ID: 985034436

View in Genome Browser
Species Human (GRCh38)
Location 4:185824049-185824071
Sequence GGGAGCAAATGCAGTAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985034436_985034443 13 Left 985034436 4:185824049-185824071 CCATGGTTACTGCATTTGCTCCC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 985034443 4:185824085-185824107 GCAAAGTACCCCAAACCGGGTGG 0: 1
1: 4
2: 29
3: 265
4: 1128
985034436_985034441 9 Left 985034436 4:185824049-185824071 CCATGGTTACTGCATTTGCTCCC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 985034441 4:185824081-185824103 CGTAGCAAAGTACCCCAAACCGG 0: 1
1: 1
2: 31
3: 300
4: 1144
985034436_985034442 10 Left 985034436 4:185824049-185824071 CCATGGTTACTGCATTTGCTCCC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 985034442 4:185824082-185824104 GTAGCAAAGTACCCCAAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985034436 Original CRISPR GGGAGCAAATGCAGTAACCA TGG (reversed) Intronic
901128080 1:6943252-6943274 GGGAGGAAAACCAGGAACCATGG - Intronic
901218740 1:7570248-7570270 GGGATCAAAAGCAGAAGCCAGGG - Intronic
901458398 1:9376978-9377000 GGGAGCAAAGCGGGTAACCAGGG + Intergenic
905772876 1:40649722-40649744 GGGAGCAGCTGCTGTCACCATGG + Intronic
907605413 1:55812490-55812512 GGGGGCAAAGGGAGTGACCAAGG + Intergenic
907711479 1:56886668-56886690 AGGAGCTGATGCAGTAACAAGGG - Intronic
909044449 1:70691876-70691898 GGAAGCTATTGCAGTAAGCAAGG + Intergenic
910440280 1:87244753-87244775 TGGAGGAACTGCAGAAACCATGG - Intergenic
911264637 1:95728340-95728362 GGGAGTAAATACAGTTACAAAGG + Intergenic
912616841 1:111110402-111110424 GGGACCAGCTGCAGTGACCATGG - Intergenic
914353213 1:146858135-146858157 GGGGGCAAATGCAGGAAGGATGG - Intergenic
916057894 1:161080578-161080600 GGGAGGAAAGGCATGAACCAAGG + Intronic
916725344 1:167517870-167517892 GGGAGTAAGTGGGGTAACCAAGG - Intronic
917384189 1:174451365-174451387 AGGGGAAAATGCAGTAAGCATGG - Intronic
917434364 1:175004186-175004208 GAGAGAACATGCAGTGACCATGG - Intronic
917480104 1:175404357-175404379 GGGAGCCTTTGAAGTAACCATGG - Intronic
921761781 1:218923458-218923480 GGGAGCCATGGCAATAACCAAGG - Intergenic
922112485 1:222574880-222574902 GGGAGGAAATGCAGTCAGGAAGG + Intronic
1066667834 10:37803471-37803493 GTCAGCACATGCAGAAACCATGG - Intronic
1070359754 10:75676122-75676144 GGAATCAAAGGCAGTAACCTGGG - Intronic
1070457042 10:76627533-76627555 TGCAGCAAACACAGTAACCAGGG + Intergenic
1070739948 10:78896329-78896351 TGGAGCTAATGCAATGACCATGG - Intergenic
1071869647 10:89780483-89780505 GCGAACATAGGCAGTAACCAGGG - Intergenic
1071920734 10:90347157-90347179 GGGAGCAATTGCAGTGAACCTGG - Intergenic
1071976559 10:90961828-90961850 GTTAGCAAATGGAGTAACAATGG + Intergenic
1072083699 10:92057598-92057620 GCGAACACAGGCAGTAACCAGGG + Intronic
1072521434 10:96233231-96233253 TGGAGCAAATGCAGTTATCCAGG - Intronic
1076518711 10:131065706-131065728 GGAAGCAAATGCAGTTAAGAGGG - Intergenic
1077869467 11:6249961-6249983 GGCAGTAATTGCAGTAACCAGGG + Intergenic
1078649259 11:13172158-13172180 ATGAGCAAATGCATCAACCATGG + Intergenic
1078942246 11:16020440-16020462 TGGAGGAAATGCAGTAGACATGG - Intronic
