAGGG - Intronic
982293363 4:153802191-153802213 CAAGAACAGGAGGGGAAAAAAGG + Intergenic
982890363 4:160841330-160841352 CAGAAAAAGAAGGGGAAAAGTGG + Intergenic
983563219 4:169122282-169122304 CATAAAGAGAAAGGGAAAAAAGG + Intronic
983727903 4:170952992-170953014 ATCAAACACAAGGGTAATAAAGG - Intergenic
984366193 4:178803056-178803078 GTCTTACAGAAGAGGAAAAATGG + Intergenic
985017492 4:185651692-185651714 CTCAAACAGAAGGGGAAAAAAGG + Intronic
985044602 4:185928013-185928035 ATAAAGCAGAAGGGAAAAAATGG - Intronic
986478955 5:8165328-8165350 CTCAATCAGATGGAGAAAAAAGG - Intergenic
987964215 5:24851219-24851241 CACAAACAGAAGGACAAGAAAGG - Intergenic
988592114 5:32558003-32558025 CTCTCTCTGAAGGGGAAAAATGG - Intronic
988610183 5:32716021-32716043 CTAACACAGCAGGGGAAAAAAGG + Intronic
988778564 5:34498900-34498922 CTCAAAGTAAAGTGGAAAAAAGG + Intergenic
988863699 5:35311269-35311291 CTCCAGCAGAAGTGAAAAAAAGG + Intergenic
989988641 5:50734326-50734348 CAGAAAAAGAAAGGGAAAAAAGG + Intronic
990039986 5:51367865-51367887 CTCCAACAGATGAGAAAAAAAGG + Intergenic
990089040 5:52018038-52018060 CAGAGACAGGAGGGGAAAAATGG + Intronic
991149946 5:63356204-63356226 CTCAAAGAAAAGGAAAAAAAAGG - Intergenic
992825008 5:80540134-80540156 CTGGATCAGAAGAGGAAAAAGGG - Intronic
993074099 5:83205392-83205414 GGAAAAGAGAAGGGGAAAAATGG + Intronic
995159367 5:108959976-108959998 CTTAAACTGAAGTGGAATAATGG + Intronic
996024061 5:118623953-118623975 CTAACACAGAAGTGTAAAAATGG - Intergenic
996286790 5:121803497-121803519 CTCAAAAAGAAGGGAAATATTGG + Intergenic
996628964 5:125605058-125605080 CACAGACAGAAGGAAAAAAAAGG + Intergenic
996644353 5:125796163-125796185 CACAGAAAGAAGGAGAAAAAAGG - Intergenic
997084058 5:130775407-130775429 CTCAAGGAGAAGGGAAGAAATGG + Intergenic
997130605 5:131272403-131272425 CTGAAAATGAAGAGGAAAAAAGG - Intronic
997522221 5:134530377-134530399 CTTTAAAAAAAGGGGAAAAAAGG - Intronic
999175568 5:149629470-149629492 CTCAAACAGGAAGGGAGAGAGGG + Intronic
999471411 5:151858215-151858237 TTGAAGCAAAAGGGGAAAAATGG + Intronic
999583618 5:153066415-153066437 CTGAACCAGAAGGAGACAAATGG + Intergenic
1000346491 5:160318596-160318618 CATAAATAGAAAGGGAAAAATGG + Intronic
1000681912 5:164195842-164195864 CTAATACAGAAGTGGAAAAATGG - Intergenic
1000695404 5:164375137-164375159 CTATAACATAAGGTGAAAAAAGG - Intergenic
1001111060 5:168896753-168896775 CACAAAGAGAAGGGAAAAGAAGG + Intronic
1001169140 5:169401738-169401760 TTCAAACAGAAGGAAAATAATGG + Intergenic
1001673097 5:173490813-173490835 CCCAAACTGAATGGGAAAAGCGG + Intergenic
1002414006 5:179108999-179109021 CTTTAAAAGAAGGGTAAAAAGGG + Intergenic
