ID: 985043906

View in Genome Browser
Species Human (GRCh38)
Location 4:185920931-185920953
Sequence CAATAAGATGTCCCATCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985043906 Original CRISPR CAATAAGATGTCCCATCATG AGG Intronic
909025933 1:70482287-70482309 GACTAACATGTTCCATCATGTGG - Intergenic
910293683 1:85623177-85623199 CAAGAAGATGACGCATCAGGAGG + Intergenic
915023906 1:152808188-152808210 CAATATGATGTAACATCATGAGG + Intronic
920139788 1:203800794-203800816 CAATAAAATTTCCCATGGTGGGG - Exonic
1064493406 10:15883908-15883930 CCATAAAATGAACCATCATGGGG + Intergenic
1067147673 10:43705033-43705055 GAATAACATGGCCTATCATGAGG + Intergenic
1067819090 10:49510945-49510967 CAAAAAAATGACCCATAATGAGG + Intronic
1071321515 10:84464761-84464783 CAATAACATGTCCCACAATAGGG - Intronic
1072177210 10:92939113-92939135 CCACAAGATGTCCCATAATCTGG - Intronic
1074604517 10:114947715-114947737 CTATAAAATGTTCCATCATATGG + Intronic
1081355020 11:42102194-42102216 GAATAAGATTTCCCATCTTAAGG - Intergenic
1088227253 11:107634776-107634798 AAATAAGATGTCCCATGAGAGGG + Intronic
1092355736 12:7793762-7793784 CATTATGATGTCTCATTATGAGG - Intronic
1092608268 12:10144383-10144405 CAAAAATATGACCCATAATGGGG + Intergenic
1093498980 12:19788792-19788814 TTATATGATGTTCCATCATGTGG + Intergenic
1094563377 12:31577019-31577041 CAATAAGAGGTGGCATCATGAGG + Intronic
1095628402 12:44344896-44344918 CAATCAGATGTCCCAACAGAAGG - Intronic
1097629593 12:62043819-62043841 CCATAAAATGCCCCAGCATGTGG - Intronic
1098694317 12:73533154-73533176 CCATATGATGCCCTATCATGGGG + Intergenic
1098700081 12:73613210-73613232 CACTAAGATGTCTCATTACGTGG + Intergenic
1102918231 12:116771683-116771705 CAAATACATGTCCCATGATGTGG + Intronic
1104066459 12:125310904-125310926 AAATACGATGTCACATCAAGTGG + Intronic
1105996086 13:25673344-25673366 CAAGAAGATTACCCATGATGTGG + Intronic
1113365998 13:109676433-109676455 AAATAATCTGTCCCAACATGAGG - Intergenic
1119902146 14:78270294-78270316 AAATGAGATGTCCCATCATCTGG - Intronic
1119915451 14:78397117-78397139 CCATAGCATGTGCCATCATGTGG + Intronic
1120743260 14:88130943-88130965 TAATAAGTTGTCCCATCTTCAGG + Intergenic
1121916366 14:97839828-97839850 GAATAAGATGACCCATTAAGAGG + Intergenic
1122279488 14:100612889-100612911 CAATAATATGTCCGGGCATGGGG + Intergenic
1122391026 14:101384537-101384559 GAAAAACATGACCCATCATGAGG - Intergenic
1123842758 15:24265706-24265728 TAATAGGATGTCCCATGATGTGG + Intergenic
1126974178 15:54155906-54155928 CAGTAGTATGTCCGATCATGTGG + Intronic
1126988438 15:54342258-54342280 CAAAAAGATGTGTCATCAAGAGG - Intronic
1154314266 18:13291852-13291874 CAAGCAGAGGTCCCAGCATGGGG + Intronic
1159976999 18:74726283-74726305 TAATAAGATGATTCATCATGGGG - Intronic
1160115171 18:76072534-76072556 AAATAAGATATCACACCATGTGG + Intergenic
1162552528 19:11365531-11365553 CATACAGATGTGCCATCATGGGG + Exonic
1166394269 19:42427242-42427264 CAAGAGGAAGTGCCATCATGAGG - Exonic
926711619 2:15886817-15886839 CTCTAAGATTTCCCATCATGGGG - Intergenic
928245304 2:29621596-29621618 CACAAAGACGTCTCATCATGTGG + Intronic
929685828 2:44033371-44033393 CATTAAGTGGACCCATCATGTGG - Intergenic
937310258 2:120897909-120897931 TAATAAAATGTCCCTTCATGGGG - Intronic
939598027 2:144152081-144152103 CCAAAAGCTGTCTCATCATGTGG + Intronic
941574111 2:167209383-167209405 CAATAAGATGGTTCAACATGGGG + Intronic
942987976 2:182164528-182164550 GAATAAGATGACCCATTCTGTGG + Intronic
943444319 2:187965211-187965233 AAAAATGAAGTCCCATCATGTGG + Intergenic
944623924 2:201550109-201550131 CCATAAGCTGTTCCATCATTAGG + Intronic
945115305 2:206402548-206402570 CCAGAAGATGTCCCCTCCTGGGG + Intergenic
945149397 2:206772682-206772704 CAATCAGCTGTGCAATCATGAGG + Intronic
946939263 2:224754181-224754203 CAAACAGATGTCTCAACATGTGG + Intergenic
