ID: 985041208

View in Genome Browser
Species Human (GRCh38)
Location 4:185893531-185893553
Sequence TCAAACCTTCAGAAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985041208_985041214 30 Left 985041208 4:185893531-185893553 CCCTCCAGCTTCTGAAGGTTTGA 0: 1
1: 0
2: 4
3: 25
4: 255
Right 985041214 4:185893584-185893606 AGACAGGTTAACAGCCAGAAGGG 0: 1
1: 0
2: 0
3: 19
4: 226
985041208_985041213 29 Left 985041208 4:185893531-185893553 CCCTCCAGCTTCTGAAGGTTTGA 0: 1
1: 0
2: 4
3: 25
4: 255
Right 985041213 4:185893583-185893605 TAGACAGGTTAACAGCCAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 201
985041208_985041212 14 Left 985041208 4:185893531-185893553 CCCTCCAGCTTCTGAAGGTTTGA 0: 1
1: 0
2: 4
3: 25
4: 255
Right 985041212 4:185893568-185893590 AAAACAAACTGACAATAGACAGG 0: 2
1: 1
2: 7
3: 52
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985041208 Original CRISPR TCAAACCTTCAGAAGCTGGA GGG (reversed) Intronic
902387790 1:16085681-16085703 TCAAGCCTTCTGATCCTGGAGGG + Intergenic
903500572 1:23798111-23798133 TCTCACCTCCAGAAGCTGGATGG + Exonic
905838548 1:41152412-41152434 TCAAACTTTTAGAGGCTGTAAGG - Intronic
906485970 1:46235265-46235287 TTCTACCTTAAGAAGCTGGAGGG - Intergenic
907595100 1:55712518-55712540 GTAAACATTCAGAAGCTGGGTGG - Intergenic
907688843 1:56642509-56642531 CCAAAGTTTCAGAAGCAGGAGGG + Intronic
908950265 1:69552725-69552747 TCACCCATTCAGAAGCTGGTAGG + Intergenic
909151614 1:72012929-72012951 GCAAACCTTCAGAAGCTAAAGGG - Intronic
909973987 1:82023771-82023793 TCCAGCCATCAGAAGCTGGAAGG + Intergenic
910581012 1:88824723-88824745 TTCAACTTTAAGAAGCTGGAAGG - Intronic
912049945 1:105516370-105516392 TTAAAACTTCAAAATCTGGAAGG - Intergenic
912524508 1:110271171-110271193 TTAAACCTTCAGAGGTGGGAAGG + Intronic
916008785 1:160685733-160685755 GCAAACCTTCAGAAGGTGAAGGG - Intronic
917747736 1:178027078-178027100 TGAAACCTTGAGAAGCTGGCAGG - Intergenic
918618969 1:186580719-186580741 TCAAACCTTCATCATCTGAATGG + Intergenic
919282020 1:195502704-195502726 TCAAAGCTTCAAAAGATAGATGG - Intergenic
921851739 1:219939203-219939225 TAAATCTTTCAGAAGCAGGAAGG + Intronic
922700236 1:227755061-227755083 TCCAACCTTCAGGAGGAGGAGGG - Intronic
923522773 1:234748767-234748789 TCAAGCGTTCACAAGCTGGTTGG + Intergenic
924091509 1:240506725-240506747 TCAAACCTTAGGAAGGTGCATGG - Intronic
1062944133 10:1447504-1447526 TCAAAAATGCAGAAGCTGTATGG - Intronic
1063309724 10:4940827-4940849 TCAAAACTTCAGAAGAGAGAGGG - Intronic
1063317566 10:5021275-5021297 TCAAAACTTCAGAAGAGAGAGGG + Intronic
1065847505 10:29758146-29758168 TCTGCCCTTCAGAAGCTGGAAGG - Intergenic
1066147289 10:32574467-32574489 CCAAACCTTCAGAGAGTGGATGG + Exonic
1067004458 10:42647723-42647745 TGAAAGTTGCAGAAGCTGGAGGG + Intergenic
1067134276 10:43594473-43594495 TGAAAGCTTCAGAAACTGGGAGG - Intergenic
1067782514 10:49219115-49219137 TAAAACCTTCAGAAGATGAGTGG - Intergenic
1068877587 10:62013271-62013293 TCAGACCTTCAGAATTTGAATGG + Intronic
1073445435 10:103577557-103577579 TCACATCTAGAGAAGCTGGAAGG - Intronic
