ID: 985045524

View in Genome Browser
Species Human (GRCh38)
Location 4:185936811-185936833
Sequence GAGCAGAAGCTGAGTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 466}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985045524_985045532 25 Left 985045524 4:185936811-185936833 CCTCCCACACTCAGCTTCTGCTC 0: 1
1: 0
2: 3
3: 43
4: 466
Right 985045532 4:185936859-185936881 GGCACGGCACAGCATGGCACGGG 0: 1
1: 0
2: 1
3: 20
4: 175
985045524_985045529 9 Left 985045524 4:185936811-185936833 CCTCCCACACTCAGCTTCTGCTC 0: 1
1: 0
2: 3
3: 43
4: 466
Right 985045529 4:185936843-185936865 ACAGCACAGCATGCACGGCACGG 0: 1
1: 0
2: 0
3: 12
4: 138
985045524_985045531 24 Left 985045524 4:185936811-185936833 CCTCCCACACTCAGCTTCTGCTC 0: 1
1: 0
2: 3
3: 43
4: 466
Right 985045531 4:185936858-185936880 CGGCACGGCACAGCATGGCACGG 0: 1
1: 1
2: 3
3: 14
4: 139
985045524_985045527 4 Left 985045524 4:185936811-185936833 CCTCCCACACTCAGCTTCTGCTC 0: 1
1: 0
2: 3
3: 43
4: 466
Right 985045527 4:185936838-185936860 TACCAACAGCACAGCATGCACGG 0: 1
1: 0
2: 2
3: 16
4: 174
985045524_985045530 19 Left 985045524 4:185936811-185936833 CCTCCCACACTCAGCTTCTGCTC 0: 1
1: 0
2: 3
3: 43
4: 466
Right 985045530 4:185936853-185936875 ATGCACGGCACGGCACAGCATGG 0: 1
1: 0
2: 1
3: 12
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985045524 Original CRISPR GAGCAGAAGCTGAGTGTGGG AGG (reversed) Intronic
900404525 1:2486599-2486621 GAGCAGAGGCCATGTGTGGGTGG - Intronic
900430382 1:2598575-2598597 GAGCAGAAGCTGTGTTGGGGAGG + Intronic
901056798 1:6452082-6452104 GAGCAGAGGCGGAAGGTGGGTGG + Exonic
901225410 1:7610481-7610503 GAGGAGAAACTGAGGCTGGGGGG - Intronic
902449113 1:16485443-16485465 GGGCTGAACCTGAGTGTGAGTGG + Intergenic
902468505 1:16632149-16632171 GGGCTGAACCTGAGTGTGAGTGG + Intergenic
902505631 1:16937841-16937863 GGGCTGAACCTGAGTGTGAGTGG - Intronic
902549793 1:17212437-17212459 GGGCAGAAACTGAGTGGGTGGGG - Intronic
902653760 1:17853528-17853550 GAGCGGGAGCTGAGTGGGTGGGG + Intergenic
903471225 1:23588726-23588748 GAGCAGAGGCTGGGCTTGGGAGG + Intronic
903549845 1:24150296-24150318 GAGCAGATGCTGGGCGAGGGAGG + Intergenic
903617526 1:24672098-24672120 GAGCAGAATCAAAGTGTGGGAGG - Intronic
904160502 1:28519017-28519039 TAGCAGAAGTTGAGTGTGTGGGG + Intronic
904592440 1:31622492-31622514 GAGCAGATGATGAGTGTTGGTGG - Intronic
904605996 1:31698033-31698055 AAGCTGATGCTGAGTGTGGCTGG - Exonic
904774385 1:32897762-32897784 GAGCAGGAGGTGAGCTTGGGAGG - Intronic
905231690 1:36518484-36518506 GGTCAGAAGCCCAGTGTGGGTGG + Intergenic
905240208 1:36576361-36576383 GAGCAGAACGTGGGTGGGGGTGG + Intergenic
905268645 1:36772115-36772137 GGGCAGATGCTGAGTCTGAGAGG + Intergenic
905391590 1:37639258-37639280 GAGCAGAAGGTTAGAGTGGGGGG - Intergenic
905535782 1:38720715-38720737 GACCAGAAAATGAGTGTGGATGG - Intergenic
906748146 1:48235854-48235876 GAGCAGGAGCTGATGGTGGTGGG + Exonic