1002660924 5:180790789-180790811 GTCAAACCCCAGGGGAAAAAGGG + Exonic
1002977798 6:2101665-2101687 CACAAACTGTGGGGGAAAAAAGG + Intronic
1004009719 6:11671062-11671084 CTAAAACAGAAGAGAAAGAAAGG + Intergenic
1004323645 6:14653334-14653356 CTCAAACAGAAGGGGCAGGAAGG - Intergenic
1004810354 6:19253354-19253376 CTCAAAGAAAAGGTGAAAAAGGG + Intergenic
1005795462 6:29356278-29356300 CTGAAAAATAAGGGAAAAAACGG + Intronic
1005931916 6:30490585-30490607 CTCAAACAGTAGAAGAAACAGGG + Intronic
1006809432 6:36810476-36810498 CTCAAATAGAAACGGAAAAAGGG + Intronic
1007942399 6:45794272-45794294 CTAAAACAGAGGTGGGAAAAGGG + Intergenic
1007981318 6:46161974-46161996 CTTAAGCAGCAGGGGAAGAAGGG + Intronic
1008096858 6:47347802-47347824 CAGAAACTGAAGGGCAAAAAGGG - Intergenic
1008698479 6:54070058-54070080 GTAACAGAGAAGGGGAAAAATGG - Intronic
1009380260 6:63019195-63019217 CTCAAAGAGAGAGGGAGAAAGGG + Intergenic
1010757796 6:79686944-79686966 CAGACACAGAAAGGGAAAAATGG - Intronic
1011276517 6:85636935-85636957 TGAAAACTGAAGGGGAAAAAAGG + Intronic
1011287167 6:85737075-85737097 CTCAAAAAGAAAAGAAAAAAAGG + Intergenic
1011594919 6:89007188-89007210 CTCAAACAGAAGAAAAACAAAGG - Intergenic
1011877261 6:91976506-91976528 CTAAAACAAAAGGGTAATAATGG + Intergenic
1011902594 6:92318455-92318477 GTGAAAGAGAAAGGGAAAAAAGG + Intergenic
1011986557 6:93454658-93454680 CTCAAACAGCAGGGTAGAGAAGG - Intergenic
1012735177 6:102929929-102929951 CTCAATCAAAAGTGTAAAAAAGG - Intergenic
1012875540 6:104721341-104721363 CTCAAACAAAAGGGGAGGAGAGG + Intergenic
1014396829 6:120933919-120933941 CACAAACAAAAGTGGACAAATGG + Intergenic
1014878633 6:126693576-126693598 CTGTTACAGAAGGGGAAAATTGG + Intergenic
1015090438 6:129350420-129350442 CTCCAACAGAAGAGGCAGAAAGG + Intronic
1015247001 6:131086120-131086142 CTGAAAGAGATGGGGAAAAATGG + Intergenic
1015571998 6:134631434-134631456 CTAAAAAAGAAGGTGAAAAAAGG - Intergenic
1015812144 6:137171505-137171527 TTCAAAGAGAAAGGGAAGAATGG + Intronic
1015832951 6:137389296-137389318 CTGAGACAGAAGGGGAAATCCGG + Intergenic
1016990494 6:149924971-149924993 CTGAGAGAGAAGGGGAAAAGAGG - Intergenic
1016994043 6:149948308-149948330 CTCAAGAAGAAGGGGAAAGAAGG + Intronic
1017004296 6:150019249-150019271 CTCAAGAAGAAGGGGAAAGAAGG - Intronic
1017047792 6:150363616-150363638 TTAAAATAGAAGGGGTAAAATGG + Intergenic
1017183496 6:151576980-151577002 CAAACACAGGAGGGGAAAAATGG - Intronic
1017590972 6:155977633-155977655 CTGAAACAGTAGAGGAAGAAAGG + Intergenic
1018679324 6:166251519-166251541 CTTAAAAAGAAGAAGAAAAACGG - Intergenic
1020398036 7:7740025-7740047 TTCTATCTGAAGGGGAAAAAGGG - Intronic
