ID: 985019139

View in Genome Browser
Species Human (GRCh38)
Location 4:185669202-185669224
Sequence CAAACTCAAGTGCCCATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 392}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985019139 Original CRISPR CAAACTCAAGTGCCCATCAT GGG Intronic
900784792 1:4642241-4642263 CACACCCAAATGCCCATCAGTGG - Intergenic
901253754 1:7802885-7802907 AGAACCCAAGTGCCCATCCTGGG - Intronic
902211428 1:14907554-14907576 CAAACTCAATTGGCCCTCTTAGG - Intronic
902753941 1:18536977-18536999 CCATCTCCAGTGCCCAGCATAGG - Intergenic
902808214 1:18873828-18873850 AAAACTCAAGAGGGCATCATGGG + Intronic
904387699 1:30155492-30155514 CCAACCCAAGTGCCCATCCATGG - Intergenic
905282573 1:36858619-36858641 CAAACTCATCTTCACATCATGGG - Intronic
905294461 1:36945443-36945465 AAAACCCAAGTGTCAATCATAGG + Intronic
905529503 1:38665845-38665867 ACAACTCAAATGCCCTTCATTGG + Intergenic
905876752 1:41436314-41436336 TAAAATGAAGTGCCCATCAAAGG + Intergenic
906890727 1:49710184-49710206 CCAACCCAAATGCCCATCAATGG + Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
909048574 1:70740407-70740429 CAAATCCAGGTGCCCATCAGTGG - Intergenic
909207382 1:72776703-72776725 CAAACTCAAGTCCTCCTCAAGGG + Intergenic
909635760 1:77815428-77815450 CAAATTCAAGTACTTATCATAGG + Intronic
911176859 1:94825985-94826007 GCAACTCAAGTGTCCATCAATGG + Intronic
916355545 1:163902673-163902695 TCAACTCAGGTGCCCATCAGTGG - Intergenic
916907344 1:169301662-169301684 ATAACTCAAGTGCCCATCAGTGG + Intronic
918359944 1:183747052-183747074 CCAACCCAAATGCCCATCAATGG - Intronic
920175103 1:204096067-204096089 ACAACTCAAGTGTCCATCAATGG - Intronic
922398819 1:225229512-225229534 CCAACCCAAATGCCCATCAATGG + Intronic
923043826 1:230339598-230339620 GAAACACAAGTGTCCATCAGTGG + Intronic
1064331950 10:14402313-14402335 CCAACCCAAATGCCCATCAATGG - Intronic
1064446486 10:15398493-15398515 GAAACTCAAGTTCCAATCACTGG - Intergenic
1064448742 10:15422134-15422156 CCAACCCAAATGCCCATCAATGG - Intergenic
1064935988 10:20679692-20679714 CCAACCCAAATGCCCATCAATGG + Intergenic
1065975461 10:30838036-30838058 CAACCTAAAATGCCCATCAATGG + Intronic
1065980362 10:30888770-30888792 CAACCTAAAATGCCCATCAGTGG - Intronic
1066484671 10:35831854-35831876 GCAACTCAAGTGTCCATCAAAGG - Intergenic
1067381577 10:45778593-45778615 CCAATACAAGTGCCAATCATTGG - Intronic
1067687193 10:48473087-48473109 GCAACTCAAGTGTCCATCAATGG + Intronic
1067889276 10:50119227-50119249 CCAATACAAGTGCCAATCATTGG - Intronic
1068372210 10:56131691-56131713 CCAACCCAAATGCCCATCAAAGG + Intergenic
1068599891 10:58945885-58945907 CCTACTGAAGTGCCCATCAGTGG - Intergenic
1068820808 10:61376407-61376429 CAAACTCAAATGTCCAACACTGG - Intergenic
1068888710 10:62125839-62125861 GAAACTCAAGTATCCATCAATGG + Intergenic
1070038284 10:72749522-72749544 CAAACACAAGTCCCTATAATAGG - Intronic
1070330577 10:75413981-75414003 CCCACACAAGTACCCATCATAGG - Intergenic
1070711116 10:78683916-78683938 CACCCTCAAGTGACCATCCTAGG + Intergenic
1070901276 10:80030940-80030962 CCAACTTAGGTGCCCATCAGTGG + Intergenic
1072047163 10:91668558-91668580 TCAACTTAAGTGCCCATCAATGG - Intergenic
1072952865 10:99863138-99863160 TAAACCTAAGTGCCCATCAGTGG - Intergenic
1073227617 10:101936749-101936771 GCAACTCAAGTGTCCATCAACGG + Intronic
1073282924 10:102367869-102367891 CACACTCCAGTGCCCATCTTGGG - Intronic
1073639300 10:105233806-105233828 CCAACCCAAATGCCCATCAATGG - Intronic
1075525358 10:123180374-123180396 ACAACTCAAGTGCCCATCGATGG + Intergenic
1076140542 10:128075220-128075242 CCAACTCAAGTGCCCATGACAGG - Intronic
1079045549 11:17099220-17099242 CAAATTCAAGTACCAGTCATTGG + Intronic
1079883026 11:25950425-25950447 TAAACTCAGGTGCCCACCAATGG + Intergenic