907439887 1:54472632-54472654 CAGCAGAAGCTGGCTGTGGCTGG + Intergenic
908896319 1:68904440-68904462 GAGCAGAAAATGTGTGTGGGAGG - Intergenic
910793568 1:91075503-91075525 GAGTGGGAGGTGAGTGTGGGCGG + Intergenic
911007891 1:93246449-93246471 CAGAAGAAGCTAAGTGTTGGAGG + Intronic
912032855 1:105271774-105271796 AAGCAGAAGCAGAGTTTGAGAGG + Intergenic
912550670 1:110483469-110483491 GAGCAGAGGCTGGGGGCGGGTGG - Intergenic
912682480 1:111738400-111738422 GAGAAGTAGCTCAGTCTGGGGGG - Intronic
912750166 1:112280907-112280929 GAGCATAAGCTAAGAGTGTGAGG - Intergenic
912866983 1:113266590-113266612 CAGGAGAAGCTGGGCGTGGGGGG - Intergenic
912955860 1:114153754-114153776 GGGCATGAGCGGAGTGTGGGGGG - Intronic
914356255 1:146887168-146887190 TGGCAGAAGCTCAGTGTAGGGGG - Intergenic
914371323 1:147027153-147027175 GAGCAGGAGCTGAGAGGAGGGGG + Intergenic
915605581 1:156948113-156948135 GAGGAGCAGCTGGGTGTGGATGG + Intronic
915656976 1:157368727-157368749 GAACAGAAGTTGAGTGTGCAAGG + Intergenic
916891727 1:169118353-169118375 GAGCAGATTCTGAGTGTCGGAGG + Intronic
918590607 1:186237016-186237038 GCGAAGAAGCAGAGTGTGTGAGG + Intergenic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
919754108 1:201056009-201056031 CAGCAAAAACTGAGTGTGGATGG + Intronic
920097183 1:203493937-203493959 GAGCAGGAGCTGGAGGTGGGGGG + Intergenic
920310194 1:205044062-205044084 GAGGAGAAGCTAAGGTTGGGAGG - Intronic
921987210 1:221325323-221325345 GACCAGAATCTGACTTTGGGAGG + Intergenic
921989603 1:221350303-221350325 AAGCAGTAGCGGAGTTTGGGAGG + Intergenic
922244577 1:223783115-223783137 GAGTAGAAGCTCCATGTGGGTGG + Intronic
922914162 1:229241788-229241810 GAGCAGGAGGTGGGGGTGGGAGG - Intergenic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
923503462 1:234585539-234585561 GAGCAAAAGCAGAGGGTGGCAGG - Intergenic
923843173 1:237696666-237696688 GAGAAGAAGCAGACTGTGGGAGG - Intronic
923936435 1:238765339-238765361 CAGCAAAAGCTGGGGGTGGGGGG + Intergenic
1062917577 10:1253651-1253673 GAGCAGAAACTGTCTGTGGTTGG + Intronic
1063101618 10:2954814-2954836 GATAAGGAGATGAGTGTGGGTGG - Intergenic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1066497738 10:35958739-35958761 AAACAGAAACTAAGTGTGGGTGG - Intergenic
1066557075 10:36626039-36626061 GAGAAGGAGCTGGGGGTGGGGGG + Intergenic
1067554704 10:47260605-47260627 GGGCAGAAGCTGTGTGGGGTGGG - Intergenic
1067853037 10:49767952-49767974 GAGCAGAAGAGGCCTGTGGGAGG - Intergenic
1068779472 10:60904050-60904072 GAGAATCACCTGAGTGTGGGAGG - Intronic
1069614575 10:69798800-69798822 GAGCAGAAGCTGAGTCTTTGGGG + Intergenic
1069874421 10:71552979-71553001 AAGCTGAAGCTGGGAGTGGGGGG - Intronic
1070335712 10:75453703-75453725 GAGCAGAAGGTGAGAGGGGATGG + Intronic
1070360947 10:75688620-75688642 AAGCAGAAGCAGGGTTTGGGAGG + Intronic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1070987897 10:80703787-80703809 GGTCAGAAGCTGAGTGTGTGTGG - Intergenic
1071341445 10:84652376-84652398 CAGAAGAAGCAGAGTGTGGGAGG - Intergenic