1073989748 10:109249007-109249029 TCAAACTGTCTGAAGCTGGATGG + Intergenic
1074842845 10:117373223-117373245 TTAAGCCATCAGATGCTGGAAGG + Intronic
1075303355 10:121345182-121345204 TTAAATCATCAGATGCTGGAGGG + Intergenic
1075864881 10:125709223-125709245 GCAAACCTTCAGAGGGTGAAAGG + Intergenic
1076192209 10:128490793-128490815 TGCCACCATCAGAAGCTGGAAGG - Intergenic
1077549476 11:3193679-3193701 ACAGCCCTTCAGAAGTTGGAGGG - Intergenic
1077937082 11:6799756-6799778 TCAAAGCATCAGAAGGAGGAGGG - Intergenic
1079561058 11:21820180-21820202 TCAAACTTTCTGCAGCTGGGAGG + Intergenic
1079676286 11:23231016-23231038 TCAAACCTTCAGAAGGCAAAGGG - Intergenic
1080425504 11:32150504-32150526 CCAAACCTTCAGAGGGTGAAGGG + Intergenic
1081182921 11:40006244-40006266 TCAACCCCCCAGAATCTGGAGGG - Intergenic
1081402325 11:42657632-42657654 TCTCACCTTCTGAAGCTGAAAGG - Intergenic
1082846730 11:57732199-57732221 GCAAAACTTTAGAAGGTGGAGGG + Intronic
1083511114 11:63210192-63210214 TGAAACCTTCAGAAGCCGGAAGG + Intronic
1084392150 11:68884460-68884482 GCAAATCTTCAGAGGGTGGAAGG - Intergenic
1086508716 11:87532116-87532138 GCAAACCTTCAGATGGTGAAGGG + Intergenic
1086859021 11:91902299-91902321 TGAAACCTTAAGAAGCTATAAGG + Intergenic
1087946471 11:104165545-104165567 CCAGACTTTCAGGAGCTGGAAGG - Intergenic
1088735617 11:112725504-112725526 TTAGACCTTCAGAAGCTTGTGGG + Intergenic
1089598153 11:119595526-119595548 TCAAAACTCCAGAAGTTCGAGGG - Intergenic
1089691216 11:120187796-120187818 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1089725669 11:120477204-120477226 TCCAACTTTCTGAAGCTGGCAGG + Exonic
1090781145 11:130007785-130007807 GGCAACCTCCAGAAGCTGGAAGG + Intergenic
1091100153 11:132864330-132864352 GCAAACCTTCAGAAGGTGAAGGG + Intronic
1091570508 12:1681345-1681367 TCGAACCTTCAGAGCCTGGCTGG - Intergenic
1092275918 12:7060861-7060883 TTTTACCTTCAGAAGCTGGTAGG - Intronic
1094685395 12:32708087-32708109 TCAAAAGTTCTTAAGCTGGAGGG - Intronic
1094809674 12:34125042-34125064 CAAAAGCTTCAGAAGCTAGAAGG - Intergenic
1097551787 12:61080648-61080670 TCAAAGCTTTAGAAAATGGAAGG + Intergenic
1098435538 12:70464729-70464751 GTGAACCTTCAGAAGATGGAGGG - Intergenic
1099801332 12:87460447-87460469 TCAAATCTTCAGAGGGTGAAAGG - Intergenic
1100376421 12:94020048-94020070 TAACCCCTGCAGAAGCTGGATGG + Intergenic
1100779528 12:98009254-98009276 TCCATCCTTCACAATCTGGAGGG - Intergenic
1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG + Intronic
1103884386 12:124189775-124189797 TGGAACCTTTAGAAGCTGGAAGG - Intronic
1107322953 13:39209033-39209055 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1107839677 13:44443390-44443412 TCAGACATACAAAAGCTGGAAGG + Intronic
1108114143 13:47109388-47109410 TGAAAGCTTCAGAAGTTAGAAGG - Intergenic
1108810538 13:54218765-54218787 ACAAACCTTCAGAGGGTGAAGGG - Intergenic
1109287579 13:60428437-60428459 GCAAACCTTCAGAGGCAGAAGGG - Intronic
1110185707 13:72672514-72672536 TCAAGCCATCAGAAACTAGACGG + Intergenic
1110745310 13:79046377-79046399 TCTGACCTTCGGAAGCTGAATGG - Intergenic