1080128671 11:28767238-28767260 GCAAACAAAGGCAGTAACCAGGG + Intergenic
1088707870 11:112480087-112480109 AGGGGCAATTGCAGCAACCATGG - Intergenic
1088943458 11:114484378-114484400 GAGAGCACATGCAGTCATCAAGG - Intergenic
1089134168 11:116235907-116235929 GGGAGCAAATGAGATAAACATGG + Intergenic
1089997108 11:122918890-122918912 GGAAGAAAAAGCAGTTACCAGGG + Intronic
1090888991 11:130906180-130906202 GGGAGCAAATGCAGCACTCTAGG + Intronic
1091082372 11:132682667-132682689 GGGAGAGAATGGAGCAACCAGGG + Intronic
1091370944 11:135057268-135057290 GGGAGCACATGCAGAGTCCAAGG + Intergenic
1091780882 12:3213897-3213919 GGGAGGAAATGCAGGATGCATGG - Intronic
1092331084 12:7588711-7588733 GGGAGAAAAAGCAGGCACCATGG + Intergenic
1092437080 12:8457860-8457882 GACAACAAATGCAGTTACCAGGG - Intronic
1093170772 12:15857885-15857907 GTGTGCAAATCCAGTAACCTTGG - Intronic
1096226816 12:49871337-49871359 GGGAGGAAAGGCATTAACCCCGG - Intronic
1096539629 12:52298248-52298270 GAGGACAAATGGAGTAACCATGG + Intronic
1101320705 12:103670671-103670693 GGGAGCAAAGGCAGGGCCCATGG - Intronic
1102540442 12:113615178-113615200 GGGAGCAAATGCACAAATCATGG + Intergenic
1103413601 12:120729678-120729700 GGGGACAAAAGCAATAACCATGG - Intronic
1104086167 12:125475993-125476015 AGGAGCAAAAGCAGAAAGCAGGG - Intronic
1105523080 13:21149110-21149132 AGGAGCAAATGAGGCAACCAGGG - Intergenic
1106507181 13:30381358-30381380 GGGACCAAAAGCAGTTTCCATGG + Intergenic
1107111012 13:36698300-36698322 GGGAGCAACTGCAGTTACAAGGG - Intergenic
1109576471 13:64265189-64265211 GGTAGCCAATGCATTAATCATGG - Intergenic
1110260220 13:73476481-73476503 AGGAGCTAATGCAGAACCCATGG + Intergenic
1112140330 13:96634258-96634280 AGGTGCAAATGCAGAAGCCAGGG - Intronic
1113003878 13:105676992-105677014 AGGATCAAAGGCAGTAACAAAGG + Intergenic
1114629442 14:24149740-24149762 GGTAGCAATTGCAGTAACCCAGG + Intronic
1115855299 14:37623883-37623905 GACAGCAAAAGCAGTAACAAGGG + Intronic
1116725078 14:48553355-48553377 GGGAACATATGCAGTAGCCAAGG - Intergenic
1117645615 14:57848865-57848887 GGGACAATATGAAGTAACCAAGG - Intronic
1118910229 14:70056037-70056059 AGGAGCAAATGCCCTTACCAGGG - Intronic
1119698411 14:76733236-76733258 GAGAGCAAATGCAGCATCTAGGG + Intergenic
1121759668 14:96434588-96434610 GTGAACACAGGCAGTAACCAGGG - Intronic
1121955493 14:98209156-98209178 GGCATCAAACGCAGTACCCAGGG - Intergenic
1128578403 15:68791689-68791711 GGGAGGAAATGCAGAAACAGTGG - Intronic
1128939957 15:71779819-71779841 GGGAGAAAGTGCATAAACCAGGG + Exonic
1132327615 15:100984913-100984935 GGGAGAACATGCAGTCACCCAGG + Intronic
1132886192 16:2183271-2183293 GTGAGCAAAGGCCGTAAGCATGG + Intronic
1135721433 16:24821624-24821646 GGGAGCCCCTGCAGTAACCCCGG + Intronic
1137779003 16:51081211-51081233 GCTAGCAAATGAAGAAACCAAGG + Intergenic
1139696713 16:68680321-68680343 GGCAGCAAATCCAGTATCCATGG - Intronic
1139980811 16:70857383-70857405 GGGGGCAAATGCAGGAAGGATGG + Intronic
1143470908 17:7174486-7174508 GGGAGGAGATGCGGAAACCACGG + Intronic
1143574411 17:7782060-7782082 GGGAGTAAAAGCAGGAACCCTGG + Intronic
1146712690 17:35056280-35056302 GGGGGCAAAAGAAGGAACCAGGG - Intronic