1071996511 10:91154173-91154195 GCTCAGAAGCCGAGTGGGGGTGG + Intergenic
1073098094 10:100992600-100992622 GAGAAGAAGCTGAGGTTGAGTGG + Intronic
1073906595 10:108287731-108287753 AGGAAGAAGCTGAGTGTTGGGGG + Intergenic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074502436 10:114038737-114038759 GAGGAGGAGGTAAGTGTGGGAGG + Intergenic
1075524324 10:123169965-123169987 GAGGATAACCTGAGTGCGGGAGG + Exonic
1075794903 10:125112961-125112983 GAGCAGGAGCTGGCTGTCGGAGG - Intronic
1077458429 11:2694989-2695011 GAGCCAAAGCTCAGTGAGGGAGG + Intronic
1078432341 11:11297766-11297788 GAGGAGGAGCTGAGTGGGCGGGG - Intronic
1078614531 11:12852848-12852870 CAGCAGAGTCTGATTGTGGGCGG + Intronic
1078841556 11:15080318-15080340 GATCAGAGGCTGAGGGTGGAAGG - Intronic
1079312043 11:19375484-19375506 GAGCAAGAGCTGAGTTTGTGGGG - Intronic
1079712723 11:23707408-23707430 TTGCAGATGCTGAGGGTGGGGGG - Intergenic
1080072383 11:28105608-28105630 TACCAGAAGCTGAGTTTTGGGGG - Intronic
1080422865 11:32127025-32127047 GAGCACTGGCTGAGTTTGGGGGG - Intergenic
1080830443 11:35888939-35888961 GAGGGGAAGCTGAGAGTGGATGG - Intergenic
1081023696 11:37981860-37981882 CAGCAGGAGGTGAGCGTGGGTGG + Intergenic
1081716524 11:45254432-45254454 AAGCAGAACCCCAGTGTGGGTGG - Intronic
1082252297 11:49995698-49995720 GAGAATAAGCTCACTGTGGGGGG - Intergenic
1083196604 11:61092160-61092182 GGGGAGGAGCTGAGGGTGGGAGG - Intergenic
1083598994 11:63934639-63934661 GAGAGGGAGCTGAGAGTGGGAGG - Intergenic
1083693556 11:64427081-64427103 GAGAATAACCTGAGTGTGGCAGG + Intergenic
1083876029 11:65524963-65524985 GGGCAGAACCTGAGTTGGGGCGG - Intergenic
1084715360 11:70870165-70870187 CAGCAGAATCTGAGTGCTGGAGG + Intronic
1084872635 11:72108567-72108589 GAGCTGGAGGTGAGGGTGGGGGG - Intronic
1084872939 11:72109932-72109954 GAGAGGAGGCTGGGTGTGGGTGG + Exonic
1086159945 11:83710787-83710809 GAGAAGAAGCTGAGGGCAGGTGG + Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086631336 11:89023305-89023327 GAGCAGAAGAAGAGTGTTTGGGG - Intronic
1088109477 11:106245788-106245810 GAGCAGAAGCAAAATGGGGGAGG - Intergenic
1088355631 11:108941213-108941235 TACCAGGAGCTGAGTCTGGGTGG - Intergenic
1088731568 11:112688500-112688522 GAGCACATGCTGAGAGTGAGTGG + Intergenic
1088772607 11:113050124-113050146 GGGCAGAAACAGAGGGTGGGGGG + Intronic
1089011040 11:115132025-115132047 GAGAAGAAGGTGAGATTGGGTGG - Intergenic
1090168835 11:124580428-124580450 GAACTGAAGCTGATTCTGGGTGG - Intergenic
1090359547 11:126162944-126162966 GAGCAGAATCTGCCTGTGTGAGG - Intergenic
1091295848 11:134473639-134473661 AAGCAGAAGGTGAGGGCGGGGGG - Intergenic
1091567494 12:1659865-1659887 GAGAAGCAGCTGGGTGTAGGCGG - Intergenic
1091804225 12:3344244-3344266 TAGCAAAAGCTGAGGTTGGGAGG + Intergenic
1092526810 12:9314532-9314554 GGGCAAAGGCTGAGTGAGGGAGG + Intergenic
1092540461 12:9417247-9417269 GGGCAAAGGCTGAGTGAGGGAGG - Intergenic
1093670338 12:21866832-21866854 GAACAGAGGTTAAGTGTGGGTGG + Intronic