1081053352 11:38374647-38374669 CTAACCTAAGTGTCCATCATTGG - Intergenic
1082225038 11:49695326-49695348 ACAACTCAAGTGTCCATCAATGG - Intergenic
1082249800 11:49965575-49965597 CCAACCCAAATGCCCATCAATGG + Intergenic
1082560877 11:54619138-54619160 CCAACCCAAATGCCCATCAATGG - Intergenic
1082698092 11:56395520-56395542 CCAACCCAAATGCCCATCAATGG - Intergenic
1082939001 11:58684246-58684268 CCAACCCAAATGCCCATCAGTGG + Intronic
1083497438 11:63069476-63069498 TCAACTCAGGTGCCCATCAATGG + Intergenic
1084297637 11:68223253-68223275 ACAACCCAAGTGCCCATCAGTGG + Intergenic
1085434345 11:76485995-76486017 CCAACCCAAATGCCCATCAGTGG + Intronic
1086624069 11:88924398-88924420 ACAACTCAAGTGTCCATCAGTGG + Intronic
1087694850 11:101364875-101364897 CCAACCCAAATGCCCATCAATGG - Intergenic
1088077792 11:105873319-105873341 CCAACACAAATGCCCATCAATGG - Intronic
1088534316 11:110843325-110843347 TAAACCCAAATGCCCATCAATGG - Intergenic
1088554147 11:111044626-111044648 TCAACTTAAGTGCCCATCAATGG - Intergenic
1089935614 11:122361051-122361073 ACAACCCAAGTGCCCATCAAAGG - Intergenic
1090140981 11:124261196-124261218 CAAACTTAAGTCTCCATCAGTGG - Intergenic
1090287659 11:125513891-125513913 CAAACCCAAATGTCCATCAAGGG + Intergenic
1090408205 11:126490105-126490127 CAAACACGAATGCCCATCATGGG - Intronic
1092609185 12:10153877-10153899 CAGACTCCACTGCCCATCCTGGG - Intergenic
1092941751 12:13415710-13415732 TCAACTTAAGTGCCCATCAATGG + Intergenic
1093252289 12:16821370-16821392 CCAACTCAAATGCCCACCAATGG - Intergenic
1093403203 12:18772722-18772744 TCAACTCAGGTGCCCATCAATGG + Intergenic
1093592832 12:20926225-20926247 TCAACTTAAGTGCCCATCAGTGG - Intergenic
1094234891 12:28152349-28152371 CAAACCCAAGTGTCCATCAATGG - Intronic
1095513421 12:42978881-42978903 TGAACTCAACTGCCCATTATGGG - Intergenic
1097388041 12:58974221-58974243 TCAACCCAAGTGCCCATCAATGG - Intergenic
1098744582 12:74219724-74219746 CCAACCCAAATGCCCATCAATGG + Intergenic
1098831023 12:75362479-75362501 CCAACCCAAATGCCCATCAATGG + Intronic
1099079325 12:78156800-78156822 TAAACTGAAGTGACCATCATGGG + Intronic
1100942270 12:99737279-99737301 TCAACTTAAGTGCCCATCAACGG + Intronic
1101839543 12:108318120-108318142 GCAACTCAAGTGCCCATCCCTGG - Intronic
1103877954 12:124143367-124143389 ACAACTCAAATGCCCATCAATGG - Intronic
1104359213 12:128116237-128116259 CCAACCCAAATGCCCATCAATGG + Intergenic
1105384399 13:19916456-19916478 CCAACCCAAATGCCCATCAATGG + Intergenic
1105971578 13:25433722-25433744 CCAACCTAAGTGCCCATCAACGG + Intronic
1106133908 13:26960353-26960375 GTAACCCAAGTGCCCATCAAAGG + Intergenic
1106459246 13:29954343-29954365 CAAACTAAAGTGCTCAGAATTGG + Intergenic
1106492868 13:30244325-30244347 CCAACCCAAATGCCCATCAGTGG - Intronic
1106561513 13:30850457-30850479 TCAACTCAGGTGCCCATCACTGG - Intergenic
1106859909 13:33894423-33894445 CTAACTCAAGTGACAGTCATAGG + Intronic
1107461225 13:40605633-40605655 TAAACTACAGTGCTCATCATAGG + Intronic
1107774513 13:43823609-43823631 GAAACTCAAGTTTCCATCACTGG + Intergenic
1108235349 13:48397238-48397260 CCAACCCAAATGCCCATCAGTGG + Intronic
1108941060 13:55953360-55953382 CCAACCCAAATGCCCATCAATGG + Intergenic
1108978102 13:56475127-56475149 CAAACCTAAATGCCCATCAGTGG + Intergenic
1109425955 13:62166855-62166877 CAACCTAAAGTGCCCATCAATGG - Intergenic
1109475983 13:62881052-62881074 TAAACCCAGGTGCCCATCAATGG + Intergenic
1109503457 13:63268203-63268225 CCAACCCAAATGCCCATCAATGG - Intergenic
1109920930 13:69057271-69057293 TAAACTTAAGTGTCCATCAACGG + Intergenic
1110248489 13:73354782-73354804 TCAACCCAAGTGCCCATCAATGG - Intergenic
1110637527 13:77783147-77783169 TCAACCCAAGTGCCCATCAATGG + Intergenic
1110808526 13:79787027-79787049 TCAACTTAAGTGCCCATCAATGG - Intergenic
1111149750 13:84234928-84234950 CAACATTAAGTGCCCATCAATGG + Intergenic
