ID: 985031392

View in Genome Browser
Species Human (GRCh38)
Location 4:185794260-185794282
Sequence ATGGAGAAGGAGGAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5536
Summary {0: 1, 1: 10, 2: 114, 3: 870, 4: 4541}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985031392 Original CRISPR ATGGAGAAGGAGGAGGAGGG AGG Intronic
Too many off-targets to display for this crispr