ID: 985042751

View in Genome Browser
Species Human (GRCh38)
Location 4:185908042-185908064
Sequence TAGTGGTGAGGAGCTCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985042751_985042756 13 Left 985042751 4:185908042-185908064 CCATGCTGAGCTCCTCACCACTA 0: 1
1: 0
2: 0
3: 10
4: 208
Right 985042756 4:185908078-185908100 CCCAAAACAAGCGCATTCTCAGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985042751 Original CRISPR TAGTGGTGAGGAGCTCAGCA TGG (reversed) Intronic
901158217 1:7154888-7154910 GAGTGGGGAGGGGCTCTGCAGGG - Intronic
901511224 1:9718970-9718992 GAGTGGTGAGTGGCCCAGCAAGG - Intronic
903619472 1:24687434-24687456 TAGAGGAGAGGAGCTCAGGGTGG - Intergenic
903661943 1:24983810-24983832 CGGTGGTGAGGAGCACAGCAGGG + Intergenic
904113647 1:28146008-28146030 GGGTGGTGAGGAGATCAACAAGG + Intergenic
904530488 1:31165466-31165488 AAGTGGGGAGCAGCTGAGCAAGG + Intergenic
907498298 1:54860051-54860073 TAGGGGTGAGGGTCTCATCATGG - Intronic
908965011 1:69750248-69750270 TAGTGTTCAGTAGCACAGCAAGG + Intronic
909597371 1:77421779-77421801 TGATGGAGAGGAGTTCAGCAAGG - Intronic
910713825 1:90208839-90208861 TGGTGGGGAGGAGCTTAGAAGGG + Intergenic
915249128 1:154576173-154576195 TAGTGTTGAGGAGGGGAGCAAGG + Exonic
915589818 1:156864446-156864468 TGTGGGTGTGGAGCTCAGCATGG + Intronic
916187200 1:162145065-162145087 TATTGATCAGTAGCTCAGCAGGG - Intronic
916739812 1:167638129-167638151 TCGTGGTGGGCAGCCCAGCAGGG - Intronic
918103612 1:181397756-181397778 CAGGGCTGCGGAGCTCAGCAGGG - Intergenic
920508797 1:206535649-206535671 TAGTGTTGTCCAGCTCAGCATGG + Intronic
922194124 1:223345236-223345258 TAGTGGTGCGGACCTCTGAAGGG - Intronic
924796462 1:247296196-247296218 TAGTGATCATGAGCTCAACAGGG - Intergenic
924829931 1:247582743-247582765 TGGTGGGGAGAAGTTCAGCAGGG - Intergenic
1067969679 10:50955104-50955126 AAGTGGTGAGGAGGAGAGCATGG + Intergenic
1069389852 10:67922851-67922873 TTGTGGTGATGAATTCAGCAAGG - Exonic
1070704002 10:78624437-78624459 GAGGAGTGAGGAGCTCTGCAGGG + Intergenic
1072016252 10:91349696-91349718 GAATGGAGGGGAGCTCAGCATGG - Intergenic
1072531822 10:96326816-96326838 TATTGGTGAGGAGATGAGCCTGG - Intronic
1073325167 10:102640000-102640022 CACTGGTGAGGAGGTCAGAAAGG + Intergenic
1076116368 10:127904547-127904569 GAGTGGTGAGGTGTTCAGGAGGG + Intergenic
1076510926 10:131013052-131013074 GAGGGCTGAGGAGCCCAGCAGGG - Intergenic
1077703222 11:4460701-4460723 TAGTGGGGAGAAGGTCAGCAAGG + Intergenic
1078384346 11:10874671-10874693 AAGTGGGGAGGAGCTAAGCTAGG - Intergenic
1078668095 11:13342362-13342384 TTCTGGTGAGGAAATCAGCAGGG + Intronic
1078741971 11:14075298-14075320 CAGTGGTGAGGAGGGCAGGAAGG - Intronic