1111791215 13:92858060-92858082 CCAACTTAGGTGCCCATCAGTGG + Intronic
1112362162 13:98728006-98728028 CAAGCTCAAGTGTCCATCTCAGG - Intronic
1112969822 13:105246888-105246910 CAAACTCTAGTGACCTCCATGGG + Intergenic
1113446393 13:110371471-110371493 CAACCTCCAGTGCTCAACATAGG + Intronic
1114075149 14:19157796-19157818 AAACCTCAACTGCCCCTCATGGG - Intergenic
1114087120 14:19242186-19242208 AAACCTCAACTGCCCCTCATGGG + Intergenic
1114400829 14:22408918-22408940 CATACTCAAGAGCCCATTCTTGG + Intergenic
1114914692 14:27248604-27248626 CCAACCCAAATGCCCATCAAGGG - Intergenic
1117608773 14:57461147-57461169 CAAACCTAAGTGCCCATCAGTGG + Intergenic
1117650025 14:57894375-57894397 AAAACTCAAGTGCCCAGCAAGGG + Intronic
1118191067 14:63580864-63580886 CACACTCCAGTCCCCATCAGAGG + Intergenic
1120064040 14:80018762-80018784 CCAACCCAAATGCCCATCAATGG - Intergenic
1120773421 14:88407013-88407035 CCAACACAAATGCCCATCAATGG - Intronic
1120954158 14:90066895-90066917 ACAACCCAAGTGCCCATCAACGG + Intronic
1121092452 14:91192109-91192131 CCAAACCAAGTGCCCATCAATGG + Intronic
1121731612 14:96191250-96191272 CCAACCCAAATGCCCATCAATGG - Intergenic
1125048963 15:35275295-35275317 CCAACCCAAATGCCCATCAATGG + Intronic
1125439101 15:39682424-39682446 CACAGTCAAGTGCACATGATAGG - Intronic
1126486303 15:49185376-49185398 CAAACCCAGGTGCCTATCAATGG - Intronic
1127709881 15:61586370-61586392 CCAACCCAAATGCCCATCAATGG + Intergenic
1128373817 15:67061127-67061149 GTAACTCAAGTGTCCATCAATGG - Intergenic
1128858729 15:71046095-71046117 CCAACCCAGGTGCCCATCAATGG - Intronic
1129133210 15:73519719-73519741 GCAACTCAAGTGTCCATCAGTGG + Intronic
1129581402 15:76815354-76815376 CAACCTTAAGTGTCCATCAATGG + Intronic
1130060377 15:80565247-80565269 CAAATCCAGGTGCCCATCAACGG - Intronic
1130190231 15:81727604-81727626 CAAAGTCAAGGGCACAGCATAGG + Intergenic
1130248824 15:82281673-82281695 TAAAATCAAGTGCCCTTCATGGG - Intronic
1130287153 15:82565595-82565617 CAAAGTCCACTCCCCATCATGGG + Intronic
1130451234 15:84054479-84054501 TAAAATCAAGTGCCCTTCATGGG + Intergenic
1131594824 15:93786591-93786613 AAAACTCAAGTGGCAATCAGTGG + Intergenic
1137685283 16:50382440-50382462 CAGACCCAAGTGACCATCTTGGG + Intergenic
1137855749 16:51792915-51792937 CAAACTGAACTGCCCTTCCTAGG + Intergenic
1138162483 16:54767561-54767583 CCAACCCAAATGCCCATCAATGG - Intergenic
1138213822 16:55185556-55185578 GCAACTCAAGTGTCCATCAATGG + Intergenic
1141387613 16:83636657-83636679 CAAACCCAGGTGCCCATCAATGG - Intronic
1142938942 17:3364835-3364857 TCAACTAAAGTGCCCATCAGTGG + Intergenic
1143367660 17:6418839-6418861 CCACCTCAAGTGGTCATCATTGG - Intronic
1143413243 17:6725450-6725472 CCAACCCAAGTGTCCATCAATGG + Intergenic
1146697578 17:34921445-34921467 ATAACCCAAGTGCCCATCAATGG + Intergenic
1149721248 17:58846667-58846689 CCAACCCAAATGCCCATCAATGG - Intronic
1153065142 18:1036819-1036841 CCAACTTATGTGCCCATCAACGG - Intergenic
1153252603 18:3137413-3137435 TCAACCCAAGTGCCCATCAGTGG + Intronic
1153368573 18:4287449-4287471 CCAACCCAAATGCCCATCAATGG + Intronic
1153585907 18:6620014-6620036 TTAACTTAAGTGCCCATCAGTGG + Intergenic
1155018984 18:21877294-21877316 TAAACTTAAGTACCCATCAATGG + Intergenic
1156317840 18:35987515-35987537 CAAACCCAAGTGTCCATCAATGG + Intronic
1156374661 18:36502642-36502664 CCAACCCAAATGCCCATCAATGG - Intronic
1157188973 18:45564736-45564758 TAAACTCCAGAGCCCTTCATTGG - Intronic
1159486039 18:69058243-69058265 TCAACTCAGGTGCCCATCAATGG - Intergenic
1159611611 18:70531904-70531926 CCTACTCAAGTGTCCATCAATGG - Intergenic
1159817220 18:73090301-73090323 TCAACTCAGGTGCCCATCAGTGG + Intergenic
1160430533 18:78808785-78808807 CAAACTTAATTGCCAATTATGGG - Intergenic
1164635628 19:29789133-29789155 AACACTCAAGTGTCCATCAGTGG + Intergenic
