ID: 985021904

View in Genome Browser
Species Human (GRCh38)
Location 4:185700630-185700652
Sequence ATAAGACTGTTTCTCAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985021901_985021904 17 Left 985021901 4:185700590-185700612 CCCTCAAGATGTACCTGAATTTA 0: 1
1: 0
2: 0
3: 11
4: 171
Right 985021904 4:185700630-185700652 ATAAGACTGTTTCTCAGTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 183
985021902_985021904 16 Left 985021902 4:185700591-185700613 CCTCAAGATGTACCTGAATTTAA 0: 1
1: 0
2: 0
3: 10
4: 194
Right 985021904 4:185700630-185700652 ATAAGACTGTTTCTCAGTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 183
985021903_985021904 4 Left 985021903 4:185700603-185700625 CCTGAATTTAAGAAACATAATAT 0: 1
1: 0
2: 4
3: 53
4: 607
Right 985021904 4:185700630-185700652 ATAAGACTGTTTCTCAGTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985021904 Original CRISPR ATAAGACTGTTTCTCAGTGC TGG Intronic
900969131 1:5979872-5979894 ATAAGACTGTCCCCCAGAGCCGG + Intronic
901002915 1:6157578-6157600 GGCAGACTGGTTCTCAGTGCTGG - Intronic
904190027 1:28736575-28736597 AAAAGCCGGTTTCTCAGTGAGGG - Intergenic
904202199 1:28827741-28827763 CTAAGACTGTGTCTCTGAGCAGG - Intronic
906718431 1:47987863-47987885 AGAAGCCTGTTTCTCAGTCCAGG + Intronic
907537992 1:55182701-55182723 AAAAGACTGTTTTTCATTTCGGG - Intronic
907551294 1:55307184-55307206 ATTAGTCTGTTTCACACTGCTGG - Intergenic
908872632 1:68631383-68631405 ATATGAATGTTTCTCATTACTGG + Intergenic
909331284 1:74414756-74414778 ATTAGACTGTTTCTCACTATCGG + Intronic
911561126 1:99406304-99406326 AGTAGACTGTTTCTCAGTTTGGG - Intergenic
912639559 1:111332354-111332376 ATCAGGCTGTTTCTCAGGCCTGG + Intergenic
914418933 1:147510523-147510545 ATAAGACTTTTGGTCAGGGCCGG + Intergenic
921022745 1:211251244-211251266 ATAAGACTGAAACTCTGTGCAGG + Intergenic
922036958 1:221858250-221858272 AAAAGAATGTTTCTCAGGCCAGG - Intergenic
922325835 1:224527370-224527392 AAAATACTGTTTCTTACTGCAGG + Intronic
922660915 1:227429675-227429697 AAGAGACTGTTGCTCAGGGCTGG + Intergenic
924638278 1:245809324-245809346 ATAGCACTGTCTGTCAGTGCAGG - Intronic
1065072393 10:22039155-22039177 ATAGGACTGTTTTTCAGATCTGG - Intergenic
1065145841 10:22767198-22767220 TTAATACTGTTTCTCAGCGGAGG + Intergenic
1068317806 10:55369875-55369897 ATAAGCATGTGTCTCAGTCCAGG - Intronic
1068322786 10:55441586-55441608 ATGAGACTGTGTCTTAGTGTGGG - Intronic
1068757694 10:60672786-60672808 ACAAGACTGTCCCTCAGTTCAGG - Intronic
1069608027 10:69752512-69752534 AGAAGACTGTTTCAGAGAGCAGG + Intergenic
1069970962 10:72168761-72168783 ATGCGACTGTTTCTCTTTGCCGG - Intronic
1070060734 10:72980895-72980917 ATAAGGCTGCTTCTCAGGGGTGG + Intergenic
1070207240 10:74275935-74275957 AAAAGAATGTTTCTAAGGGCTGG - Intronic
1070226632 10:74515327-74515349 ACTAGACTGTTTCTCAGGTCTGG + Intronic
1071390277 10:85167492-85167514 ATAGTACTTTTTCTCACTGCAGG - Intergenic
1071778080 10:88811362-88811384 ATAAGGCTGTTTTTTACTGCAGG + Intronic
1073730939 10:106286662-106286684 ATAAGACTGTTTCGTAATTCTGG - Intergenic