1147208708 17:38858022-38858044 GGAAGCTATTGCAGTAACCCAGG + Intergenic
1148664864 17:49366879-49366901 GTGAGGAAATGCAGTGAGCAGGG - Intergenic
1150799892 17:68272676-68272698 GGAAGCAACTGCAGTGACTATGG + Exonic
1151604834 17:75129768-75129790 GGGAGAAGATGCAGTTACCAGGG - Exonic
1151886753 17:76927120-76927142 GGGAACAGATGCAGTAAAGAGGG + Intronic
1152993895 18:388433-388455 GTGAGCATGTGCAGTAACCATGG - Intronic
1153598294 18:6751714-6751736 GGGAGCAACTGCTGTTGCCAGGG - Intronic
1153874608 18:9357927-9357949 GGGAACAAGTGAAGAAACCATGG + Intronic
1159807511 18:72974103-72974125 GAGAGCAATTGCAGTAACTCAGG - Intergenic
1160625395 18:80201033-80201055 GTGAGCAAATGCTGTGACCTGGG + Intronic
1162172753 19:8804350-8804372 GGGAGCAATTGAAGAAACCGAGG + Intergenic
1162301009 19:9845000-9845022 GGTAGTAAATGCAGCACCCAGGG + Intronic
1165948685 19:39460298-39460320 GGCAGCAAATGCTGCATCCAAGG + Intronic
931244880 2:60484186-60484208 GTCAGAAAATGCAGTCACCACGG + Intronic
931392612 2:61857220-61857242 GGAAGAAAATGAAGTAACTAAGG + Intergenic
931433791 2:62230524-62230546 GGCAACAGATGCCGTAACCACGG - Intergenic
931692643 2:64848223-64848245 GGGAGCAAGCGCATTAACAAAGG + Intergenic
932504419 2:72214953-72214975 GGGAGGAAATGCAGCAAAGAGGG + Intronic
934913112 2:98276968-98276990 GGCAGCAAATGCTGTGTCCAGGG + Intronic
936501785 2:113072485-113072507 GGGAGCAAGTCCAGCCACCAGGG - Exonic
937362687 2:121239864-121239886 TGGAGCAAGTGAAGTACCCAAGG + Intronic
937583320 2:123515443-123515465 GGAAACTAATGCAGTCACCATGG + Intergenic
938627875 2:133131346-133131368 GGGAGGAAATGCAGTGATGAGGG - Intronic
939820619 2:146953101-146953123 TGGAGCAACTGCAGTGACCCAGG + Intergenic
941321099 2:164055710-164055732 TGCAGCAAATGCAGAAACCCTGG + Intergenic
942217212 2:173733181-173733203 GTAAGGAAATGCTGTAACCATGG - Intergenic
942915092 2:181295129-181295151 GGGAACATAGGCAGTAGCCAGGG + Intergenic
943760562 2:191603612-191603634 GAAAGAAAATGCAATAACCAAGG - Intergenic
944340211 2:198587238-198587260 GGCAGCACATGCAGTTATCATGG - Intergenic
944684679 2:202107686-202107708 GGGAGTAAATGCAGAAAGAAAGG + Intronic
947036004 2:225856667-225856689 GGGAAAAAATACAGTTACCAGGG + Intergenic
948937602 2:241177790-241177812 GTGACCAAAGGCAGTAGCCAGGG + Intronic
1169144013 20:3240756-3240778 GGGAGCAGGTGCAGAAGCCAAGG - Intergenic
1169686023 20:8272895-8272917 GGGAGCAAAAACACTAACGATGG - Intronic
1173083666 20:39893889-39893911 GGAAGAAAATCCAGTTACCAAGG - Intergenic
1177456417 21:21344777-21344799 GCGAGCATAGGCAGTAGCCAGGG + Intronic
1179802748 21:43819081-43819103 GGGAGCAAACTCACGAACCATGG - Intergenic
1180057803 21:45367889-45367911 GGGAGCAAACGCAGTGCACACGG + Intergenic
1181365793 22:22376140-22376162 GGGTGCTAAGGCAGAAACCAGGG - Intergenic
1183339453 22:37271822-37271844 GGGAGCAAAGGCAGAAGACAGGG - Intergenic
952849244 3:37714070-37714092 TGGAACAAATGCAGGAGCCATGG + Intronic
953078642 3:39594582-39594604 GGGAACAAATGCTGGAACCATGG + Intergenic
955339788 3:58116463-58116485 GGGAGCAAAACCAGCAATCAGGG - Intronic
955503071 3:59604368-59604390 GGTAGAAAATGCAGTTGCCAAGG + Intergenic
956438410 3:69256782-69256804 GGGTGCAAATGTAGTAGCTATGG - Intronic