1079901083 11:26185702-26185724 GAGTGGTGAGTAGATCAGAATGG + Intergenic
1080307528 11:30852899-30852921 TAGTGGTGAGCAGGGCAGCCAGG + Intronic
1081394434 11:42568942-42568964 TAGTGGTGAATAGCACAGAATGG - Intergenic
1083607526 11:63987578-63987600 TTGTGCTGAAGAGCTCAGCCTGG + Intronic
1086566821 11:88236593-88236615 GAGTGGTCAGGAGATGAGCAGGG - Intergenic
1086860865 11:91923388-91923410 TAGTGGAGAGAAGCTGAGGATGG - Intergenic
1087838979 11:102903331-102903353 TAGTGGTTAAGAGCTCAGACAGG + Intergenic
1089413842 11:118270133-118270155 CAGTGGCGAGGGGCTAAGCATGG + Intergenic
1089689536 11:120178740-120178762 TAAGGGTGAAGAGATCAGCATGG - Intronic
1099006440 12:77240040-77240062 CAGTGGTGAAGAGCTCAGGCTGG + Intergenic
1099963173 12:89416397-89416419 TAATGGTGAAAAGTTCAGCAGGG + Intergenic
1100854634 12:98748288-98748310 TAAGGGTGAGGAGGTGAGCAGGG + Intronic
1103705247 12:122867816-122867838 TGGTGGTGGGGTGCGCAGCAGGG - Intronic
1103891231 12:124240587-124240609 GAGTGGGGAGGAGCCCAGGAAGG - Intronic
1104698222 12:130880522-130880544 TAGTGATGCGGAGCGCAGCCAGG + Intergenic
1104895388 12:132161308-132161330 GAGTGGGGAGGAGCTGAGCGAGG - Intergenic
1104895394 12:132161338-132161360 GAGTGGGGAGGAGCTGAGGAAGG - Intergenic
1105593743 13:21817182-21817204 TAGTGGAGACGAGGTTAGCAAGG - Intergenic
1105696829 13:22897594-22897616 CACTGGGGAGGAGCCCAGCAAGG - Intergenic
1106305316 13:28504336-28504358 TCTTGGTGAGGAGCTCATCTTGG + Intergenic
1106773715 13:32987634-32987656 TAGTTGTGCTGAGCTCAGCAAGG + Intergenic
1110213216 13:72997064-72997086 TAGTGGTCAGGAGATTAGAAGGG - Intronic
1111993544 13:95139947-95139969 TAGAGATCAGGAGGTCAGCATGG - Intronic
1116449515 14:45049127-45049149 TGGTGTTAAGGAGCTGAGCAAGG - Intronic
1118632165 14:67715502-67715524 CTGTGGTGAGGTGCTCAGGATGG - Intronic
1119102328 14:71891392-71891414 TGTTGGCGAGGAGCTCAGCTGGG + Intergenic
1119945552 14:78689914-78689936 TAGTGGGGAGGAGCGGAGGAGGG - Intronic
1120492082 14:85190866-85190888 CAGAGGTGAGGTGCTGAGCAAGG + Intergenic
1122869440 14:104629611-104629633 TAGTGGTGGGGTGCTAGGCATGG + Intergenic
1125553454 15:40565116-40565138 TGGTCGAGAGGAGCTCAGCGTGG + Intergenic
1127802109 15:62485727-62485749 AAGCGGTGAGGAGCTCAGAATGG - Intronic
1129773891 15:78221290-78221312 TGGTGGGGAGAAGATCAGCAAGG + Intronic
1129987978 15:79935474-79935496 AAGTGGGGAGAAGGTCAGCAGGG + Intergenic
1130234343 15:82120442-82120464 TAGTGGGGAGAAGGGCAGCATGG - Intergenic
1131668740 15:94597417-94597439 TATGGGTGAGGGTCTCAGCATGG + Intergenic
1131741673 15:95399521-95399543 TACTGGTGAGGAGCTTAGGCTGG + Intergenic
1132321850 15:100931123-100931145 TGGGGGTGATGAGCTCAGGAAGG - Intronic