1167375454 19:49108513-49108535 CAAACTCAAGTGGCCAAGGTTGG - Intronic
1167813734 19:51859238-51859260 AAAACTCAAATGCCTATCAAAGG - Intronic
1168163874 19:54533373-54533395 CCAACACAAGTGCCCAGCACGGG - Intronic
1168481902 19:56727158-56727180 GAAACTGAAGTGTCCATCAAGGG - Intergenic
1168655121 19:58121932-58121954 CAAAGTGAAGTGCCCAGCCTGGG + Intergenic
1202648212 1_KI270706v1_random:159519-159541 AAACCTCAACTGCCCCTCATGGG - Intergenic
925105792 2:1290030-1290052 ACAACTCAAGTGTCCATCAAAGG - Intronic
925320701 2:2965072-2965094 TCAACTCAGGTGCCCATCAATGG + Intergenic
925883322 2:8370679-8370701 GGAACTAAAGTCCCCATCATTGG + Intergenic
926875037 2:17466581-17466603 CCAACCCAAATGCCCATCAATGG + Intergenic
926885366 2:17593272-17593294 ACAACCCAAGTGCCCATCAAAGG + Intronic
927298439 2:21482609-21482631 ATAACTCAAATGCCCATCAGTGG + Intergenic
927402861 2:22733826-22733848 CCAACACAAATGCCCATCAATGG + Intergenic
927570381 2:24153861-24153883 GAAACTCAAGTTCCAATCACTGG + Intronic
927983538 2:27391082-27391104 TCAACTCATGTGCCCATCAGTGG - Intronic
929382820 2:41372613-41372635 TCAACTTAAGTGCCCATCAGTGG + Intergenic
930392462 2:50779417-50779439 CCAACCCAAATGCCCATCAGTGG - Intronic
931559753 2:63547504-63547526 TAAACCCAAGTGCCCATCAATGG + Intronic
933404029 2:81835225-81835247 ACAACTGAAGTGCCCATCAATGG + Intergenic
933634961 2:84698780-84698802 CCAACTCAGGTGCCCATCAGTGG + Intronic
934859374 2:97750950-97750972 CAAACTCCAGTTCCCACCAAAGG - Intergenic
935369876 2:102333980-102334002 CCAACTCAAGTGTCCATCAACGG - Intronic
935964120 2:108455814-108455836 TCAACTTAAGTGCCCATCAAAGG - Intronic
936656887 2:114498892-114498914 CAACCTTAAGTGTCCATCAATGG + Intronic
936803928 2:116302200-116302222 TCAACTTAAGTGCCCATCAATGG + Intergenic
938502730 2:131839827-131839849 TCAACTTATGTGCCCATCATTGG + Intergenic
940401236 2:153250625-153250647 CCAACCCAAATGCCCATCAGTGG + Intergenic
940468584 2:154064216-154064238 CAAACTCAAGTTCCAACCACTGG - Intronic
941625234 2:167824131-167824153 GAAAATGAAGTCCCCATCATGGG - Intergenic
942924591 2:181416876-181416898 CAAACCCAAATGCCCATCAATGG + Intergenic
945271187 2:207942149-207942171 TCAACTTAAGTGCCCATCAATGG + Intronic
945330577 2:208535544-208535566 TAAACACAAGGGCCCATCAATGG + Intronic
946781755 2:223198670-223198692 CCAACCCAAATGCCCATCAATGG + Intergenic
947913594 2:233818247-233818269 CAAACACAGGTGACCATCAGAGG + Intronic
1169954791 20:11089176-11089198 CCAACCCAAATGCCCATCAATGG + Intergenic
1170179365 20:13512002-13512024 CCAACCCAAGTGTCCATCAATGG - Intronic
1171410918 20:24948496-24948518 CCAACCCAAATGCCCATCAATGG + Intergenic
1175537281 20:59723500-59723522 GAAACCCAAATGCCCATCAACGG - Intronic
1176706322 21:10121905-10121927 AAACCTCAACTGCCCCTCATGGG - Intergenic
1177756001 21:25348476-25348498 CCAACCCAAATGCCCATCAATGG + Intergenic
1180002274 21:45000677-45000699 AGAACTCAGGTGCCCATCACCGG + Intergenic
1180290798 22:10850705-10850727 AAACCTCAACTGCCCCTCATGGG - Intergenic
1180353693 22:11822982-11823004 AAACCTCAACTGCCCCTCATGGG + Intergenic
1180384551 22:12169377-12169399 AAACCTCAACTGCCCCTCATGGG - Intergenic
1180493599 22:15880132-15880154 AAACCTCAACTGCCCCTCATGGG - Intergenic
1180578012 22:16798566-16798588 TCAACTCAGGTGCCCATCAATGG + Intronic
1181014167 22:20059283-20059305 AAAACTCAAGTGTCCATTAATGG - Intronic
1181449180 22:23006417-23006439 CGAACCCAAATGCCCATCAAGGG + Intergenic
1182002300 22:26929831-26929853 CCAACCCAAGTGTCCATCAGTGG - Intergenic
1182704025 22:32263793-32263815 CCAACCCAAATGCCCATCAATGG + Intergenic
1183603719 22:38855700-38855722 GCAACTCAAGTGTCCATCAATGG - Intergenic
1184776299 22:46625193-46625215 AATACTCAAGTGCCCATCCCAGG + Intronic
1185129565 22:49031346-49031368 CAAAGTCAAATGTCCACCATAGG + Intergenic
