ID: 985033406

View in Genome Browser
Species Human (GRCh38)
Location 4:185814687-185814709
Sequence TCCCCCAGTTTGCACTGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985033405_985033406 -6 Left 985033405 4:185814670-185814692 CCAAAGAGAACTGGAAGTCCCCC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 985033406 4:185814687-185814709 TCCCCCAGTTTGCACTGAACCGG No data
985033400_985033406 12 Left 985033400 4:185814652-185814674 CCTCCAATTCCTGCTCCTCCAAA 0: 1
1: 1
2: 4
3: 39
4: 439
Right 985033406 4:185814687-185814709 TCCCCCAGTTTGCACTGAACCGG No data
985033402_985033406 3 Left 985033402 4:185814661-185814683 CCTGCTCCTCCAAAGAGAACTGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 985033406 4:185814687-185814709 TCCCCCAGTTTGCACTGAACCGG No data
985033399_985033406 18 Left 985033399 4:185814646-185814668 CCTATACCTCCAATTCCTGCTCC 0: 1
1: 0
2: 2
3: 28
4: 329
Right 985033406 4:185814687-185814709 TCCCCCAGTTTGCACTGAACCGG No data
985033398_985033406 19 Left 985033398 4:185814645-185814667 CCCTATACCTCCAATTCCTGCTC 0: 1
1: 0
2: 0
3: 13
4: 237
Right 985033406 4:185814687-185814709 TCCCCCAGTTTGCACTGAACCGG No data
985033397_985033406 20 Left 985033397 4:185814644-185814666 CCCCTATACCTCCAATTCCTGCT 0: 1
1: 0
2: 1
3: 26
4: 263
Right 985033406 4:185814687-185814709 TCCCCCAGTTTGCACTGAACCGG No data
985033401_985033406 9 Left 985033401 4:185814655-185814677 CCAATTCCTGCTCCTCCAAAGAG 0: 1
1: 0
2: 2
3: 32
4: 330
Right 985033406 4:185814687-185814709 TCCCCCAGTTTGCACTGAACCGG No data
985033404_985033406 -3 Left 985033404 4:185814667-185814689 CCTCCAAAGAGAACTGGAAGTCC 0: 1
1: 0
2: 2
3: 25
4: 196
Right 985033406 4:185814687-185814709 TCCCCCAGTTTGCACTGAACCGG No data
985033395_985033406 26 Left 985033395 4:185814638-185814660 CCTCCTCCCCTATACCTCCAATT 0: 1
1: 0
2: 1
3: 25
4: 293
Right 985033406 4:185814687-185814709 TCCCCCAGTTTGCACTGAACCGG No data
985033396_985033406 23 Left 985033396 4:185814641-185814663 CCTCCCCTATACCTCCAATTCCT 0: 1
1: 0
2: 3
3: 25
4: 324
Right 985033406 4:185814687-185814709 TCCCCCAGTTTGCACTGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985033406 Original CRISPR TCCCCCAGTTTGCACTGAAC CGG Intronic
No off target data available for this crispr