1096113418 12:49041641-49041663 GTGCAGAAGGTGAGTGGGGCTGG - Exonic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096752355 12:53769139-53769161 AATCAGAAGCAGACTGTGGGGGG - Intergenic
1098080283 12:66777253-66777275 GAGCAGAAGGCCAGTGTGGCTGG - Intronic
1099148711 12:79081041-79081063 GTGCAGAGGCTGAGGGTGGTGGG + Intronic
1099246969 12:80203557-80203579 GAACAGAAGCTGTGAGTGGGAGG + Intergenic
1100393208 12:94162354-94162376 GAGCAGAAGCAGAGTGCAGGAGG + Intronic
1101460776 12:104891000-104891022 GAGTAGATGATGAGTGTGGGAGG - Intronic
1101727036 12:107396265-107396287 GGGCAGAAGCTGTGAGTGGCAGG - Intronic
1103478118 12:121233232-121233254 GAGCAGCTGCTGAGAGTGGCAGG - Intronic
1104356058 12:128088082-128088104 GAGCAGGAGTTGTGAGTGGGAGG - Intergenic
1105652053 13:22389728-22389750 TAGAAGAAGCTGAGTTTGGAAGG - Intergenic
1106404218 13:29459818-29459840 TAGCAGGAGTTGTGTGTGGGTGG - Intronic
1106709032 13:32311579-32311601 GAGCAGCTGCTGAGGGTGCGAGG + Exonic
1106886445 13:34190125-34190147 GAACAGAAGCTGAAACTGGGAGG - Intergenic
1107374009 13:39782647-39782669 GAGCACAAGCTGATTGTGTTTGG + Intronic
1107522841 13:41200714-41200736 GAGCAGTAGCTGGGTGAGGTAGG - Intergenic
1107749259 13:43546644-43546666 AAGCAGAAGCTGGGGGTGTGAGG - Intronic
1107853411 13:44591975-44591997 GAGGGGAAGCTGAGGGTGGCTGG + Intergenic
1108408755 13:50127642-50127664 GCGCAGAAACTGGGTGGGGGCGG + Intronic
1108688514 13:52842066-52842088 AAACAGGAGCTGTGTGTGGGAGG - Intergenic
1114193201 14:20456030-20456052 GAGCAGATCTTGAGTGTGGCAGG - Exonic
1115198075 14:30823252-30823274 CAGCACAAGCTGAGTGTGATTGG - Intergenic
1115308232 14:31953819-31953841 GAGGAGAAGCAGAGAGTTGGGGG - Intergenic
1115786334 14:36829775-36829797 CAGCAGAGGCTGAGTGGTGGTGG + Intronic
1118249805 14:64148537-64148559 GAGGAGAACCTGTGTGTGGATGG - Intronic
1118871389 14:69745773-69745795 GAGCAGTGGCTGGGGGTGGGGGG + Intronic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118994495 14:70823519-70823541 AAGCAGAAGCTGAGACAGGGAGG - Intergenic
1119265555 14:73261661-73261683 TAGCAGGAGCTGAGTGCTGGAGG + Intronic
1119655979 14:76417331-76417353 GAGCAGGAGACCAGTGTGGGTGG + Intronic
1121274712 14:92659593-92659615 GGGGAGGAACTGAGTGTGGGTGG + Intronic
1123685198 15:22792208-22792230 CAGCAGAGGCTGAGTGTGCCTGG + Intronic
1124199148 15:27661816-27661838 GAGGATCAGCTGAGTCTGGGAGG + Intergenic
1125491381 15:40151072-40151094 GAGCATCACCTGAGTTTGGGAGG + Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1126827765 15:52568834-52568856 GAGCAGAAGGTGAGCGCGCGGGG - Exonic
1127284693 15:57522118-57522140 AATCAGAAGTTCAGTGTGGGGGG - Intronic
1127287744 15:57545782-57545804 GAGCAGGAGTGGAGTGTGAGTGG + Intronic
1127382401 15:58441170-58441192 GAGGAAAAGCTGAGTGTTTGCGG - Intronic
1127462343 15:59211046-59211068 AAAAAGAAGCTGAGTGTGGTGGG + Intronic
1127714913 15:61640592-61640614 GAGCAGAGACTGAGTGAGGAAGG + Intergenic