949466472 3:4349578-4349600 CCAACCCAAATGCCCATCAATGG + Intronic
949911851 3:8917054-8917076 CAAAATCATGTGGCCATCAGAGG + Intronic
950051880 3:9997800-9997822 ACAACTCAAGTGTCCATCAATGG - Intronic
950067216 3:10122281-10122303 CAAAACCAAATGCCCATGATTGG - Intronic
950300776 3:11876151-11876173 ACAACTCAAGTGTCCATCAGTGG - Intergenic
951025262 3:17821846-17821868 CCAACCCAAATGCCCATCAGTGG + Intronic
951095340 3:18623131-18623153 CAAACTCAATTGTCCCTCAGTGG + Intergenic
951189975 3:19756768-19756790 CCAACCCAAGTACCCATCAACGG + Intergenic
951539462 3:23768515-23768537 ACAACCCAAGTGCCCATCAACGG + Intergenic
952030422 3:29135599-29135621 TAAACATAAGTGCCCATCAATGG + Intergenic
952156867 3:30652924-30652946 TCAACTCAAGTGATCATCATGGG + Intronic
953527251 3:43702637-43702659 CAGACTCTAGTTCCCATCTTTGG + Intronic
953557915 3:43961524-43961546 CAAACACAAGAGCCCATACTGGG + Intergenic
954720229 3:52555280-52555302 CACACTCATATGCCTATCATGGG + Intronic
955366112 3:58311639-58311661 AGAACTTAAGTGCCCATCAATGG - Intronic
955881696 3:63553337-63553359 TCAACTCAGGTGCCCATCAATGG - Intronic
958434717 3:94082380-94082402 CAAACTTAAGTGTGCATCAAGGG - Intronic
958589760 3:96140779-96140801 CAACCTAAATTGCCCATCAGGGG + Intergenic
959645616 3:108696978-108697000 CAAACCCAAATGCCCATCAATGG + Intergenic
959760331 3:109955525-109955547 CCAACCCAAGTGTCCATCAATGG - Intergenic
960866410 3:122204477-122204499 CAACCTGAAGTGCCCATCAACGG - Intronic
962211585 3:133483685-133483707 TCAACTTAAGTGCCCATCAGTGG - Intergenic
963766106 3:149337603-149337625 CCAACCCAAATGCCCATCAATGG + Intergenic
964296055 3:155234458-155234480 TCAACTCAAATGCCCATCAGTGG - Intergenic
965113872 3:164462281-164462303 CCAACTCAGGTGCTCATCAGTGG - Intergenic
965160767 3:165129959-165129981 GAAACTCAAGTTCCCACCACTGG + Intergenic
965308950 3:167104366-167104388 TCAACTCAAATGCCCATCAGTGG + Intergenic
965310710 3:167124631-167124653 CCAACCCAAATGCCCATCAATGG + Intergenic
966632663 3:182095685-182095707 CCAACCCAAATGCCCATCAATGG - Intergenic
966925689 3:184643157-184643179 CTATCTCAAGTCCCCATCAGAGG - Intronic
967344975 3:188445233-188445255 CCAACCCAAATGCCCATCAATGG + Intronic
968220006 3:196930250-196930272 CAAATTCAAGTTCCCATTAAGGG + Intronic
968418636 4:463500-463522 CCAACCCAAATGCCCATCAATGG + Intronic
969217310 4:5732594-5732616 ACAAATCAAGTGACCATCATAGG - Intronic
970058689 4:12004586-12004608 CCAACCCAAGTGTCCATAATGGG + Intergenic
970165766 4:13236482-13236504 AAAACTTAAGTGTCCATCAGTGG + Intergenic
970484881 4:16515029-16515051 TCAACCCAAGTGCCCATCAGTGG + Intronic
970939169 4:21611215-21611237 CCAACCCAAATGCCCATCAATGG - Intronic
971641987 4:29146102-29146124 CCAACCCAAATGCCCATCAATGG - Intergenic
971989691 4:33876136-33876158 CCAACCTAAGTGCCCATCAGTGG - Intergenic
972104243 4:35462280-35462302 CAAACTCAAGTTCCAGTCACTGG + Intergenic
972154688 4:36145272-36145294 TCAACTCAAGTGCCGATCAGTGG + Intronic
973108353 4:46368923-46368945 CAAACTCAAATGCTCTCCATGGG - Intronic
973374486 4:49277669-49277691 AAACCTCAACTGCCCCTCATGGG - Intergenic
973382925 4:49332572-49332594 AAACCTCAACTGCCCCTCATGGG + Intergenic
973386551 4:49517614-49517636 AAACCTCAACTGCCCCTCATGGG + Intergenic
973682766 4:53338243-53338265 GAAACTCATATGCCCATCACTGG + Intronic
974097537 4:57381033-57381055 CTAACTTAGGTGCCCATCACTGG + Intergenic
975809959 4:78157222-78157244 TAAACCCAGGTGCCCATCAATGG - Intronic
977670432 4:99688816-99688838 TAAACTTAAGTGTCCATCAAAGG - Intergenic
978113620 4:104992589-104992611 CCAACTTAGGTGCCCATCAATGG - Intergenic
978422860 4:108552435-108552457 CAAACTTAAATACCCATCAATGG + Intergenic
978771691 4:112463622-112463644 CCAACTTAGGTGCCCATCAGTGG + Intergenic
979075720 4:116266947-116266969 TCAACCCAAGTGCCCATCAATGG + Intergenic