1020852605 7:13376467-13376489 CTCAAAGAGAGGGGGATTAATGG + Intergenic
1020984809 7:15120188-15120210 TTCAAAGAGAATGGGAGAAAAGG - Intergenic
1021157613 7:17231188-17231210 CTAAAACAGAAGGTGTAAATAGG - Intergenic
1021324451 7:19248474-19248496 CCCAAACTCAAGGAGAAAAAAGG - Intergenic
1021442848 7:20698626-20698648 CTAAACCACAAGGGGAAAATTGG + Intronic
1021817831 7:24465545-24465567 CTGAAACCCAAGGTGAAAAAGGG + Intergenic
1022189123 7:27999828-27999850 GGCAAACAGGAGGGGAAAACAGG + Intronic
1022742711 7:33138339-33138361 CTGAAAAAGAAGGGGAAAACTGG + Intronic
1023044551 7:36199624-36199646 CTCAGTCAGAAGAGGGAAAAGGG - Intronic
1023687670 7:42753033-42753055 CAAAAACAGAAGGGATAAAAAGG - Intergenic
1024195845 7:47058321-47058343 CCCTCAAAGAAGGGGAAAAAAGG + Intergenic
1024941334 7:54766117-54766139 AGGAAACAGGAGGGGAAAAAAGG - Intergenic
1026092079 7:67308705-67308727 ATCAAAAAGAAGGGGATAATAGG - Intergenic
1027669959 7:81084255-81084277 CTCAAACTGAAGAAGAAAAGAGG - Intergenic
1027920099 7:84382106-84382128 CTCAAAAAGAAAAGAAAAAATGG - Intronic
1028034066 7:85957483-85957505 ATAAAACAGAAGGGGAATATGGG - Intergenic
1028042184 7:86066928-86066950 AACAAACAGGAGGGGGAAAATGG - Intergenic
1028130079 7:87161165-87161187 CTCAGACTATAGGGGAAAAAAGG + Intronic
1028187746 7:87808204-87808226 ATCAAACAGAAGGGGATGAGAGG - Intronic
1029377508 7:100188582-100188604 ATCAAAAAGAAGGGGATAATAGG - Intronic
1030688675 7:112510955-112510977 AGCAAACAGAAAGGGAAAAGAGG + Intergenic
1031638562 7:124133016-124133038 CTAAGACAGAAGGAGAAAGAGGG - Intergenic
1031842303 7:126758896-126758918 CTCAAAAAGAAAAAGAAAAAAGG - Intronic
1032176983 7:129638529-129638551 CAAAAACAGAAGGGGAAAAGAGG - Intronic
1032714324 7:134492008-134492030 CTGAAACTGAAGAGGAAAGAGGG - Intergenic
1032922835 7:136568507-136568529 CTCAAACTCAATGGTAAAAATGG - Intergenic
1033758109 7:144412800-144412822 CTCAAAAATAAGGAGAAAACAGG - Intergenic
1034331273 7:150284634-150284656 ATGAAACAGAAGGTGAAACAGGG + Intronic
1034666768 7:152825219-152825241 ATGAAACAGAAGGTGAAACAGGG - Intronic
1034682516 7:152939928-152939950 CTCAACCAGTTGGGGAGAAAAGG + Intergenic
1036385157 8:8272798-8272820 CTCAAACAGAAAATTAAAAAAGG - Intergenic
1037954327 8:23042397-23042419 CTCATACACATGGGGGAAAAGGG + Intronic
1039147796 8:34468495-34468517 CTCAAGAAGAAAGGGAAACATGG + Intergenic
1040596600 8:48843894-48843916 CTCATATTGAAGGGGAAAAATGG - Intergenic
1040899746 8:52406105-52406127 GTCAAAATAAAGGGGAAAAAAGG + Intronic
1041098104 8:54369725-54369747 CTAATACAGAAGAGAAAAAAGGG - Intergenic
1041129474 8:54682217-54682239 TTTAAAAAAAAGGGGAAAAAAGG - Intergenic