1132371262 15:101301004-101301026 TAGTGGTGAGGGGCTTTGGATGG + Intronic
1133013482 16:2927968-2927990 TGGTGGGGAGAAGGTCAGCAGGG + Intronic
1133430039 16:5728767-5728789 CAGTGGCGAGTAGCTCATCAGGG - Intergenic
1133809858 16:9152953-9152975 TCGGGGTGAGGAGCTCACAAAGG + Intergenic
1135935607 16:26777289-26777311 TGGTGGTGAGGAGGAGAGCATGG - Intergenic
1136617689 16:31408635-31408657 TAGGGGCCAGGAGCACAGCAGGG + Intronic
1138561133 16:57801821-57801843 CAGTTGTGAGGGTCTCAGCAGGG - Intronic
1138600643 16:58051981-58052003 TAGTGAGGAGGAGCTCTGCTTGG + Intergenic
1139393868 16:66624222-66624244 TACAGGTGAAGAGCCCAGCATGG + Intronic
1140052071 16:71490093-71490115 TAGTGGTAAGGAGCACAGCCTGG + Intronic
1140199242 16:72881110-72881132 CAGTGAGGAGGAGCTGAGCATGG + Intronic
1140694556 16:77519489-77519511 TAGTAGGTAGGAGCTAAGCATGG + Intergenic
1141835707 16:86537970-86537992 TGATGGTGAGGAGCACAGGACGG + Intronic
1142208157 16:88793719-88793741 TACTGGGGCGGAGCTCAGCCCGG + Intergenic
1142208171 16:88793760-88793782 TACTGGGGCGGAGCTCAGCCCGG + Intergenic
1142208185 16:88793801-88793823 TACTGGGGCGGAGCTCAGCCCGG + Intergenic
1144955818 17:19018292-19018314 CAGGGGTGAGGTGCTCAGCCAGG + Intronic
1147488974 17:40846143-40846165 GAATGGTGTGGAGCTAAGCAAGG + Intergenic
1147994328 17:44352901-44352923 TGGTGATGGGGAGCTCAGAATGG - Exonic
1148735059 17:49860611-49860633 CAGTGGTGATGAGCTCAGACTGG - Intergenic
1150494877 17:65599797-65599819 CAGTGATGAGGCGCTCAGGAGGG - Intronic
1151160303 17:72159351-72159373 TGTTGTTGAGGAGGTCAGCAGGG - Intergenic
1151250732 17:72832415-72832437 CAGAGGCGATGAGCTCAGCATGG - Intronic
1152603961 17:81279450-81279472 CAGAGGTGGGGAGGTCAGCACGG + Intronic
1152662491 17:81549188-81549210 GAGAGGTGAGCAGCTCAGCTCGG - Exonic
1153127422 18:1811430-1811452 TAGTGGCCAGGAGTTCAGGAAGG - Intergenic
1153835856 18:8963116-8963138 CAGTGCTCAGGAGCTCAACAAGG + Intergenic
1159417687 18:68173857-68173879 CAGTGGTGAGGAGAACAACAAGG - Intergenic
1161088181 19:2344575-2344597 CAGAGGTGAGGAGTTCAGCCTGG - Exonic
1161586335 19:5107795-5107817 GAGTGCTGGGCAGCTCAGCAGGG - Intronic
1161975374 19:7605514-7605536 TTGAGGGGAGGAGCTGAGCATGG - Intronic
1162626662 19:11889851-11889873 TGGTGGGGAGAAGGTCAGCAGGG + Intronic
1163386123 19:17001601-17001623 TAGGGGTGAGGACACCAGCATGG + Intronic
1165155133 19:33782253-33782275 AAGGGGTGAGGAGCTCCCCAGGG + Intergenic
1167211465 19:48136463-48136485 TAATGGTCAGGACCCCAGCATGG + Intronic
1167272933 19:48516649-48516671 TGGGGGTGGGGAGCTGAGCAGGG + Intergenic
1167916014 19:52740675-52740697 TGGTGGGGAGAAGGTCAGCAGGG + Intergenic
1167939223 19:52932842-52932864 AAGTGGGGAGAAGGTCAGCAGGG + Intronic