1169685566 20:8267390-8267412 CACAGAGATGTCCCATCTTGAGG - Intronic
1172440629 20:34963507-34963529 CAATAATTTGTCCCATTCTGTGG + Intergenic
1173241963 20:41304887-41304909 CAATAGGATGAATCATCATGGGG + Intronic
1179308243 21:40174337-40174359 CAATGAGATTTCCCAACATTAGG + Intronic
949345480 3:3072574-3072596 CATTAAGATGTTCCATTAAGAGG + Intronic
949638709 3:6012037-6012059 TAGTCAGATTTCCCATCATGTGG - Intergenic
950091728 3:10300458-10300480 CAGTTAGGTCTCCCATCATGGGG + Intronic
950239373 3:11354347-11354369 CAATAAGATGTCAGATTATGAGG + Intronic
955332436 3:58058542-58058564 CAATAAGATGTTCCTTAATGTGG + Intronic
962037682 3:131669999-131670021 CAATAATATTTTCCAGCATGTGG + Intronic
966267145 3:178060079-178060101 CATTAAGCTGACCCATCATACGG - Intergenic
966935623 3:184706841-184706863 CAATCAGATATCCCACAATGGGG + Intergenic
969179919 4:5432107-5432129 CAATAAGTTGTCTCATTATGGGG + Intronic
969983631 4:11184609-11184631 CAACATGAGGACCCATCATGAGG + Intergenic
974386878 4:61212031-61212053 CTATCAGATGTCACATCTTGGGG - Intronic
975314430 4:72934786-72934808 CAATAAGATGTCCAGATATGTGG + Intergenic
979388591 4:120099900-120099922 CAAGAAGATGGCCCATCTTCAGG - Intergenic
980000718 4:127484524-127484546 TAATAAAAAGTCCCATTATGAGG + Intergenic
980634516 4:135482758-135482780 CAATAGGAGGTCCCATTATATGG - Intergenic
981015229 4:139967543-139967565 AAATGAGATCTGCCATCATGAGG + Intronic
984498962 4:180533876-180533898 CAGAAAGAAGCCCCATCATGTGG - Intergenic
985043906 4:185920931-185920953 CAATAAGATGTCCCATCATGAGG + Intronic
987221737 5:15797470-15797492 CAATAGGATCTCCCATCTTCTGG + Intronic
991612607 5:68464817-68464839 CAACAGGAGGTACCATCATGGGG + Intergenic
995326483 5:110894589-110894611 AAATAAGATGTTCCAGCATAGGG + Intergenic
996908346 5:128628336-128628358 CCATAACTTTTCCCATCATGTGG - Intronic
999136382 5:149322662-149322684 CAGTGAGAAGTCCCATCGTGTGG + Exonic
1011583783 6:88902208-88902230 AAATAAAAGGTCTCATCATGGGG + Intronic
1012726600 6:102820414-102820436 CAATAAAATGTACCTTCCTGTGG - Intergenic
1015356919 6:132288191-132288213 CAATAAGATGGCCCATGAAAGGG + Intergenic
1016752371 6:147645156-147645178 CAGTAAGATGTCCTGTCGTGTGG - Intronic
1024182671 7:46911823-46911845 CAAGCAAATGTCCCATAATGGGG - Intergenic
1024211362 7:47208539-47208561 CAATAAAATTTACCATCATCAGG - Intergenic
1029925336 7:104310206-104310228 TAATAAAATGTCACATCATGGGG + Intergenic
1033865770 7:145688580-145688602 CCATAAGATGTTTGATCATGGGG - Intergenic
1034873906 7:154707880-154707902 CCATCAGATCTCCCAACATGTGG + Intronic
1040082727 8:43305026-43305048 CAACTAGATGTCCCATCTGGGGG + Intergenic
1041291617 8:56313608-56313630 TAATAATCTGTCCCATAATGTGG + Intronic
1042712637 8:71735207-71735229 CAATAAGAGGTACCAGCAGGAGG - Intergenic
1043860334 8:85308777-85308799 AAATATGCTCTCCCATCATGGGG - Intergenic
1045187428 8:99853338-99853360 GAATCTGATGTCCCATCAGGAGG + Intronic
1047516798 8:125562123-125562145 TAATAAGTTGTCCATTCATGGGG - Intergenic
1050610228 9:7344554-7344576 TCATAAAATGTCCCATCCTGTGG - Intergenic
1051126884 9:13814737-13814759 CAATAAGATGTCACTTCTTCAGG + Intergenic
1052296908 9:26907014-26907036 CAATAAAATGTCCCATATTATGG - Intronic
1057975104 9:99597299-99597321 CAATAAGAGGTGACATCAGGTGG + Intergenic
1060024036 9:120156004-120156026 GAATAAGAATTCCCACCATGAGG - Intergenic
1187611207 X:20945468-20945490 CAATAAGATCTCCCATTATGTGG - Intergenic
1188857948 X:35220902-35220924 CAACAAGATATCCTATTATGGGG - Intergenic
1190399169 X:50014460-50014482 CAATAAGAAGTCCCATGTTGTGG - Intronic
1191756128 X:64594421-64594443 CCAGAAAAGGTCCCATCATGTGG + Intergenic
1194971954 X:100353543-100353565 CCATAATATATCTCATCATGAGG + Intronic
1196903088 X:120405755-120405777 GAAAAACATGACCCATCATGAGG - Intergenic