979185506 4:117786541-117786563 TCAACTCAGGTGCCCATCAATGG - Intergenic
979605503 4:122634257-122634279 CCAACCCAAATGCCCATCAATGG - Intergenic
979985769 4:127312555-127312577 CCAACGCAAATGCCCATCAATGG - Intergenic
980079516 4:128329191-128329213 AGAACCCAAGTGCCCATCAATGG + Intergenic
980203341 4:129684917-129684939 TCAACCCAAGTGCCCATCAATGG + Intergenic
980530035 4:134041318-134041340 CCAACTCAAATGCCCATCAATGG + Intergenic
981053588 4:140336625-140336647 AAAACCCAAATGCCCATCAATGG - Intronic
981154956 4:141423942-141423964 CCAACCCAAATGCCCATCAATGG - Intergenic
981894893 4:149786922-149786944 CCAACCCAAATGCCCATCAATGG + Intergenic
983311894 4:166075431-166075453 CAAACTCAAATGCCTACCAAAGG + Intronic
983655207 4:170075989-170076011 GCAACTCAAGTGTCCATCAGTGG - Intronic
983677252 4:170309948-170309970 TCAACTCAGGTGCCCATCAGTGG + Intergenic
984353984 4:178634920-178634942 CCAACCCAAATGCCCATCAATGG + Intergenic
985019139 4:185669202-185669224 CAAACTCAAGTGCCCATCATGGG + Intronic
985562760 5:599582-599604 CAAACCTAGGTGCCCATCAGTGG - Intergenic
985613751 5:907024-907046 ACATCTCAAGTGCCCAGCATCGG - Intronic
985954002 5:3248209-3248231 CCAACCCAAATGCCCATCAATGG - Intergenic
992347010 5:75889497-75889519 CCAACCCAAATGCCCATCAATGG - Intergenic
992378967 5:76218349-76218371 CACACCCAAATGCCCATCAATGG + Intronic
992510002 5:77423258-77423280 TCAACCCAGGTGCCCATCATTGG - Intronic
992872833 5:81023808-81023830 CAAACCCAAATGCCCAGTATGGG - Intronic
993399138 5:87427154-87427176 CCAACCCAAATGCCCATCAATGG - Intergenic
993725404 5:91361163-91361185 CCAACTTAGGTGCCCATCAATGG - Intergenic
994699482 5:103115274-103115296 GCAACTCAAGTGTCCATCAATGG + Intronic
995190191 5:109311529-109311551 CCAACACAAATGCCCATCCTTGG - Intergenic
995206196 5:109484135-109484157 CAAACTCAAGTGGCTAAAATTGG + Intergenic
996350324 5:122533191-122533213 AAAACCCAAATGCCCATCAATGG - Intergenic
997144027 5:131412625-131412647 GCAACCCAAGTGCCCATCAGTGG - Intergenic
997772053 5:136564353-136564375 TCAACTCAGGTGCCCATCAGTGG - Intergenic
998850540 5:146346504-146346526 CAAATTCAAGTGTTCATCCTGGG + Intergenic
999798110 5:155006858-155006880 CAACCCAAAGTGCCCATCAATGG - Intergenic
999943108 5:156565944-156565966 CTAACTCAAATGCCCATCAGTGG - Intronic
1000541207 5:162542356-162542378 CCAACCCAAATGCCCATCAATGG + Intergenic
1001137328 5:169113462-169113484 GCAACTCAAGTGTCCATCAGTGG - Intronic
1001148900 5:169209538-169209560 CCAACCCAAATGCCCATCAATGG + Intronic
1001428038 5:171637343-171637365 CAAACTGAAGAGCCCATGCTGGG - Intergenic
1002421684 5:179152362-179152384 CAGCCTCACGGGCCCATCATGGG - Intronic
1003415211 6:5901171-5901193 TCAACTTAAGTGCCCATCAATGG + Intergenic
1004653733 6:17637434-17637456 CAATCCCAAGTGCCTATCACTGG + Exonic
1005173872 6:23021886-23021908 ACAACTCAAGTGTCCATCAATGG + Intergenic
1008608639 6:53165697-53165719 TCAACCCAAGTGCCCATCAATGG + Intergenic
1008643735 6:53491503-53491525 CCAACCCAAATGCCCATCAGTGG - Intergenic
1009044832 6:58225901-58225923 TCAACCCAAGTGCCCATCAATGG - Intergenic
1009220647 6:60980219-60980241 TCAACCCAAGTGCCCATCAATGG - Intergenic
1009669181 6:66723752-66723774 CAAACTCAATTACATATCATTGG + Intergenic
1010101592 6:72115175-72115197 CAAACTCATATGCCAATCAAAGG - Intronic
1010291601 6:74143846-74143868 TCAACTTAAGTGCCCATCAATGG - Intergenic
1010878236 6:81136287-81136309 CCAACCCAAATGCCCATCAATGG + Intergenic
1012140791 6:95624271-95624293 CCAACCCAAATGCCCATCAATGG - Intergenic
1012502794 6:99908249-99908271 TCAACCCAAGTGCCCATCAATGG + Intergenic
1013568412 6:111394028-111394050 CAACCTTAAGTGCACATCAGTGG - Intronic
1013661705 6:112304313-112304335 TTAGCTCAAGTGCCCATCAGTGG - Intergenic
1014356149 6:120412594-120412616 TAAACTTAAATGCCCATCAATGG + Intergenic