956744438 3:72300359-72300381 AGGAGCAAAGGCAGGAACCCAGG + Intergenic
958669048 3:97179889-97179911 GTGAACACATGCAGTAGCCAAGG - Intronic
959568435 3:107856659-107856681 GGGAGAAAATGCAATATCCCTGG + Intergenic
960244589 3:115386268-115386290 AGGAGCAAATGCAGGAACTGTGG - Intergenic
963274515 3:143316819-143316841 AGAATCAAATGCAGTAACCCTGG - Intronic
964256072 3:154775931-154775953 GGGAGCAAACACAGAAAGCAAGG - Intergenic
965134292 3:164741634-164741656 GGGACCAAATGCAGAAACAAGGG + Intergenic
966431250 3:179833132-179833154 GGAAGCAATTGCAGTAATCTGGG + Intronic
968074574 3:195809441-195809463 GGCAGGAAAAGCAGTCACCAAGG - Intronic
968780165 4:2574320-2574342 GTGAGCAAATGCAGCAGCCTTGG - Intronic
972237360 4:37149997-37150019 GTGAACATATGCAGTAGCCAGGG - Intergenic
972779364 4:42272772-42272794 AGGATCAAATGCAAAAACCAGGG + Intergenic
974578951 4:63769411-63769433 GAGATCAAAGGCAGGAACCATGG + Intergenic
975252811 4:72198764-72198786 GTGAGCATAGGCAGTAGCCAGGG + Intergenic
975984560 4:80190325-80190347 GGGAGGAAATGCAGTTCCCAAGG - Intronic
978318778 4:107470029-107470051 GGGAGCAGTTGAAGGAACCATGG + Intergenic
981331401 4:143514006-143514028 GGGAGCAACAGCAGCAACAAAGG + Exonic
982113258 4:152075392-152075414 AGGAGCAGATGCATTAACAAAGG + Intergenic
985034436 4:185824049-185824071 GGGAGCAAATGCAGTAACCATGG - Intronic
985486557 5:154964-154986 GGAAGCAGATCCAGTCACCATGG - Exonic
985769938 5:1802995-1803017 GGAAGCAAATTCAGGAATCATGG - Intronic
985921345 5:2978770-2978792 GGGACCAAAATCAGTAATCAAGG - Intergenic
986471880 5:8084028-8084050 AAGAGCAAATGCAGTGTCCATGG - Intergenic
986588755 5:9346595-9346617 GTGAGCAGATGCAGGAGCCAGGG - Intronic
987029181 5:13960217-13960239 TGGAGCAAATGCAAGAAGCAAGG + Intergenic
987162115 5:15155350-15155372 AGGAGCAAAACCAGTAACAAAGG + Intergenic
987283559 5:16435347-16435369 ATGAGCAAGTGCAGTAGCCATGG - Intergenic
990818387 5:59810588-59810610 GGGAGCAAATGCATGGTCCAAGG - Intronic
991663725 5:68975082-68975104 GTGAACATAGGCAGTAACCAGGG + Intergenic
993882823 5:93382800-93382822 GTTACCAAAGGCAGTAACCATGG - Intergenic
993891576 5:93481897-93481919 GGCAGCAAAAGCAGTATCCAGGG + Intergenic
994530057 5:100957345-100957367 GGGAACACAGGCAGTAGCCAGGG + Intergenic
998811625 5:145972379-145972401 GGGAGCAAGTGCAGAAGCAAAGG + Intronic
998890540 5:146741191-146741213 TGGAGCACATGCAGTAAGGAAGG + Intronic
999230859 5:150061041-150061063 GGGACCAAATGCAGAGACCCAGG + Intronic
999411288 5:151352062-151352084 AGCAGCAAATGCAGTATCCAAGG - Intergenic
999647939 5:153737820-153737842 GGGAGCAGCTGCATTAACCATGG - Intronic
999851264 5:155541913-155541935 GTGAGCAAGTGCAGGAGCCAGGG - Intergenic
1000310059 5:160033865-160033887 GGGAGGAAATACAGTTAGCAGGG - Intronic
1003300892 6:4882118-4882140 GGGAGCAAGCGCAGTACCCAGGG - Intronic
1004160872 6:13211773-13211795 GGGAGAAACTGCAGTAAGCCAGG - Intronic
1004886705 6:20058275-20058297 AGGAACAAATGCATTAATCATGG + Intergenic
1006975233 6:38094303-38094325 TGGATTAAATGCAGTACCCATGG - Intronic
1007739947 6:44004161-44004183 GGGAGCATGTGCAGCCACCACGG - Exonic
1008376207 6:50794974-50794996 GGGAGAAAATGGAGTCCCCATGG + Intergenic
1009623778 6:66109402-66109424 GGGAGAAAATACAGTATACAAGG - Intergenic