1167991420 19:53364536-53364558 TGGTGGCGAGAAGGTCAGCAGGG - Intergenic
1168614878 19:57829698-57829720 TGGTGGGGAGAAGGTCAGCAGGG - Intronic
925482406 2:4290622-4290644 TACTGGTGGCGAGCTCAGTAAGG + Intergenic
927757262 2:25719072-25719094 TTGAGGTGAGGAGATCAGGATGG - Intergenic
930094873 2:47559327-47559349 TAGGAGTGGGGAGCCCAGCAGGG + Intronic
935486459 2:103661677-103661699 TAGTGTTCAGTAGCACAGCAGGG - Intergenic
936885502 2:117306321-117306343 TAGTGGTGGGGAGGTCGGAATGG + Intergenic
938323244 2:130379847-130379869 TGGTGGTGAGGAACTCAGTCAGG + Intergenic
939418984 2:141941552-141941574 TAGAGGTTAGCAGCTCAGCTTGG + Intronic
939696173 2:145327829-145327851 TTCTGGTGAGGACCTCAGGAAGG + Intergenic
940854278 2:158717586-158717608 CAGTGGGAAGGAGCACAGCATGG - Intergenic
944188593 2:196976955-196976977 TAGTGTTCACAAGCTCAGCAAGG + Intronic
944871125 2:203913085-203913107 CAGTGGTGAGGACCTCATCCAGG + Intergenic
945728526 2:213503817-213503839 AAGTGGTGAGGAGCTGAACCTGG - Intronic
946992522 2:225351281-225351303 TAGGGGTGTGGAGATCAGCCAGG + Intergenic
947738963 2:232476248-232476270 GAGAGGGGAGGAGCTCAGCAGGG + Intergenic
1169111336 20:3036160-3036182 TAGTGGGCAGGAGAGCAGCAGGG + Intronic
1169387733 20:5165465-5165487 CAGTGGTGAGGAAGTCAACATGG + Intronic
1169411435 20:5373860-5373882 TTCTGGGGAGGAGCTCTGCAGGG - Intergenic
1170582467 20:17709826-17709848 TCTTGGTGCGGAGCTTAGCACGG + Intronic
1171170871 20:23014400-23014422 TAAGGGTGAAGAGCTAAGCAAGG + Intergenic
1172303114 20:33863492-33863514 TGGGGGTGGGGAGCTCACCAGGG - Intergenic
1172374432 20:34425737-34425759 TGGTGGGGAGAAGGTCAGCAGGG - Intronic
1173009514 20:39169062-39169084 CAGTGTAGAGGAGCACAGCAAGG - Intergenic
1173304148 20:41831827-41831849 TAGAAGTGAGGAGATCAGCTGGG + Intergenic
1174252572 20:49230674-49230696 TAGTGTTGAGGAGCTGAGGAGGG + Intronic
1174467915 20:50731612-50731634 TGGTGGAGTGGAGCTCAGCGCGG + Exonic
1175469285 20:59215287-59215309 CAGTGAAGAGGAGCTGAGCATGG + Intronic
1175591086 20:60192831-60192853 CAGTGGTGAGGAGCAGAGCTGGG + Intergenic
1176348561 21:5771587-5771609 TCGCGGTTAGGAGCTCAGCCCGG + Intergenic
1176355375 21:5892171-5892193 TCGCGGTTAGGAGCTCAGCCCGG + Intergenic
1176496266 21:7552868-7552890 TCGCGGTTAGGAGCTCAGCCCGG - Intergenic
1176542882 21:8169657-8169679 TCGCGGTTAGGAGCTCAGCCCGG + Intergenic
1176561833 21:8352702-8352724 TCGCGGTTAGGAGCTCAGCCCGG + Intergenic
1179904633 21:44416058-44416080 TGGAGCTGAGGAGCCCAGCACGG + Intronic
1183727404 22:39597397-39597419 CAGTGGTGAGGAGAGCAGCCTGG + Intronic
1184748311 22:46469424-46469446 TGGGAGTGAGGGGCTCAGCATGG - Intronic