1128554747 15:68623699-68623721 GAGCAGCAGCAGCGGGTGGGAGG + Intronic
1128673763 15:69594271-69594293 GACCAGAAGCTTAGAGTAGGAGG - Intergenic
1129695415 15:77738214-77738236 GGCAAGAAGCTGAGTGAGGGAGG - Intronic
1131250515 15:90827266-90827288 GACCAAAAGCGGGGTGTGGGGGG - Intergenic
1131562246 15:93454884-93454906 TAGCAGATGCTGACTGCGGGTGG + Intergenic
1132311552 15:100861439-100861461 GAGCAGAAGCTGTCTGTGGAGGG - Intergenic
1133026860 16:2992376-2992398 GAGGAGAAGCAGTGTGTGAGGGG - Intergenic
1133452645 16:5916724-5916746 GATAAGCAGCTTAGTGTGGGGGG - Intergenic
1133455990 16:5943011-5943033 GACCACAAGCTCAGTATGGGGGG + Intergenic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1134249593 16:12565178-12565200 TAGCAGAATCTGAAGGTGGGGGG - Intronic
1135996828 16:27256396-27256418 GAGGAGAAGCAGAGTGGGAGTGG - Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136395249 16:29988866-29988888 GAGTGGGAGCTGAGTGTGTGAGG + Intronic
1137566777 16:49538180-49538202 GAGCAGCAGGGGAGTGGGGGTGG + Intronic
1138530366 16:57631351-57631373 GTGCAGAAGCTGTGTGCAGGTGG + Intronic
1139977761 16:70828295-70828317 TGGCAGAAGCTCAGTGTAGGGGG + Exonic
1140343555 16:74189738-74189760 CAGCAGTAGCTGTGTGTGTGTGG - Intergenic
1140853640 16:78957859-78957881 GAGAAGAGGCTGGGCGTGGGGGG + Intronic
1142273464 16:89103338-89103360 GAGCTGATGCTGGGTGTGGTAGG + Intronic
1142291456 16:89195293-89195315 GGGCAGAACCTGAGTGTGGATGG + Exonic
1142303951 16:89275196-89275218 AGGCAAAAGGTGAGTGTGGGGGG + Intronic
1142417409 16:89949945-89949967 GAGCAGAAGCTAAGGCTGCGAGG + Intronic
1144461583 17:15463002-15463024 GAGCAGGAGATGGGGGTGGGAGG + Intronic
1145007714 17:19346842-19346864 GCGCAGAGGCTTAGTGTGGAGGG - Intronic
1145254115 17:21313529-21313551 GAGCTGATGGTGAGTATGGGCGG + Exonic
1146266123 17:31454007-31454029 GAGCAGCAGGTGGCTGTGGGTGG - Intronic
1146428264 17:32764658-32764680 GAGTGGAAGCTGACTGGGGGTGG - Intronic
1146673932 17:34760094-34760116 CAGCAGGAGCTCAGTGTGGCTGG - Intergenic
1146677034 17:34780779-34780801 GATCAGAAGAGGAGGGTGGGAGG + Intergenic
1147317275 17:39626976-39626998 GAGGAGAGGCTGAGGGAGGGAGG + Exonic
1147474757 17:40700165-40700187 GAGCAGAAGCGGCTTGTGTGTGG + Intronic
1147673611 17:42190731-42190753 GACCAGACCCTGAGTGTGCGAGG - Exonic
1148000639 17:44385254-44385276 GAGCAAAAGCGCAGTGGGGGCGG - Intronic
1148075333 17:44932368-44932390 GGGCAGTAGCTGAGGGTAGGAGG + Intronic
1149586083 17:57787972-57787994 CAGCAGAAGCGGAGTGCTGGGGG - Intergenic
1149813489 17:59701099-59701121 GAGCAAAGGATGAGTGTGGATGG - Exonic
1151223955 17:72634788-72634810 GGGAGGAAGCTGGGTGTGGGTGG + Intergenic
1152214435 17:79024332-79024354 GTGCAGAAGAGGAGGGTGGGGGG - Exonic
1152656276 17:81520410-81520432 GAGCCCAAGGTGTGTGTGGGTGG - Intronic
1152702098 17:81824255-81824277 GGGCAGGAGCTGTGTGTGGCAGG + Intronic
1153189564 18:2522545-2522567 GAGCTAAAGCTGAGTAAGGGAGG - Intergenic
1154293614 18:13131345-13131367 GAGCAGAACCAGCGTGTGGTGGG + Intergenic