1110926324 13:81157982-81158004 CTAAACATCCAGAAGCTGGATGG + Intergenic
1110927388 13:81171639-81171661 TTAAACCCTCAGAAGCATGAGGG + Intergenic
1112058134 13:95709933-95709955 TCAAAAAGTCAGAAGCTGGCCGG - Intronic
1112697890 13:101971066-101971088 TCGAACCTTCAGAGGATGGGTGG + Intronic
1112846857 13:103654218-103654240 TCAAACTCTTTGAAGCTGGAAGG + Intergenic
1113720353 13:112551525-112551547 TCACTCCTTCAGCAACTGGATGG + Intronic
1114017393 14:18443519-18443541 ACAAACCTTCAGACACTCGAAGG + Intergenic
1114027089 14:18537749-18537771 ACAAACATTCAGAACCTCGAAGG - Intergenic
1115721673 14:36168463-36168485 TCCAACCTTAACTAGCTGGAAGG - Intergenic
1116244015 14:42384892-42384914 TCAAAACTTCAGAAGTGGGAGGG + Intergenic
1116958458 14:50946382-50946404 TCCAAACTTCAGAATCTGGGAGG - Intergenic
1117043763 14:51791814-51791836 TCCAACCTTGAGAAGCTGTGGGG + Intergenic
1118613127 14:67556826-67556848 TCAACCCTTCTGCAGCTAGATGG - Intronic
1118973040 14:70653549-70653571 CCAAATCCTGAGAAGCTGGAAGG - Intronic
1119080572 14:71689771-71689793 TTAACTCTTAAGAAGCTGGATGG + Intronic
1120611549 14:86647133-86647155 TCTAAAATTCAGAATCTGGATGG + Intergenic
1120994570 14:90406976-90406998 TCAAGTCTTTAGAAGCTGGGTGG + Exonic
1121716086 14:96077029-96077051 GCAAACCTTCACAAGCTTAAAGG - Intronic
1202847838 14_GL000009v2_random:197692-197714 TCACACCTTCAGAGGGTAGAGGG - Intergenic
1202917314 14_GL000194v1_random:188231-188253 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1123454703 15:20410298-20410320 TCCATCCTTCAGAAGGTGAAAGG - Intergenic
1124143033 15:27094219-27094241 TCAAGCCTTCAGAGGCTGCAGGG + Intronic
1124171848 15:27381330-27381352 TCATGCCTTCAGAAGGAGGAGGG - Intronic
1127145495 15:56018986-56019008 TCAAACCTTCAGAAAGTAGGGGG + Intergenic
1127211398 15:56778386-56778408 GCAAACCTTCAGAGGGTGGAAGG - Intronic
1127505797 15:59596587-59596609 GCAAACCTTTAGTAGGTGGAAGG - Intronic
1128498726 15:68212367-68212389 TCAAATCTCCAGAAGTAGGAGGG - Intronic
1129148042 15:73667614-73667636 CAAAAACTTTAGAAGCTGGAAGG - Intergenic
1130624221 15:85496862-85496884 TAAAACCATCAAAAGCTAGACGG - Intronic
1130965797 15:88696551-88696573 TCACACCTCCTGAAGGTGGATGG - Intergenic
1132297519 15:100751815-100751837 TTAATCCTTCATAAGGTGGATGG - Intergenic
1133480113 16:6161917-6161939 ATAAACCTTCAGAAACTGCAGGG + Intronic
1133978952 16:10619493-10619515 TCAATCCCGCAGAAGCTGGTGGG + Intergenic
1134106202 16:11487256-11487278 TCTAACCTCCAGAAGGTTGAAGG + Exonic
1134369477 16:13609677-13609699 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1135846858 16:25926793-25926815 GCAAACCATCAGTGGCTGGAAGG - Intronic
1135927007 16:26704031-26704053 TCTTACCTTAAGAAGCTGGAAGG + Intergenic
1137960415 16:52876772-52876794 TCAAACCCTCAGAAGGTAAAGGG - Intergenic
1141888003 16:86906119-86906141 CCAAACCTTCAGAGAGTGGATGG - Intergenic
1145013951 17:19384981-19385003 TCAACCCTTCTGGATCTGGAAGG - Intronic
1145280592 17:21464321-21464343 TGAAACCTCCAGGAGCAGGAAGG + Intergenic
1145397305 17:22506194-22506216 TGAAACCTACAGGAGCAGGAAGG - Intergenic