1184840348 22:47048811-47048833 TAGGGGTGAGGGGCCCTGCACGG + Intronic
1203247749 22_KI270733v1_random:85900-85922 TCGCGGTTAGGAGCTCAGCCCGG + Intergenic
950259423 3:11533198-11533220 TGGGGGTCAGCAGCTCAGCATGG - Intronic
953743749 3:45557604-45557626 AGGTGGTGAGGAGCTCATCTGGG + Intronic
953929344 3:46998228-46998250 TAGGTGTGAGGACCTGAGCAAGG + Intronic
955480871 3:59388447-59388469 TGGTGGTTAGGAGGTCAGCAGGG + Intergenic
960867228 3:122213978-122214000 AAGTGTTGAGGAGCTAAACATGG - Intronic
962267730 3:133955494-133955516 CACTGGTGGGGAGCTGAGCACGG + Intronic
962806103 3:138928891-138928913 TAGTGGAGACAAGCTCTGCATGG + Intergenic
962949679 3:140206330-140206352 TTGAGCTGAGGAGCTCTGCAGGG - Intronic
963432374 3:145224836-145224858 CAGTGATGATGAGCTAAGCAGGG + Intergenic
963755452 3:149231107-149231129 TAGAGATGAGGAGCTCAGGCTGG - Intergenic
965157191 3:165077279-165077301 GAGTGGTAAGGAACTCACCATGG - Intronic
965409560 3:168313161-168313183 TAGTGGTGAGGGGTGCACCAAGG + Intergenic
965783076 3:172308576-172308598 TAGTGGTTAGCAGCAAAGCATGG + Intronic
965939354 3:174158908-174158930 TAGTAGTAAGGAGCTTACCATGG - Intronic
967245398 3:187481519-187481541 TTGTGCTGAACAGCTCAGCAGGG + Intergenic
967690930 3:192472733-192472755 CAGGGCTGAGGAGCCCAGCAGGG - Intronic
967880848 3:194300275-194300297 AAGTGGTGAGGGCATCAGCATGG - Intergenic
968580187 4:1386256-1386278 TCGTGGTGTGGGGTTCAGCACGG + Exonic
970465911 4:16322915-16322937 CAATGGTGAGGCCCTCAGCAGGG + Intergenic
974382209 4:61155369-61155391 TAGTGGAAAGGAGCTCAATAAGG - Intergenic
975241390 4:72064213-72064235 TGTGGGTCAGGAGCTCAGCATGG + Intronic
976688290 4:87840141-87840163 TGATGGTGGGGATCTCAGCAGGG + Intronic
977293943 4:95191856-95191878 GAGTGGGGAGGAGGTGAGCATGG - Intronic
977925572 4:102696717-102696739 GAGCTGTGAGGAGCTCAGCAGGG - Intronic
983693185 4:170497465-170497487 TTCTGGTGAGGAGGTGAGCAGGG - Intergenic
985042751 4:185908042-185908064 TAGTGGTGAGGAGCTCAGCATGG - Intronic
986310207 5:6545662-6545684 GAGTGGTGAGCAGCTGAGCCTGG - Intergenic
986495528 5:8338249-8338271 TAGATGTGAGGACCTCAGGAGGG + Intergenic
986526867 5:8688446-8688468 TGGGGGTCAGGAGCTCAGCTGGG + Intergenic
987547885 5:19337885-19337907 TAGTGTTTAATAGCTCAGCAGGG - Intergenic
991162103 5:63515516-63515538 TAGTTGTAATGAGCTCAGAAAGG - Intergenic
993487630 5:88505938-88505960 TAATGATGAAGAGCTCAGGATGG - Intergenic
995005513 5:107189742-107189764 TTATGGTGAAGAGCTCAGAAAGG + Intergenic
995075760 5:107981165-107981187 GAGTGAGGAGGAGTTCAGCATGG + Intronic
997786425 5:136717969-136717991 AAGAGGTGAGGATCACAGCAAGG + Intergenic
999000595 5:147918472-147918494 TGGTGGTTAGGGGCTGAGCAGGG + Intergenic