1014609633 6:123525297-123525319 CAAACATAAGTGTCCATCAGTGG + Intronic
1014847576 6:126297445-126297467 CATACTAAAGTGTCCATGATGGG - Intergenic
1015662620 6:135592159-135592181 TCAACTCAGGTGCCCATCAGTGG - Intergenic
1016002970 6:139061470-139061492 CAACCTAAAATGCCCATCACTGG + Intergenic
1016855668 6:148668173-148668195 TCAACTCAAATGCCCATCAATGG - Intergenic
1019953541 7:4392817-4392839 GCAACTCAAGTGTCCATCAGTGG + Intergenic
1020099541 7:5387475-5387497 CAAACGAAAATGCCCATCAAGGG + Intronic
1020176153 7:5883713-5883735 AAAAATGAAGTGCCCACCATTGG + Intronic
1021119974 7:16788196-16788218 GCAACTCAAGTGTCCATCAATGG - Intergenic
1022045850 7:26621718-26621740 TAAACCCAGGTGCCCATCAACGG + Intergenic
1023129854 7:36991924-36991946 CAAACTCAGGTGTCCATCTGTGG + Intronic
1023449907 7:40272498-40272520 TAAACCCAAGTGTCCATCAAAGG - Intronic
1023814573 7:43939666-43939688 ACAACCCAAGTGCCCATCAGTGG + Intronic
1024183601 7:46924533-46924555 CCAACCCAAATGCCCATCAATGG - Intergenic
1026486662 7:70827872-70827894 TCAACTTAAGTGCCCATCAATGG - Intergenic
1026513316 7:71045525-71045547 CCAACCCAGGTGCCCATCAGTGG + Intergenic
1027443869 7:78249452-78249474 CCAACCCAAGTGTCCATCAATGG + Intronic
1027784022 7:82556594-82556616 TAAACTTAAATGCCCATCAATGG + Intergenic
1028348282 7:89811323-89811345 TCAACTTAAGTGCCCATCAGTGG + Intergenic
1028776234 7:94680238-94680260 AAAGCTGAACTGCCCATCATTGG - Intergenic
1029082671 7:97987311-97987333 AAAAATGAAGTGCCCACCATTGG - Intronic
1029286774 7:99471209-99471231 CCAACCCAAATGCCCATCAGTGG + Intergenic
1033401700 7:141032252-141032274 CAAACCTAAGTGTCCATCAGTGG + Intergenic
1033982837 7:147187356-147187378 TCAACTCAGGTGCCCATCAACGG + Intronic
1034370198 7:150588430-150588452 CCAACCCAAATGCCCATCAATGG - Intergenic
1035636714 8:1152652-1152674 CAAACCCAAGTTCGCATCCTAGG - Intergenic
1036097388 8:5738988-5739010 CCAACCCAAATGCCCATCAATGG - Intergenic
1036481414 8:9142906-9142928 TCAACCTAAGTGCCCATCATTGG - Intronic
1037254753 8:16941279-16941301 GAAACTCAAGTTCTGATCATTGG - Intergenic
1038011448 8:23479716-23479738 CAGAGTCAGGTGCCCATCCTGGG - Intergenic
1038309864 8:26438104-26438126 GCAACTCAAGTGCCCGTCAAAGG + Intronic
1038317477 8:26499979-26500001 TCAACCTAAGTGCCCATCATTGG + Intronic
1039444133 8:37617336-37617358 TCAACCCAAGTGCCCATCAATGG + Intergenic
1040963412 8:53059827-53059849 CTAACCCAAATGCCCATCAATGG + Intergenic
1041211513 8:55556395-55556417 GCAACTCAAGTGCCCATCACTGG + Intergenic
1041391439 8:57350606-57350628 CAAACACAAGTGCACACCCTAGG + Intergenic
1041400030 8:57433037-57433059 CAGACACAAATGTCCATCATGGG + Intergenic
1041785913 8:61633974-61633996 CAAACTCCACTGCCCAGCAAAGG + Intronic
1042708784 8:71691696-71691718 CAGACTCAAGTGTCCATTACTGG - Intergenic
1044320800 8:90798696-90798718 TCAACTTAAGTGCCCATCAGTGG - Intronic
1044759251 8:95500109-95500131 CCAACCCAAGTGCCCATCAATGG + Intergenic
1044773009 8:95657479-95657501 TCAACCCAAGTGCCCATCAGTGG + Intergenic
1045953020 8:107873098-107873120 CCAACCCAAATGCCCATCAATGG - Intergenic
1046811670 8:118539757-118539779 TAAACTCAAGTGCCATCCATGGG + Intronic
1047138470 8:122107740-122107762 CAAACTCAAGTTCCACTCACTGG + Intergenic
1047463382 8:125090017-125090039 AAAACACAAGTGCCCTTCATGGG - Intronic
1048596811 8:135875247-135875269 CAAAATCAAGTGCCCTACTTGGG - Intergenic
1049105792 8:140611714-140611736 CACACTCAAGTGCCTCTCCTTGG - Intronic
1050877465 9:10656686-10656708 CAATCTTAAGTGTCCATCAGTGG + Intergenic
1051492492 9:17682303-17682325 CCAACCCAAATGCCCATCAGTGG + Intronic
1053643608 9:40109022-40109044 AAACCTCAACTGCCCCTCATGGG - Intergenic
1053762545 9:41356468-41356490 AAACCTCAACTGCCCCTCATGGG + Intergenic
1054324466 9:63706250-63706272 AAACCTCAACTGCCCCTCATGGG - Intergenic