1041838563 8:62244255-62244277 CCAAAACAGAAATGGAAAAAAGG + Intergenic
1042037953 8:64557646-64557668 CTCAAACACAAGGCCAGAAAAGG + Intergenic
1042121384 8:65492112-65492134 CTGAAACAGCAGGAAAAAAATGG - Intergenic
1042218818 8:66453306-66453328 TTCAAATGAAAGGGGAAAAAAGG + Intronic
1042567692 8:70129224-70129246 TTCCAAGGGAAGGGGAAAAATGG + Intronic
1042588394 8:70368999-70369021 CTCAAAAAAAAGGAAAAAAAAGG + Intronic
1042637898 8:70898911-70898933 CTCAAAAAGAAAAAGAAAAATGG - Intergenic
1045326664 8:101122405-101122427 CACAAAGAGCTGGGGAAAAAAGG - Intergenic
1046441277 8:114258120-114258142 CTAAAACACAATGGGATAAATGG + Intergenic
1046705197 8:117441707-117441729 CTAAAAGAGAGGGGGAAATAAGG - Intergenic
1046788870 8:118299069-118299091 CACACACAGAAGTGGACAAAAGG - Intronic
1046928811 8:119822975-119822997 CTTAAACAGAAGGGAAAGATGGG - Intronic
1047123809 8:121937273-121937295 ATCAAACAAAATGAGAAAAATGG - Intergenic
1047209154 8:122826826-122826848 CTCTCACAGAAGAGTAAAAATGG - Intronic
1047403582 8:124566602-124566624 CTCAATTAGAATGGGAGAAATGG + Intronic
1048501387 8:134978597-134978619 CTCCCACAGCAGGGGACAAAAGG + Intergenic
1048599395 8:135903080-135903102 TTCTAACAGAAAGTGAAAAAAGG - Intergenic
1049713308 8:144077313-144077335 CTCAGACTGAAAGGGGAAAAGGG + Intergenic
1052113936 9:24625582-24625604 GTCAAACAAAAGGGAAAAAAAGG - Intergenic
1052352745 9:27473735-27473757 CACAAGCAGAAGGGGAAAGAAGG + Intronic
1052904894 9:33825022-33825044 CTGACACAAAAGGTGAAAAAAGG - Intronic
1053603923 9:39637663-39637685 TTGTAACAGAAGGGGAAAGAGGG + Intergenic
1053786642 9:41657242-41657264 CTCACAAAGAAGGAGATAAATGG - Intergenic
1053861737 9:42393710-42393732 TTGTAACAGAAGGGGAAAGAGGG + Intergenic
1054158418 9:61656953-61656975 CTCACAAAGAAGGAGATAAATGG + Intergenic
1054249619 9:62704751-62704773 TTGTAACAGAAGGGGAAAGAGGG - Intergenic
1054450331 9:65400463-65400485 CTCACAAAGAAGGAGATAAATGG - Intergenic
1054478191 9:65587958-65587980 CTCACAAAGAAGGAGATAAATGG + Intergenic
1054563729 9:66739283-66739305 TTGTAACAGAAGGGGAAAGAGGG - Intergenic
1054706322 9:68466139-68466161 CTGAAACACAAGAAGAAAAAAGG - Intronic
1055380244 9:75698844-75698866 CACACACAGAGGGGAAAAAAAGG - Intergenic
1056124915 9:83526488-83526510 CTCTTTCAGAAGGAGAAAAAGGG - Intronic
1056148126 9:83755600-83755622 ATCAAAAAAAAGAGGAAAAATGG + Intronic
1056187718 9:84152099-84152121 CAAAAAGAGAAAGGGAAAAATGG + Intergenic
1056834839 9:89945831-89945853 CTCAAACAAAAGTAGAAAATGGG - Intergenic
1056943151 9:90972383-90972405 ATGAAACAAAAGGGGTAAAAAGG - Intergenic
1057202801 9:93151801-93151823 CACAGAAACAAGGGGAAAAAAGG - Intergenic
