ID: 985033443

View in Genome Browser
Species Human (GRCh38)
Location 4:185814869-185814891
Sequence CTTGGTGCACTGAGGCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985033438_985033443 -10 Left 985033438 4:185814856-185814878 CCCTCCCTTGTAACTTGGTGCAC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 985033443 4:185814869-185814891 CTTGGTGCACTGAGGCCCATTGG No data
985033435_985033443 2 Left 985033435 4:185814844-185814866 CCTGCTCGAAGCCCCTCCCTTGT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 985033443 4:185814869-185814891 CTTGGTGCACTGAGGCCCATTGG No data
985033434_985033443 8 Left 985033434 4:185814838-185814860 CCTTCGCCTGCTCGAAGCCCCTC 0: 1
1: 0
2: 1
3: 18
4: 206
Right 985033443 4:185814869-185814891 CTTGGTGCACTGAGGCCCATTGG No data
985033433_985033443 23 Left 985033433 4:185814823-185814845 CCAAGGCTCTTGGCTCCTTCGCC 0: 1
1: 0
2: 1
3: 26
4: 262
Right 985033443 4:185814869-185814891 CTTGGTGCACTGAGGCCCATTGG No data
985033437_985033443 -9 Left 985033437 4:185814855-185814877 CCCCTCCCTTGTAACTTGGTGCA 0: 1
1: 0
2: 1
3: 7
4: 119
Right 985033443 4:185814869-185814891 CTTGGTGCACTGAGGCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985033443 Original CRISPR CTTGGTGCACTGAGGCCCAT TGG Intronic
No off target data available for this crispr