1002461421 5:179375830-179375852 AAAGGGGGAGGAGCTCAGCAGGG + Intergenic
1004081011 6:12393242-12393264 CTGTGGAGAGCAGCTCAGCAAGG - Intergenic
1004250051 6:14016237-14016259 TCGTGGTGAGGTGGTCACCATGG + Intergenic
1006119661 6:31796056-31796078 TAGCGGGGAGGTGCCCAGCAGGG + Intergenic
1008854834 6:56071135-56071157 TAATGATGAGGATCTCAGCCCGG - Intronic
1009970600 6:70621662-70621684 TTGAGCTCAGGAGCTCAGCATGG - Intergenic
1011695580 6:89909664-89909686 TAGTGGTGTGGTGGTCAGTATGG + Intergenic
1019515519 7:1438261-1438283 TAGTGGTGGGGAGCCGGGCAGGG - Intronic
1020009069 7:4798706-4798728 TAGGGGAGAGGAACTCAGGAGGG + Intronic
1021995980 7:26178768-26178790 TTGTGGGCAGGACCTCAGCAGGG - Intronic
1024003944 7:45211764-45211786 GGGAGGTGAGGAGCTCAGAACGG - Intergenic
1025908571 7:65809297-65809319 CATTGGCAAGGAGCTCAGCATGG - Intergenic
1025993815 7:66515437-66515459 CAGTGGTGAGGAGATCCGCTGGG + Intergenic
1027203132 7:76075166-76075188 CATTGGCAAGGAGCTCAGCACGG + Intergenic
1027254688 7:76423704-76423726 TTGTGGTGAGGAGCTGGGCATGG + Intronic
1027932257 7:84552630-84552652 TTGTGGAGAGGAGCACACCAGGG + Intergenic
1029288906 7:99486645-99486667 TAGTGGTGATGAATACAGCAGGG + Exonic
1033038971 7:137901214-137901236 TTGTGCTGAGATGCTCAGCATGG - Intronic
1034250488 7:149686655-149686677 GGGAGGTGAGGAGCTCAGGAAGG + Intergenic
1035333906 7:158113564-158113586 TTGGGGAGAGGACCTCAGCAGGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1038406335 8:27325483-27325505 AAGTGGGGAGGAGAGCAGCAGGG + Intronic
1041421135 8:57667906-57667928 CAGTGGTGCAGTGCTCAGCATGG - Intergenic
1048414084 8:134207157-134207179 TATTGGTGGGAAGATCAGCAGGG + Intergenic
1048577753 8:135706358-135706380 TAGTGGTCAGGACATGAGCAAGG + Intergenic
1049517334 8:143067696-143067718 TGGTGGGGAGAAGGTCAGCAGGG + Intergenic
1052173256 9:25427421-25427443 TATTGGAGCTGAGCTCAGCAGGG + Intergenic
1056817297 9:89811344-89811366 CAGTGAGGAGGAGCTGAGCAGGG + Intergenic
1056912818 9:90718833-90718855 TAGGGGTGAGGAGCTGGCCATGG + Intergenic
1057502554 9:95607251-95607273 TCGTGGTGAGAAGCTGAGCCGGG - Intergenic
1059151872 9:111956370-111956392 AAGGGGTGAGGAGCTGGGCACGG - Intergenic
1061908782 9:133712082-133712104 TACTGGTGAGGCACCCAGCATGG - Intronic
1203464152 Un_GL000220v1:69135-69157 TCGCGGTTAGGAGCTCAGCCCGG + Intergenic
1186440617 X:9583108-9583130 CATTGTTGAGGAGGTCAGCAGGG + Intronic
1189559592 X:42178413-42178435 TACTGGCCAGGAGCTCAGCTGGG - Intergenic
1190388525 X:49909300-49909322 TAGTTGTGAGAAGCTAAGGATGG - Intergenic
1190755811 X:53400937-53400959 GAGTGGTGGAGAGGTCAGCAGGG - Intronic
1191660037 X:63640035-63640057 TAGTGTTCAGTAGCACAGCAGGG + Intronic