1010348926 6:74848329-74848351 GGGAGCTAATGCCGTACACACGG + Intergenic
1011565807 6:88670321-88670343 AGGAGCAAAGGCAGCAAGCAGGG - Intronic
1014118576 6:117695698-117695720 GGGACTAAATGCAGTCACAAAGG - Intronic
1019266797 7:121631-121653 GGGAGGAAATGCAGGAAGGAAGG + Intergenic
1021196643 7:17681336-17681358 GGGAGGAAATTCAGTAAACCTGG + Intergenic
1021488005 7:21187972-21187994 GGGAACAACTGCAGAAACTACGG + Intergenic
1022073786 7:26945326-26945348 GGTAGCAAATGCAGAAACCAAGG - Intronic
1022362481 7:29675389-29675411 AGGAACAAATGCAGGAACCAAGG - Intergenic
1022698918 7:32738404-32738426 AGGAACAAATGCAGGAACCAAGG + Intergenic
1022763485 7:33382497-33382519 GGGAGCAAATGTAATAATCTTGG + Intronic
1023523286 7:41071054-41071076 GAGAGTAATTGCAGTAAACAAGG + Intergenic
1024410933 7:49039847-49039869 GTGAACACAGGCAGTAACCAAGG + Intergenic
1026692528 7:72561930-72561952 GGGTGCAGAGGGAGTAACCAAGG - Intronic
1028902350 7:96115677-96115699 GGTAGCAAATGCACTTACTATGG + Intergenic
1030583517 7:111388686-111388708 GGAAGCAAAAGCAGAAACCCCGG + Intronic
1030622540 7:111806466-111806488 GGGAAATAATGCAGCAACCAAGG + Intronic
1032056944 7:128691248-128691270 TGGAGAACATGCAGGAACCAAGG - Intergenic
1034244633 7:149635126-149635148 GGGAGCAGGTGAAGAAACCAGGG - Intergenic
1034590908 7:152138158-152138180 GGAAGCAAATGCAGCAATTAAGG + Intronic
1035823017 8:2615423-2615445 GGGAGAAAGTGCAGTAAAAATGG + Intergenic
1039144234 8:34427853-34427875 GGGAGCTATTGCAGTAATCCAGG - Intergenic
1039380609 8:37081408-37081430 GAGAGAAGATGTAGTAACCAGGG + Intergenic
1039831584 8:41219547-41219569 GGGGGCAAATGCACAACCCAAGG - Intergenic
1040424964 8:47276533-47276555 GTGGACAAATACAGTAACCAAGG + Intronic
1040879306 8:52188337-52188359 GGGAGAAAATGCAGAAACAGTGG + Intronic
1041627774 8:60050274-60050296 GGGAGTAAATGCAGGTCCCATGG - Intergenic
1041693987 8:60716188-60716210 GGGAGCTACTGCAGTAACACCGG - Intronic
1044251619 8:90009238-90009260 GGGAGCAAAGGCCCTAAGCAGGG - Intronic
1045947000 8:107807692-107807714 GGGGTCAAATGAAGTACCCAAGG - Intergenic
1048510302 8:135055877-135055899 GGGGACAAATGCAGTTACGAAGG + Intergenic
1049435615 8:142584880-142584902 GGGAGAAAAAGATGTAACCAAGG + Intergenic
1052182795 9:25551021-25551043 GGCAGGAAATACAGTAGCCAAGG - Intergenic
1056575461 9:87853063-87853085 GGGAGCAAATGGAATTAACAAGG + Intergenic
1062375258 9:136259163-136259185 GGGACCCACTGCAGGAACCAAGG + Intergenic
1187139347 X:16577572-16577594 GGAAGCAAACACAGAAACCAAGG - Intergenic
1191801017 X:65079374-65079396 GTGAACAGAGGCAGTAACCAAGG + Intergenic
1192588476 X:72339781-72339803 GGGAACAATTGCAGTACCAAGGG + Intronic
1193664689 X:84300731-84300753 GGGAACATAGGCAGTAGCCAGGG + Intergenic
1195722399 X:107879024-107879046 GTGAGCAGGTGCAGGAACCAGGG + Intronic
1196290557 X:113935866-113935888 GGGATCAAATGCAATAAATAGGG - Intergenic
1199032324 X:143014521-143014543 GCAAACAAAGGCAGTAACCAAGG + Intergenic
1199220034 X:145306873-145306895 GGCAGCAAAAGCAGGAACAAAGG + Intergenic
1200666600 Y:6033530-6033552 GGAAACATATGCAGTAACTAGGG - Intergenic
1201362496 Y:13168201-13168223 AGGAGCAAAGGCAGCAAGCAGGG + Intergenic