1054541143 9:66267582-66267604 AAACCTCAACTGCCCCTCATGGG + Intergenic
1054793528 9:69277590-69277612 CCAACCCAAATGCCCATCAATGG - Intergenic
1054864749 9:69988547-69988569 GCAACCCAAGTGCCCATCAATGG + Intergenic
1055015909 9:71617946-71617968 TCAACTTAAGTGCCCATCAAAGG + Intergenic
1055996458 9:82165740-82165762 TCAACTCAGGTGCCCATCAGTGG + Intergenic
1056959475 9:91110102-91110124 CTAACCCAGGTGCCCATCAGTGG + Intergenic
1057842128 9:98494921-98494943 CTATTTCAAGTGCCCACCATGGG + Intronic
1057973627 9:99580875-99580897 CTAAATCCAGTGCCTATCATAGG - Intergenic
1059827055 9:118042726-118042748 CCAACCCAAATGCCCATCAATGG + Intergenic
1060037956 9:120274502-120274524 CCAACTCAAATGTCCATCAATGG + Intergenic
1060213138 9:121722652-121722674 GAAACTCAAGTGTGGATCATAGG + Intronic
1060853871 9:126899513-126899535 CCAACTTAAGTGCCCATAATGGG + Intergenic
1061741511 9:132709691-132709713 CAAACTTAAGTGCACAGCTTAGG + Intergenic
1202791358 9_KI270719v1_random:91994-92016 AAACCTCAACTGCCCCTCATGGG - Intergenic
1203698149 Un_GL000214v1:115576-115598 AAACCTCAACTGCCCCTCATGGG - Intergenic
1203551047 Un_KI270743v1:165403-165425 AAACCTCAACTGCCCCTCATGGG + Intergenic
1185693695 X:2178070-2178092 CCAACCCAAATGCCCATCAATGG + Intergenic
1186055201 X:5642795-5642817 GTAACTCAAGTGCCCATCAAAGG + Intergenic
1186281622 X:7999242-7999264 CAAACTCAGCTGCCCATGACAGG + Intergenic
1186403603 X:9282219-9282241 GAAACTCAAGTGTCCATCAGAGG + Intergenic
1186698161 X:12059856-12059878 TCAACTTAAGTGCCCATCAATGG - Intergenic
1188135305 X:26487424-26487446 TCAACTTAAGTGCCCATCAGTGG + Intergenic
1188724987 X:33571959-33571981 TAAACCTAAGTGCCCATCAAGGG - Intergenic
1188992066 X:36833659-36833681 TCAACTCAAATGCCCATCAATGG + Intergenic
1189598957 X:42600956-42600978 CAAACTATAGTGTCCAGCATGGG - Intergenic
1189929765 X:45996539-45996561 AGAACTCAAGTTCCCATCACTGG + Intergenic
1190537159 X:51440734-51440756 GAAACTCAAGTTCCCACCACTGG - Intergenic
1191150409 X:57215559-57215581 CCAACCCAAATGCCCATCAATGG + Intergenic
1191166517 X:57398244-57398266 CCAACCCAAATGCCCATCAATGG + Intronic
1192284465 X:69720072-69720094 CCAACCTAAGTGCCCATCAGTGG - Intronic
1192384228 X:70649114-70649136 CCAACCCAAATGCCCATCAATGG - Intronic
1192400139 X:70826750-70826772 GAAACTCAAGTTCCCACCACTGG - Intronic
1192475027 X:71433414-71433436 CAAACTCAAGTGTCCTGCAGGGG + Intronic
1192694380 X:73399122-73399144 AAAACTCAAGTTCCCACCACTGG - Intergenic
1192826814 X:74705389-74705411 AGAACTCAAGTTCCCATCACTGG + Intergenic
1193674378 X:84431247-84431269 CAACCATAAGTGCCCATCAATGG - Intronic
1193973388 X:88086137-88086159 TCAACTCAAATGCCCATCAATGG - Intergenic
1194011113 X:88563047-88563069 CCAACCTAAGTGCCCATCAGTGG + Intergenic
1194171436 X:90588655-90588677 TCAACTCAAATGCCCATCAATGG + Intergenic
1194487773 X:94506904-94506926 AAAGCACAAGTGCCCATCAATGG + Intergenic
1194541204 X:95175011-95175033 TCAACTCAAATGCCCATCAGTGG + Intergenic
1195539944 X:106052299-106052321 CCAACTTAAGTGTCCATCAATGG + Intergenic
1195579705 X:106487519-106487541 CCAACCCAAATGCCCATCAGTGG - Intergenic
1195823226 X:108969894-108969916 CAAACTCAAGTTCCCATTGCTGG - Intergenic
1197243798 X:124147730-124147752 CCAACCCAAATGCCCATCAATGG + Intronic
1197427281 X:126313179-126313201 TCAACTGAAGTGTCCATCATTGG + Intergenic
1197617138 X:128705769-128705791 TCAACCCAAGTGCCCATCAATGG - Intergenic
1199029114 X:142975512-142975534 CCAACCCAAATGCCCATCAGTGG + Intergenic
1199166125 X:144677870-144677892 TCAACTCAGGTGCCCATCAATGG - Intergenic
1199414713 X:147567990-147568012 TCAACCCAAGTGCCCATCAATGG - Intergenic
1200306945 X:155035911-155035933 AAAACTCAAATGTCCATCAAAGG - Intronic
1200517669 Y:4166409-4166431 TCAACTCAAATGCCCATCAATGG + Intergenic
1200819295 Y:7565822-7565844 CCAACTTAAGTGCCCATCAATGG + Intergenic