1075867369 10:125736530-125736552 ATACGACTGTATTTCAGTTCAGG - Intronic
1077452930 11:2661821-2661843 ATAAAACTGATTGTCAGGGCTGG + Intronic
1080924518 11:36742525-36742547 ATAACACTGGTTCTCAATCCTGG - Intergenic
1082175413 11:49052974-49052996 ATACAACAGTTTTTCAGTGCTGG - Intergenic
1086455067 11:86953176-86953198 AGCAGACTGTTTATCAATGCTGG - Intronic
1086698314 11:89869883-89869905 ATACAACAGTTTTTCAGTGCTGG - Exonic
1086707850 11:89974605-89974627 ATACAACAGTTTTTCAGTGCTGG + Exonic
1086975485 11:93127928-93127950 ATTTCACTGTTTCTCTGTGCGGG - Intergenic
1087628646 11:100624699-100624721 ATAAAACTGTTTCTAACTGGTGG - Intergenic
1087681568 11:101224340-101224362 ACAAGATTGTTTCTCAGGCCTGG + Intergenic
1087757019 11:102065044-102065066 AAAAGACGGTTTCTAAGTGAAGG - Intronic
1088532593 11:110827017-110827039 ATAAGAGTGTTTATCAGTCAGGG - Intergenic
1091352533 11:134908599-134908621 ATAAGGCTCTTCCGCAGTGCAGG + Intergenic
1099734622 12:86551269-86551291 AAAAGACTGTTTATCAGGCCTGG - Intronic
1106055327 13:26231692-26231714 ATAAGGCTATATCTCATTGCTGG - Intergenic
1107174394 13:37383250-37383272 CTAAGACTGAATCTCAGTTCAGG + Intergenic
1108642446 13:52395428-52395450 CTAACACTGCTTCTCAGTGTAGG - Intronic
1109618262 13:64865337-64865359 ATAAGACTCTTTCCCAGTAAAGG - Intergenic
1111371911 13:87330611-87330633 AAAACACTGTTTCTCAAAGCTGG + Intergenic
1113147086 13:107219132-107219154 ATAAGACTACTTCTGAGTGTTGG + Intronic
1114725025 14:24927175-24927197 AGAAGACTGTTTATGAATGCAGG + Intronic
1114803873 14:25811322-25811344 ATAATATTGATTCTTAGTGCTGG - Intergenic
1116988479 14:51247042-51247064 ATTAAATTATTTCTCAGTGCTGG + Intronic
1124584955 15:30996361-30996383 AGAAGAATGTGTCTTAGTGCTGG - Intergenic
1124853962 15:33368994-33369016 AAAAGTCTGTCTGTCAGTGCTGG - Intronic
1125655124 15:41350061-41350083 TTAAGACTGTGTTTCAGGGCTGG - Intronic
1126602481 15:50442842-50442864 ATAAGATTGTTTCTAAGTAAAGG - Intronic
1126925674 15:53583702-53583724 GAAACACTGTTTCACAGTGCAGG + Intronic
1129527819 15:76233088-76233110 ATAAGACTGTGTCTTAGGGTGGG + Intronic
1131587755 15:93714680-93714702 ATAAGGCTTTCTCACAGTGCAGG + Intergenic
1132017836 15:98334730-98334752 ATAAAACTGTTTCTCACTGCTGG + Intergenic
1133615965 16:7477261-7477283 ATAAGCCTGTGTCTCATTGCCGG - Intronic
1135144149 16:19947081-19947103 TTAAGACTGTTCTTCAGTGCTGG + Intergenic
1135203495 16:20461214-20461236 CTAAGACTGTTTCATAGTGTAGG - Intronic
1135215508 16:20563723-20563745 CTAAGACTGTTTCATAGTGTAGG + Intronic
1135679864 16:24447087-24447109 AAAAGAATGGTTGTCAGTGCTGG - Intergenic
1137362832 16:47835283-47835305 ATTAGAATGTGTCTCAGTGTGGG - Intergenic
1137938627 16:52658944-52658966 ATGAGGCTGTTTCTCAGGCCTGG - Intergenic
1138235138 16:55376165-55376187 TTAAGACTGTTTTTCCATGCAGG + Intergenic
1138947819 16:61873679-61873701 ATAACTCTGTTTTTCAATGCTGG + Intronic
1140739276 16:77926782-77926804 ACATGTCTGTGTCTCAGTGCTGG - Intronic
1140910231 16:79444695-79444717 ACAACACTGTTTCTGGGTGCAGG + Intergenic
1142291614 16:89195875-89195897 AGAAGCCCGTGTCTCAGTGCAGG - Exonic