1146892818 17:36517671-36517693 GCATACCTTAAGAAGCTAGAGGG - Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1152903487 17:82958179-82958201 TCAAAGCCCCAGGAGCTGGACGG + Intronic
1153321191 18:3775696-3775718 GCAAACCTTCAGAGGGTGAAGGG + Intronic
1154109147 18:11551036-11551058 TGGAAACTTCAGAAACTGGAAGG - Intergenic
1154109376 18:11552605-11552627 ACCAACCTTCAGAAGGAGGAAGG - Intergenic
1155638606 18:27985106-27985128 GCAAACCTTCACACGCAGGATGG + Exonic
1156411589 18:36833367-36833389 TCATACCTGCAGAAGCTATAAGG + Intronic
1156867860 18:41908674-41908696 TCATCCCATCAGAAGGTGGAGGG - Intergenic
1157582246 18:48780476-48780498 TCAAAACTGCAAAGGCTGGAGGG + Intronic
1157634760 18:49141063-49141085 TCCAACCTTCAGAAGCTGGGTGG - Intronic
1159254370 18:65926907-65926929 TCTAACCTACAGAAGCTGTGAGG + Intergenic
1160254682 18:77238425-77238447 GCAAACATTCACAAGCTGAATGG + Intergenic
1160593552 18:79958756-79958778 TCACACCTACAAAAGCTGCATGG + Intergenic
1164011165 19:21204508-21204530 CAAAAGCTTCAGCAGCTGGAAGG - Intergenic
1164015852 19:21255442-21255464 CAAAAGCTTCAGAGGCTGGAAGG + Intronic
1166458801 19:42968054-42968076 GCAAACCTTCAGAGGGTGAAGGG - Intronic
1166475748 19:43123325-43123347 GCAAACCTTCAGAGGGTGAAGGG - Intronic
1167260245 19:48454144-48454166 TGAAGCCTTCATAAGCTGGTGGG - Exonic
1202675183 1_KI270710v1_random:37835-37857 TCACACCTTCAGAGGGTAGAGGG - Intergenic
926480634 2:13389303-13389325 TCCATCCTTCAGAAGGTGAAAGG + Intergenic
926846022 2:17140156-17140178 TCAAACCTTCAGATGGTAGAGGG - Intergenic
927725323 2:25417785-25417807 TGAGACCATCAGGAGCTGGAAGG + Intronic
930409170 2:51001791-51001813 TGAAAACTGCAGAAGCAGGAAGG + Intronic
931986823 2:67750280-67750302 GCAAACCCCCAGAAGCTAGAAGG - Intergenic
932820573 2:74896246-74896268 GAAAACCTTCAGAGGGTGGAGGG + Intergenic
933071547 2:77864737-77864759 TCAAACCTTCAGAGGGTGGAAGG + Intergenic
935263296 2:101373583-101373605 TAAAACATTGATAAGCTGGATGG + Intronic
939134401 2:138276300-138276322 TCAAACCTTCAGAAAAGGGAGGG - Intergenic
942496892 2:176549359-176549381 TAAAACCAGCAGAAGCTGGTGGG - Intergenic
942623740 2:177876844-177876866 GCAAACCTTCAGAGGGTAGAAGG - Intronic
943211269 2:184969885-184969907 GCAAACCTTCAGAAGGCGAAGGG + Intergenic
943416615 2:187614711-187614733 GCCAACGTTCAGAAGCTGAAAGG + Intergenic
943995773 2:194763595-194763617 TCAAACCTTCAGACAATAGAGGG + Intergenic
944469898 2:200041748-200041770 TCACACAATCAGAAGCTGGCAGG - Intergenic
944959734 2:204857824-204857846 AGAAAACTTCAGAAGCAGGAAGG - Intronic
946033726 2:216725277-216725299 TCCAACCTGCAGAGGGTGGAGGG + Intergenic
946162670 2:217845706-217845728 TCAAGCCTTCGAAAGCTGGTAGG + Intronic
947986967 2:234456516-234456538 TCACACCTTCAGAGAGTGGAAGG - Intergenic
948138451 2:235655197-235655219 TTAAATGTACAGAAGCTGGAAGG + Intronic
948556936 2:238818517-238818539 GAAAACCTCCAGAAGCTGAAAGG - Intergenic
1169779929 20:9298045-9298067 AGAAAACTGCAGAAGCTGGAAGG + Intronic
1169889319 20:10435315-10435337 GCCAACCTTCAGAAGCTTAAGGG - Exonic
1171562172 20:26135651-26135673 TCCAACCTCCAGCAGGTGGAAGG + Intergenic