1057411297 9:94818605-94818627 CCCAAAAAGAAGGGTAAAGAAGG + Intronic
1057681103 9:97186300-97186322 CAAAAACAGAAAAGGAAAAAAGG + Intergenic
1057694537 9:97313876-97313898 CTCAGGGAGAAGGGGACAAATGG - Intronic
1057985986 9:99714658-99714680 CTAAAACTGAAAGGTAAAAATGG + Intergenic
1058231462 9:102431557-102431579 CACAAACAGAAGAATAAAAATGG - Intergenic
1058528012 9:105879289-105879311 CTCAACCAAAATGGGAAAACTGG - Intergenic
1059328869 9:113522668-113522690 AGCAAACAGAAGGGGAAAAGTGG - Intronic
1059944074 9:119388749-119388771 ATGAAGCAGAGGGGGAAAAAAGG + Intergenic
1059944231 9:119391492-119391514 CAAAAAAAGGAGGGGAAAAAAGG + Intergenic
1060553117 9:124495002-124495024 GGCAGACAGAAGGGGAGAAAAGG + Intronic
1203344794 Un_KI270442v1:26129-26151 CTCCAATAGAATGGAAAAAATGG + Intergenic
1203680565 Un_KI270756v1:60503-60525 CTCAAATGGAATGGAAAAAATGG - Intergenic
1186464977 X:9778088-9778110 CTCAAAAAAAAAAGGAAAAAAGG + Intronic
1186684968 X:11916424-11916446 GTCAATCAGAAAGGGAAAAAGGG + Intergenic
1186810930 X:13187861-13187883 ATCAATGAGAAGGGGAAGAAGGG - Intergenic
1187797455 X:23019911-23019933 CTCAAACAGAAGGGGAAACAGGG + Intergenic
1189061840 X:37762087-37762109 GAGAAACAGAAGGGGAAACAAGG - Intronic
1190577946 X:51860262-51860284 CTCAAAAAGAAAAGAAAAAAAGG + Intronic
1190771100 X:53514923-53514945 TTCAAAAAAAAGGGAAAAAAAGG + Intergenic
1192723931 X:73728115-73728137 CTCAAAAAGAAAAGAAAAAAGGG + Intergenic
1194681391 X:96858385-96858407 CTCAAACAGATGTGGTGAAATGG + Intronic
1195301077 X:103530472-103530494 CACAAAGAGCAGGGGACAAATGG - Intergenic
1195382779 X:104286507-104286529 CTCAAAAAATAGGGCAAAAAAGG + Intergenic
1195951258 X:110276077-110276099 CTGAAACAGAATAGAAAAAATGG - Intronic
1196460357 X:115923276-115923298 CACAAAAAGAACGGGTAAAAAGG + Intergenic
1196560208 X:117137490-117137512 CTCACCCAGAAGGGGTAAATAGG - Intergenic
1198511864 X:137360272-137360294 CTCCACCAGAAAGGGAAAATTGG + Intergenic
1198838983 X:140835857-140835879 TTGAAACAGATGGGGGAAAAGGG - Intergenic
1199430715 X:147756804-147756826 TGCAAAGAGAAGGAGAAAAAGGG + Intergenic
1199442484 X:147884233-147884255 CTCAAACTGAAGAAGAAGAAAGG - Intergenic
1200009410 X:153109800-153109822 GTCAAAGAGAAAGAGAAAAAAGG - Intergenic
1200030190 X:153290122-153290144 GTCAAAGAGAAAGAGAAAAAAGG + Intergenic
1200880148 Y:8204036-8204058 CTGAAAAAGAAGGTGAAGAAAGG - Intergenic
1201052574 Y:9952869-9952891 CTCAAACACACTGGGAAAATGGG - Intergenic
1201260181 Y:12151579-12151601 TTCAAAAAAAAGGGAAAAAAAGG - Intergenic
1201989634 Y:20009625-20009647 CTCTCTCTGAAGGGGAAAAATGG - Intergenic
1202192065 Y:22255620-22255642 CCAAAAAAGAAGGGGAAGAAAGG - Intergenic