1144488397 17:15686627-15686649 ATGGGACTGTTTCTCAGGCCTGG + Intergenic
1144912620 17:18695677-18695699 ATGGGACTGTTTCTCAGGCCTGG - Intergenic
1146842074 17:36163259-36163281 ACAAGACTGTTTCCCAGAGCTGG - Intergenic
1146854383 17:36251218-36251240 ACAAGACTGTTTCCCAGAGCTGG - Intronic
1146870286 17:36375110-36375132 ACAAGACTGTTTCCCAGAGCTGG - Intronic
1146877643 17:36426191-36426213 ACAAGACTGTTTCCCAGAGCTGG - Intronic
1147073167 17:37975734-37975756 ACAAGACTGTTTCCCAGAGCTGG - Intergenic
1147084689 17:38055272-38055294 ACAAGACTGTTTCCCAGAGCTGG - Intronic
1147100636 17:38179238-38179260 ACAAGACTGTTTCCCAGAGCTGG - Intergenic
1147510200 17:41061934-41061956 ATAAGTCTGTTTCACAGCTCAGG + Intergenic
1150083576 17:62262285-62262307 ACAAGACTGTTTCCCAGAGCTGG - Intergenic
1150951737 17:69810224-69810246 ATAAGAGGGTTCCCCAGTGCTGG + Intergenic
1151026330 17:70681815-70681837 TTAAGACAGTTTCTTAGAGCTGG + Intergenic
1155665301 18:28300228-28300250 ATAAGTCTGTATCCCAGTTCAGG - Intergenic
1156335014 18:36162714-36162736 AAAAGACTGATACTAAGTGCTGG - Intronic
1160333229 18:78014528-78014550 TTAACACTGTTTCTCAGAGATGG + Intergenic
1162867992 19:13563437-13563459 AACAGACTGTCTCTCAGTTCTGG + Intronic
1164930984 19:32175839-32175861 AGAAAACTGTTTCTCAGGGCTGG - Intergenic
1166609951 19:44182452-44182474 ATAACACTGGTTCTCAGTTGGGG - Intergenic
927802737 2:26116419-26116441 ATATGTCTGTTTCACAGGGCTGG + Intronic
932973014 2:76568743-76568765 ATAAGTTTGTTTGTCAGTGGTGG - Intergenic
933063162 2:77763475-77763497 AAAAGAAGGTTTCTTAGTGCTGG + Intergenic
934587929 2:95520836-95520858 ATACAACAGTTTTTCAGTGCTGG + Intergenic
934873129 2:97886626-97886648 ACAAGGCTGTTTCTCAGGTCAGG + Intronic
935112038 2:100103836-100103858 AAACGAGTGTTTCTCCGTGCCGG - Intronic
936122935 2:109761315-109761337 AAACGAGTGTTTCTCCGTGCCGG + Intergenic
937454332 2:122028157-122028179 CCAAGACAGTTTCTCAGAGCCGG - Intergenic
937648798 2:124297252-124297274 ATATGCCTGGTTCTCCGTGCCGG + Intronic
938388500 2:130885221-130885243 ACAAGACTGTCCCTCAGAGCAGG - Intronic
941116745 2:161480477-161480499 ACAGGACTGTTTCTCAGACCTGG - Intronic
944269037 2:197760360-197760382 ATGGGACTGTTTCTCAGGCCTGG - Intronic
945169755 2:206983287-206983309 AAAAAACTGGTTTTCAGTGCTGG + Intergenic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1169409399 20:5354646-5354668 ATAAGGGTGTTTCCCAGTGCTGG - Intergenic
1173085178 20:39909237-39909259 ATATGACTGCTTCTCTCTGCTGG - Intergenic
1173714750 20:45193412-45193434 ATAAGGTTGTCTCTCAGTGGAGG + Intergenic
1173717180 20:45218715-45218737 GTAGGACTGTTTCTCAGACCTGG + Intergenic
1179506207 21:41843496-41843518 ACAAGGATGTTTCACAGTGCTGG - Intronic
1183485561 22:38086105-38086127 CTCAGTCTGTTCCTCAGTGCAGG - Intronic
949781580 3:7694947-7694969 ATAAGACTGTTTCCCAAACCTGG - Intronic
954481740 3:50806209-50806231 ATGAGGCTGTTTCTCAGGTCTGG + Intronic
956314252 3:67916369-67916391 ACCAGACTGTTTCTCATTCCTGG - Intergenic
958627762 3:96647878-96647900 ACAAAACTGTTCCTCATTGCTGG + Intergenic
959682405 3:109110462-109110484 ATAAAACTGTTTCTCATGGCAGG + Intronic