1172047669 20:32092091-32092113 TCAGACCTTGAGAAGCCGGCCGG + Intronic
1173789419 20:45818062-45818084 GGAGACCTTCAGAACCTGGAGGG - Intergenic
1175683857 20:61012056-61012078 TCAGACCTTCAGTAGCTTGCAGG - Intergenic
1176636762 21:9252333-9252355 TCATACCTTCAGAGGGTAGAGGG + Intergenic
1176955596 21:15099474-15099496 TCAACCCTTCTGAAGATAGATGG - Intergenic
1177300125 21:19233251-19233273 TCAAAAGTTCAGAAGATGGGAGG - Intergenic
1180441897 22:15374388-15374410 ACAAACCTTCAGACACTCGAAGG + Intergenic
1180451223 22:15464944-15464966 ACAAACATTCAGAACCTCGAAGG - Intergenic
1182565194 22:31193280-31193302 CTAAAGCTTCAGAATCTGGATGG + Intronic
951957684 3:28275424-28275446 TGACACCTTCAGATGCAGGAGGG - Intronic
952059849 3:29494750-29494772 ACCAACCTTCAAAAGCAGGAAGG - Intronic
952568029 3:34681562-34681584 TGGAAGCTTCAGAAGTTGGAAGG + Intergenic
953708397 3:45248400-45248422 TCAAACCATCAGAACCTCGAAGG - Intergenic
955004330 3:54955020-54955042 GCAAACCTTCAGAGGGTGAAGGG - Intronic
955254849 3:57320620-57320642 TCACACCTGCAGAAACTGGAAGG + Intronic
955467009 3:59247804-59247826 TCATACCTTTAGGAGCTGGCTGG + Intergenic
955694794 3:61624950-61624972 TAATTCCTTCTGAAGCTGGAAGG + Intronic
957103998 3:75862932-75862954 TCATACCTTCAGAGGGTAGAGGG - Intergenic
961757420 3:129137525-129137547 ACAACCCTTTAGAAACTGGAAGG + Intronic
961825308 3:129596247-129596269 TCAAAGCATCCGAGGCTGGATGG + Intronic
962249253 3:133825193-133825215 TCATTCCTTCACAAGATGGAAGG - Exonic
962702123 3:138010163-138010185 TCACACCTTCGGCAGCAGGAGGG + Exonic
965415717 3:168389623-168389645 GCAAACCTTCAGAGGGTGAAAGG + Intergenic
965862653 3:173165754-173165776 TGAATCCTTCAGGAGCTGAAGGG + Intergenic
966058909 3:175732174-175732196 GCAAACCTTCAGAGAGTGGAGGG - Intronic
966394693 3:179490566-179490588 TAAAATCTTGAGAACCTGGAGGG + Intergenic
966661704 3:182421798-182421820 TCAAGCCTTCAGACTCTGAATGG + Intergenic
967593395 3:191303324-191303346 TCAAACTTTCAGAGGGTGGAAGG + Intronic
968348996 3:198036643-198036665 TAAACCCTTTAGAAGCAGGAGGG + Intronic
1202750133 3_GL000221v1_random:152686-152708 TCATACCTTCAGAGGGTAGAGGG - Intergenic
968796546 4:2709788-2709810 TCAAACCTTTAAAGCCTGGATGG - Intronic
968867249 4:3221167-3221189 TCAAATCTGCAGAAGCCCGAGGG - Intronic
969965702 4:10993236-10993258 GCAGAGCTCCAGAAGCTGGAGGG + Intergenic
971400441 4:26270734-26270756 TCAAACCTTCAGAGGGTAGAGGG - Intronic
973130805 4:46646489-46646511 TAAATCCTTCAGAAACTGGCAGG - Intergenic
974920200 4:68229779-68229801 TTAAATGTTCAGAAACTGGATGG - Intronic
977173678 4:93793765-93793787 TCAAAGCTTCAGAAGCACCAAGG + Intergenic
977375943 4:96203988-96204010 TGAAAATTTCAGAATCTGGAAGG + Intergenic
978385171 4:108170877-108170899 TCAAACCCTCAGGAGGGGGAGGG + Intergenic
979831491 4:125310900-125310922 GCAAACTTTCAGAAGTAGGAGGG - Intergenic
980970245 4:139560560-139560582 TGACAACTGCAGAAGCTGGAGGG + Intronic
982651505 4:158093270-158093292 TCAATCTTTCAGAATCTGTATGG + Intergenic
985041208 4:185893531-185893553 TCAAACCTTCAGAAGCTGGAGGG - Intronic