1155028196 18:21961303-21961325 GAGCAGAGGTTGAGCCTGGGTGG + Intergenic
1155098968 18:22589900-22589922 GAGAAGAAGCTGAGGGTTTGAGG - Intergenic
1155809325 18:30211842-30211864 GAGCATAAGTTGAGCCTGGGAGG - Intergenic
1156622035 18:38864275-38864297 GGGCAGAAGCCTAGTGTGGGGGG + Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157481040 18:48053978-48054000 GCGCAGAGGCTGAGTGAGGATGG + Intronic
1158116618 18:54003389-54003411 AAGCAGAAGTAGAGTGTGTGTGG - Intergenic
1158500195 18:57993977-57993999 GAGCAGAAGATTTGTGTGGGTGG - Intergenic
1159925991 18:74269500-74269522 GAGTAGCTGCTGTGTGTGGGAGG - Intronic
1160481520 18:79245074-79245096 GAGCAGATCCTGACAGTGGGGGG - Intronic
1160975828 19:1791963-1791985 GAGCAGGACCTCAGGGTGGGTGG - Intronic
1161159750 19:2755236-2755258 GACCAGAAAATGAGGGTGGGAGG + Exonic
1161470875 19:4456290-4456312 GAGCAAAGGCTGAGTGAGGGAGG - Intronic
1161526560 19:4759731-4759753 GAGCGGGAGCTGAGGGAGGGAGG + Intergenic
1162089358 19:8268899-8268921 GGGCATCAGCTGAGTGTGGTCGG - Intronic
1162106096 19:8370833-8370855 CAGCAGGGACTGAGTGTGGGAGG - Intronic
1162419794 19:10559599-10559621 AAGAAGAGGGTGAGTGTGGGGGG - Exonic
1162578033 19:11510763-11510785 GACCAGCAGCAGAATGTGGGGGG - Intronic
1162864908 19:13538351-13538373 AAGCAGAAGCTGGGAGGGGGAGG + Intronic
1163549151 19:17955793-17955815 AAGTAGAGGCTGTGTGTGGGGGG - Intronic
1163803726 19:19383977-19383999 AAGCAGCATCTGAGTGTGGGAGG - Intergenic
1163828584 19:19537205-19537227 GGGCAGAGGCTCAGTGTTGGAGG + Intronic
1163955778 19:20638049-20638071 GAGGATAATCTGAGTTTGGGAGG + Intronic
1165831742 19:38733971-38733993 GAGGACAAGCTGAGGCTGGGTGG + Intronic
1166170260 19:41023384-41023406 GAGCAGGAGGTGGGTGAGGGAGG + Intergenic
1166636816 19:44458137-44458159 GAGAAGAAGCTGGGTGAGGCAGG + Intergenic
1166783026 19:45352159-45352181 GAGGAGAAGCTCAGCCTGGGAGG + Intronic
1167263596 19:48472485-48472507 GGGCAGGAGCTGGGTCTGGGGGG - Intronic
1167580230 19:50337009-50337031 GAGGACAAGCTGACTGTGAGTGG - Intronic
1167583797 19:50361655-50361677 GAGGACAAGCTGACTGTGAGTGG - Exonic
1168404122 19:56102037-56102059 GAACAGAAGCTCCCTGTGGGCGG - Intronic
1168720795 19:58554031-58554053 GGCCAGATGGTGAGTGTGGGTGG - Exonic
925011677 2:490166-490188 GAGCTGCAGCTGAGTGTGTACGG + Intergenic
925292345 2:2756154-2756176 AGGCAGAAGCTGAGGGTGGCAGG - Intergenic
926111232 2:10185297-10185319 CAGGAGAGGCTGAGCGTGGGAGG + Intronic
926243109 2:11103207-11103229 GAGCCTATGCTGAGTGTGTGTGG + Intergenic
926877471 2:17497814-17497836 AAGCAGAAGCAGAGTGTTGTAGG - Intergenic
927152569 2:20204298-20204320 GACCAGAAGCAGAGTGTGTTGGG + Intronic
927152583 2:20204339-20204361 GACCAGAAGCAGAGTGTGTTGGG + Intronic
927467948 2:23351061-23351083 GAGCAGAAGATGACTGTGGATGG - Intergenic
927857810 2:26538166-26538188 GAGCAGAAGCCTAGTATAGGGGG + Intronic
928273429 2:29877721-29877743 GAGCAGAGCCAGCGTGTGGGAGG - Intronic