961219104 3:125185928-125185950 ATAAGATGTTTTCTAAGTGCTGG - Intronic
961575799 3:127835123-127835145 GCAAGACTGTTTCTAAGAGCTGG - Intergenic
963149350 3:142028547-142028569 ATCAGTTTGTTTCTCACTGCTGG - Intronic
966140124 3:176747768-176747790 ATGAGACTGATTCTCACAGCAGG + Intergenic
967701463 3:192597453-192597475 ATTTGACTGTTTTGCAGTGCAGG + Intronic
968008137 3:195256652-195256674 AACAGACTGTTACTCAGAGCCGG + Intronic
969106184 4:4808751-4808773 ATGAGACTGTTTATAAGGGCTGG + Intergenic
970668299 4:18363676-18363698 ATTAGACCGTTTCACACTGCTGG - Intergenic
970989544 4:22196338-22196360 ATAAAAATGCTTCTCAGTCCTGG - Intergenic
975399492 4:73918034-73918056 ATAAAACTATTTCTAAGTGGGGG + Intergenic
975665111 4:76727583-76727605 ATCAACCTTTTTCTCAGTGCAGG - Intronic
979860998 4:125693555-125693577 ATAATACTGTTTATTTGTGCAGG + Intergenic
979864120 4:125732098-125732120 AGAAGACTATACCTCAGTGCTGG - Intergenic
983058405 4:163126876-163126898 AAAAGACTGTAACTCACTGCAGG + Intronic
983453638 4:167935987-167936009 ATAAAACTGTTTCTCATATCTGG - Intergenic
983989099 4:174096844-174096866 AAAAAACTGTTTCTCAGGCCCGG + Intergenic
984720945 4:182972594-182972616 ATAAAAATGTTTTTCATTGCTGG + Intergenic
985021904 4:185700630-185700652 ATAAGACTGTTTCTCAGTGCTGG + Intronic
985238998 4:187908918-187908940 ACAATACTGTTTTTCAGTTCAGG - Intergenic
986360936 5:6977579-6977601 AAAAGGCTGTGTCTCAGTGTGGG + Intergenic
987243860 5:16028637-16028659 ATAAGATTATTTCTCACTGTAGG + Intergenic
989332887 5:40280759-40280781 TTATGACTGTTTTTCAGTGTTGG + Intergenic
990082387 5:51932994-51933016 ATGAGACTGTTTCCTATTGCTGG + Intergenic
992747344 5:79832786-79832808 AGCACACTGTTTCTGAGTGCAGG - Intergenic
993012028 5:82493516-82493538 ATAAAAATGTTTCTCAGCTCAGG + Intergenic
994354749 5:98782760-98782782 CTAAGACAGCTTCTCAGTCCTGG + Intronic
995416818 5:111922041-111922063 ATTAGTCTGTTTCACACTGCTGG - Intronic
996120384 5:119665317-119665339 GTAAGACTCTTTCTCTGGGCTGG + Intergenic
997142970 5:131402309-131402331 ATTATAATGTTTCTCAGTGTAGG - Intergenic
997685125 5:135783108-135783130 ATAATATTGTTTCTCAATCCAGG + Intergenic
999251781 5:150186821-150186843 ATAAGACAGGTTCTCAGCCCAGG - Intergenic
999692123 5:154157401-154157423 ATGAGATTGTTTCTGAGTGTCGG + Intronic
1000918354 5:167108815-167108837 ATATGACTTTTTTTCAGTGAAGG + Intergenic
1002030816 5:176428628-176428650 ATAAAATTGTTTCTCATGGCTGG + Intergenic
1002878212 6:1229663-1229685 ATATCAGTGTTTCTCAGTACAGG - Intergenic
1003320891 6:5050029-5050051 ATCAGAGTGCTTCTTAGTGCAGG - Intergenic
1003799324 6:9645302-9645324 AAAAGAATGATGCTCAGTGCTGG + Intronic
1006762645 6:36476895-36476917 AAAAAAGTGTTTCTCAGTGCAGG + Intronic
1008880608 6:56377283-56377305 TTAAGACTGTTTTTCCGGGCCGG - Intronic
1010823541 6:80445432-80445454 GTAAGACTGTTGGTGAGTGCTGG + Intergenic
1010953470 6:82064076-82064098 AGAAGAGGGTTTCTGAGTGCTGG + Intergenic
1010991422 6:82484639-82484661 CTAAGACTTTTTCTGAGGGCAGG + Intergenic
1011182768 6:84639839-84639861 ATAAGACTTTTTCTAAGGCCTGG - Intergenic