985220961 4:187705071-187705093 GCAAACCTTCAGATGGTGAAGGG - Intergenic
985382092 4:189405315-189405337 TCAAACCTTCAAAAGGTTTATGG - Intergenic
1202751650 4_GL000008v2_random:10775-10797 TCATACCTTCAGAGGGTAGAGGG + Intergenic
985990469 5:3555488-3555510 TAAAACCTTCAGAATCAGGTTGG - Intergenic
987274201 5:16344800-16344822 TCAAACCTTCAGAAGATAGAAGG + Intergenic
987739744 5:21891846-21891868 TCAAAACTTCAAAAGAAGGAAGG + Intronic
988807771 5:34756368-34756390 TCATCCCTTCAGAGGCTGCAAGG + Intronic
989148662 5:38274935-38274957 TCAAACATTCAAAATGTGGAGGG + Intronic
989588556 5:43092692-43092714 TCAAACCTTCAGAGGAGGAAGGG - Intronic
989955178 5:50350625-50350647 CCAAACCTTCAAAAACTAGATGG - Intergenic
990495887 5:56347398-56347420 GCAAACCTTCAGAGGGTAGAAGG + Intergenic
991078628 5:62570095-62570117 TTAATCCAGCAGAAGCTGGAGGG + Intronic
991382156 5:66040817-66040839 TCCCACCTTCAGAATCTTGAAGG - Intronic
991658419 5:68926453-68926475 ACTAAACTGCAGAAGCTGGAGGG - Intergenic
992661217 5:78962899-78962921 TCAAACAGGCAGAAACTGGAAGG + Intronic
993247454 5:85468746-85468768 GCAAATCTTCAGAAGGTGAAGGG - Intergenic
993962669 5:94319287-94319309 TCCAACATTTAGAAGTTGGAAGG - Intronic
994077504 5:95669916-95669938 TCATTCCTGCAGAACCTGGAGGG + Intronic
994677926 5:102848394-102848416 TTAACCCTTCAGCAGATGGATGG + Intronic
996438349 5:123460701-123460723 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
997721489 5:136081255-136081277 TGAAAGATTCAGGAGCTGGATGG + Intergenic
997897517 5:137733127-137733149 TCCAACCTCCAGAGACTGGAGGG - Intronic
999668757 5:153939908-153939930 TCAAAACTTCCAGAGCTGGAGGG - Intergenic
1000888084 5:166770952-166770974 TCAAAGCCCCAGAATCTGGATGG - Intergenic
1002907855 6:1465419-1465441 GCAAACCTTCAGAGGATGAAGGG - Intergenic
1002972976 6:2043380-2043402 CAACACCTTCATAAGCTGGATGG + Intronic
1003969752 6:11287827-11287849 TTCAACTTCCAGAAGCTGGAAGG - Intronic
1004151541 6:13124682-13124704 TCACAGCTTTAGAGGCTGGAAGG + Intronic
1004483334 6:16041386-16041408 TCAAACCTTCAGACGACTGAAGG + Intergenic
1005248925 6:23921639-23921661 AAGAACCATCAGAAGCTGGAAGG + Intergenic
1005652605 6:27898266-27898288 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1007173963 6:39883823-39883845 TCAGACCTTCAGAAGGTAGTCGG - Intronic
1007361433 6:41359378-41359400 ACAAACCTTCAGATTCTAGAAGG + Intergenic
1008413911 6:51217147-51217169 TCAGACCATAAGAACCTGGAGGG - Intergenic
1009765234 6:68065158-68065180 TTAAATTTTCAGAAGCAGGAGGG + Intergenic
1012324327 6:97896115-97896137 TTACACCTTTAGAAGCTGGAAGG - Intergenic
1013714703 6:112944983-112945005 TGACACCACCAGAAGCTGGAAGG + Intergenic
1017455233 6:154595408-154595430 TGAAACCTTCTGAAGCTCTAAGG + Intergenic
1017702759 6:157091489-157091511 TCAAACAAGCAGAATCTGGAAGG + Intronic
1020683975 7:11270743-11270765 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1022921050 7:35015138-35015160 TCAAACCTACAAAAGAAGGAAGG - Intronic
1023168686 7:37368963-37368985 GCAAACCTTCAGGAGATGAAGGG + Intronic
1026810245 7:73457858-73457880 TAACACACTCAGAAGCTGGAAGG + Intronic