929253063 2:39780175-39780197 GAGCATGAGCTGGGTGGGGGCGG - Intergenic
929783978 2:44975958-44975980 GAGCAGAAGCCGGGGGCGGGAGG + Intergenic
930266344 2:49204177-49204199 GAACAGAAGCTGAGTTTGCATGG + Intergenic
930527355 2:52546195-52546217 GAGAAGGAGATGAGTGTGGCAGG + Intergenic
930650027 2:53955079-53955101 GAGGAGCATCTGAGTCTGGGAGG + Intronic
932175820 2:69600703-69600725 AAGCAGCAGCAGAGTTTGGGAGG + Intronic
932322835 2:70834598-70834620 GAGCAGAATGTGAAAGTGGGTGG - Intronic
932618302 2:73250207-73250229 GAGCAGCTGCTGAGTGTTGGGGG + Intronic
932895810 2:75638271-75638293 GAGCAGAAAATGAGAGTGGGAGG - Intergenic
934504638 2:94880673-94880695 GAGCAGAGGGTGAGTGTACGGGG - Intergenic
934781057 2:96969964-96969986 TTGCAGAAGTTAAGTGTGGGCGG - Intronic
935277612 2:101488755-101488777 TAGGAGAAACTGTGTGTGGGAGG - Intergenic
937911240 2:127076612-127076634 AAGCAGCTGGTGAGTGTGGGTGG - Exonic
939200842 2:139031760-139031782 GTGCAGCAGCTGACTGGGGGAGG + Intergenic
939995576 2:148916111-148916133 ATGCAGGAGCTGACTGTGGGAGG + Intronic
940483292 2:154264027-154264049 GAGATGAAGCTGAGTGTTTGGGG + Intronic
940907104 2:159179468-159179490 CTGCAGAAGCTGGGTGGGGGAGG - Intronic
942303681 2:174586173-174586195 GAGCAGCAGCTGAGGCGGGGTGG + Intronic
942598658 2:177618271-177618293 GAGCAGCTGCTGAGTGGGGAAGG - Exonic
944683308 2:202096424-202096446 GAACTGAGGCTGAGTGTTGGTGG - Intronic
944931348 2:204523148-204523170 TCTCAGAAGCTGGGTGTGGGTGG - Intergenic
946146515 2:217735221-217735243 GAGCAGGAGGTGAGTGGGGGAGG - Intronic
946168394 2:217879097-217879119 GAGCAGACGGTCAGAGTGGGAGG - Intronic
946196576 2:218035779-218035801 GAGCAGATGCTGCGTGTGTGGGG - Intronic
946200858 2:218069945-218069967 GAGCACATGCTGCGTGTGTGTGG - Intronic
946201214 2:218071858-218071880 GAGCAGATGCTGCCTGTGTGTGG - Intronic
946210252 2:218142073-218142095 GAGCTGAAGCTGATTTTGGAGGG + Intergenic
946661989 2:222010989-222011011 GAACAGAAGCTGAGAGGGTGGGG + Intergenic
947572325 2:231245919-231245941 GGGCAGAGGCTTGGTGTGGGTGG - Intronic
948018179 2:234707219-234707241 GACCAGGGGCTGGGTGTGGGTGG - Intergenic
948270849 2:236672101-236672123 GAGCCCATGCTGAGTGTGCGGGG + Intergenic
948893248 2:240917011-240917033 GAGCAGCAGCCCAGTGGGGGAGG - Intergenic
1170064376 20:12294577-12294599 GAGGAGAAGCAGAGAGTGTGGGG + Intergenic
1170924157 20:20707739-20707761 AAGCAGAAGCTGAGGCTGGCTGG - Intronic
1172164947 20:32893378-32893400 GAGCAGAGGCAGGGAGTGGGGGG - Intronic
1172320621 20:33993317-33993339 GAAGAGAAGCTTAGAGTGGGAGG - Intergenic
1172578726 20:36030222-36030244 GTGCAGAAGGAGAGTCTGGGAGG + Intronic
1173317629 20:41959338-41959360 GAGGAGAAGCTAAGTCAGGGAGG + Intergenic
1173588479 20:44204630-44204652 GGGCAGGAGCGGAATGTGGGTGG - Intronic
1174080935 20:47970364-47970386 GATGAGAAGCGGAGTGTGGAAGG - Intergenic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174340537 20:49892453-49892475 GAGGAGAAGCTGAGCCTGGCTGG - Intergenic