1011770104 6:90666162-90666184 AAATGAGTGTTTTTCAGTGCAGG - Intergenic
1012841356 6:104332641-104332663 TGAAGACTGTTTCTCATGGCAGG - Intergenic
1012992404 6:105939336-105939358 ATTAGACTGTTTCTAGATGCAGG + Intergenic
1014049307 6:116933697-116933719 ATAACAGTGTTTCTCCATGCAGG + Intergenic
1014226577 6:118854964-118854986 ATAACAATATTTCTCAGTGATGG + Intronic
1015036709 6:128664595-128664617 TTAAAACTTTTACTCAGTGCTGG - Intergenic
1015285732 6:131485019-131485041 ACAAGGCTGTTTCTCAGGTCTGG + Intergenic
1017018219 6:150118090-150118112 AAAAGAATGTTTCTCTTTGCTGG - Intergenic
1017906320 6:158759436-158759458 AGAGGGCTGCTTCTCAGTGCTGG + Intronic
1021159358 7:17252731-17252753 ATCAGGCAGTTTCCCAGTGCTGG + Intergenic
1021242592 7:18222244-18222266 AAAAGCATGTTTCTCAGTTCAGG - Intronic
1021944463 7:25712940-25712962 AGAAAACTGCATCTCAGTGCAGG + Intergenic
1023739730 7:43268603-43268625 AGAGGAGTGTTTCTCAGTGTTGG - Intronic
1028102699 7:86840696-86840718 ATAAGAATGTTTCTCTCTTCAGG + Intronic
1030352613 7:108506844-108506866 ATAAGATTGTTTCTCATTCAGGG + Intronic
1031232863 7:119132590-119132612 ATAAGACTGCATCACAGTGCAGG + Intergenic
1031531558 7:122883198-122883220 ATAACACTGCTGCTCAGTTCTGG + Intronic
1033071009 7:138202351-138202373 ATATGACTGTTTCTCATTAAAGG - Intergenic
1036161144 8:6389514-6389536 ATCTTACTGTTTCTCAGTTCTGG - Intergenic
1038614667 8:29081337-29081359 ATTAGCCTCATTCTCAGTGCTGG - Intronic
1042089719 8:65145515-65145537 ATAAGTCTTTATCTCCGTGCAGG + Intergenic
1044219255 8:89650008-89650030 ATGGGGCTGTTTCTCAGTTCTGG - Intergenic
1045978913 8:108161211-108161233 GTAACACTGCGTCTCAGTGCAGG - Intergenic
1046584472 8:116134264-116134286 ATAAAACTGTTTCTCATTCTTGG - Intergenic
1047364973 8:124203362-124203384 ACAACAGTGTTTCTCAGTGGAGG + Intergenic
1047464186 8:125096363-125096385 TTGAGACTATTTCTCAGGGCAGG - Intronic
1049704990 8:144037463-144037485 ATAAGAATTTTTCTTAGTACAGG - Intronic
1055436662 9:76298386-76298408 ATGAGAGTGTTTCTCATGGCTGG + Intronic
1056509974 9:87295358-87295380 ATATGACTGTGTCTTAGTGGTGG + Intergenic
1057357749 9:94345808-94345830 ATAAGATTGTTTTTCAGGGCTGG + Intergenic
1057650001 9:96911814-96911836 ATAAGATTGTTTTTCAGGGCTGG - Intronic
1059687769 9:116653969-116653991 ATAAGACTGTCTCTAGCTGCTGG - Intronic
1059762731 9:117354371-117354393 ATCAAGCTGTTTCTCACTGCAGG + Intronic
1062063203 9:134509788-134509810 TTAAAACTGTTTTTCAGTGAAGG - Intergenic
1188297736 X:28470478-28470500 AGAACAATGTTTCTCAGTTCTGG - Intergenic
1191839518 X:65501746-65501768 GTAAGACTCTCTCTCAGTGATGG - Intronic
1192691976 X:73373846-73373868 ATAAGACGGTTTTGCTGTGCTGG + Intergenic
1193881858 X:86933052-86933074 ATCAAACTGTTTCTCAGTTTTGG + Intergenic
1195175329 X:102309790-102309812 ATAAGAATGTTTAAGAGTGCTGG - Intronic
1195183536 X:102377303-102377325 ATAAGAATGTTTAAGAGTGCTGG + Intronic
1197272133 X:124436432-124436454 ATGAGACTGATTCTCAGGGTAGG - Intronic
1198709643 X:139487423-139487445 ATACAAATATTTCTCAGTGCAGG - Intergenic
1201247901 Y:12024556-12024578 AGTAGAGTGTGTCTCAGTGCTGG - Intergenic