1028478995 7:91283964-91283986 TCAAACCTTCCAAAGATGCATGG + Intergenic
1028906743 7:96163009-96163031 TGAAACCTTCACAAGGTGAAGGG + Intronic
1030145596 7:106351035-106351057 TCTAACTTTAAGAAGCTAGAGGG + Intergenic
1031346217 7:120670591-120670613 TCAGACCCTAGGAAGCTGGAGGG - Intronic
1031573373 7:123386291-123386313 TCATACATTGAGAAGCTGTAGGG - Intergenic
1031998739 7:128250460-128250482 TAAATCCTTGAGGAGCTGGAGGG + Intronic
1033363997 7:140657634-140657656 CGAAACCTTCAGAAACTGGAAGG + Intronic
1034100953 7:148450010-148450032 GCAAACCTTCAGAGGTTGAAGGG + Intergenic
1034496099 7:151423546-151423568 GCAAACCGCCAGAAGCTGGGAGG - Intergenic
1035175042 7:157044514-157044536 AGCAACCTCCAGAAGCTGGAGGG - Intergenic
1037059373 8:14487499-14487521 TCAAACTCTTAGAATCTGGAAGG - Intronic
1037917343 8:22780694-22780716 GCGGACCTTCAGCAGCTGGAAGG + Intronic
1038268298 8:26052894-26052916 TCAAAGATTCAGAAGGTTGAGGG - Intergenic
1038522840 8:28248019-28248041 ACAAACCTTAAGAAGGGGGAAGG + Intergenic
1039896722 8:41721716-41721738 TCACACTTCCAGAAGCTGGAGGG - Intronic
1041436085 8:57843336-57843358 TCCAACCTTCAGAAGGTAAAAGG - Intergenic
1042120058 8:65477599-65477621 TCAGACCTTCAGAAGTTTGGGGG + Intergenic
1042477334 8:69263516-69263538 TGAAAGCTTCACAAGATGGAGGG - Intergenic
1047209058 8:122826041-122826063 TCACACCTTCTGCAGCTGAAGGG + Intronic
1047958539 8:129994253-129994275 CCAAAACTCCAGAAGCTGGGGGG + Intronic
1055036453 9:71823449-71823471 TCAAACCTTGAGAAGGGGAAAGG + Intergenic
1203718775 Un_KI270742v1:182776-182798 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1203653003 Un_KI270751v1:146450-146472 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1185822248 X:3216831-3216853 TCAGACCTGGAGAAGATGGAAGG + Intergenic
1188023566 X:25185248-25185270 TCAAAGCATTAGAAGCAGGAAGG + Intergenic
1188480006 X:30627785-30627807 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1188727946 X:33607933-33607955 GCAAACCTCCAGAAGGTGAATGG - Intergenic
1188800232 X:34520922-34520944 TCTAAATTTCAGAAGATGGAAGG + Intergenic
1190167370 X:48084366-48084388 TCAACCCTTCAGAAGATCTAGGG + Intergenic
1191155168 X:57266034-57266056 TCAAACACTCTGAAGCTTGAAGG - Intergenic
1192231430 X:69267755-69267777 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1192239368 X:69317157-69317179 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1193907438 X:87260535-87260557 ATAAACCTTCATAACCTGGAGGG - Intergenic
1194757076 X:97749952-97749974 GCAAACTTTCAGAAGGTGAAGGG - Intergenic
1195704014 X:107725617-107725639 TCAAACCTTCAGGAGTGAGAGGG - Intronic
1195750926 X:108161613-108161635 TCAGACCTTCAAATCCTGGAGGG + Exonic
1196279367 X:113804760-113804782 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1196410002 X:115408372-115408394 TCAAAGATTCAGAATCTGGTAGG - Intergenic
1201277752 Y:12314455-12314477 TGAAAGCTTCAGAAGTTGGAAGG + Intergenic
1201357641 Y:13113762-13113784 TGAAAGCTTCAGAAGTTGGAAGG + Intergenic
1202052641 Y:20796981-20797003 TGAAAGCTTCAGAAGTTGGAAGG - Intergenic