1174950306 20:55035236-55035258 AAGCAGAAGGTGATTGTGGAAGG + Intergenic
1175806839 20:61834266-61834288 GAGAGGCAGCTGAGTGAGGGGGG - Intronic
1175926091 20:62472313-62472335 GACCAGGACCTGAGCGTGGGAGG - Intronic
1176301718 21:5101829-5101851 GAGCAGTGGCTGGGTGAGGGTGG - Intergenic
1176950248 21:15036356-15036378 TAGCAGAAACTGAATTTGGGAGG - Intronic
1177039379 21:16088136-16088158 TTGCAGAAGCTGAGGGTAGGTGG - Intergenic
1178213675 21:30568808-30568830 GAGCAGAAGCAGTCTGTGGTTGG - Intergenic
1178726434 21:35056638-35056660 GAGCCCAAGCAGGGTGTGGGGGG - Intronic
1178862064 21:36297851-36297873 GTGCAGAAGCTCATTGTTGGGGG - Intergenic
1179299066 21:40090306-40090328 GAGAAGAAGCTGGGAGGGGGAGG - Intronic
1179855313 21:44160070-44160092 GAGCAGTGGCTGGGTGAGGGTGG + Intergenic
1180077017 21:45468127-45468149 AAGGAGAAACTGAGTCTGGGAGG - Intronic
1181402732 22:22661142-22661164 GAACAGGAGCACAGTGTGGGGGG - Intergenic
1181694521 22:24586189-24586211 GAGCAGGAGCTGGGTGAGGCGGG + Exonic
1182297221 22:29316620-29316642 GAGCAGAGGCGGAGGATGGGGGG - Intronic
1183356370 22:37361978-37362000 AAGGAGTAGCTGCGTGTGGGAGG - Intergenic
1183978933 22:41528452-41528474 AAGGAGAAGGTGGGTGTGGGTGG - Exonic
1184173005 22:42770316-42770338 AAGCAGCAGCTGCGTGGGGGAGG + Intergenic
1184693637 22:46128359-46128381 GACCCAAAGCAGAGTGTGGGAGG + Intergenic
1184797289 22:46739531-46739553 GAGCGGCAGCTGAGGGAGGGAGG - Intergenic
949146102 3:701589-701611 GAGCAGACTCTGGGTGGGGGTGG - Intergenic
949538468 3:5013680-5013702 GAGCAGGAGCTGAGAGTGGGGGG - Intergenic
949934177 3:9103850-9103872 ATCCAGAAGCTGAGTGTGGAAGG - Intronic
950131993 3:10553697-10553719 GAGCAGCAGCTCGGAGTGGGTGG + Intronic
951534411 3:23728259-23728281 GAGGATCACCTGAGTGTGGGAGG + Intergenic
952253288 3:31674645-31674667 GAGCAGAAGCAAGGTGGGGGAGG - Intronic
953847390 3:46438575-46438597 GAGCAGGAACTGTGTGAGGGAGG - Intronic
954642557 3:52110098-52110120 CAGCATAAGTTGAGTGTGTGAGG - Intronic
956750003 3:72337731-72337753 GGACAGGATCTGAGTGTGGGTGG + Intergenic
958019859 3:87981631-87981653 GAAAAGAAGTTGAGTGTGTGGGG - Intergenic
958032066 3:88123455-88123477 GAGTAGACACTAAGTGTGGGAGG + Intronic
958851973 3:99338328-99338350 TACCAGAGGCTGAGGGTGGGAGG - Intergenic
958970473 3:100605522-100605544 GAGCCGGAGCTGAGTGGGGAGGG - Intergenic
961041823 3:123683272-123683294 GAGAGGAAGCTAAGTGGGGGTGG + Intronic
961381243 3:126497791-126497813 GGGCAGAGGCTTGGTGTGGGTGG + Intronic
961454798 3:127018610-127018632 GAGCTGAAGCAGGGTGGGGGCGG - Intronic
961980331 3:131070990-131071012 GAAAAGAAGCTGAATATGGGGGG + Intronic
962920364 3:139944656-139944678 GAGCAAATGCTGAGTGTTGAGGG + Intronic
963389676 3:144644185-144644207 GAGCAGAAGGAGGGTGTGGTAGG + Intergenic
965781366 3:172289465-172289487 GATCAGAAGGGGAGTGTGGTAGG - Intronic
966269802 3:178090939-178090961 GAGCCCAAGCTGACTGGGGGTGG + Intergenic
966677010 3:182600465-182600487 GAGCAGAAGGCCAGTATGGGAGG + Intergenic
968228329 3:196989791-196989813 AGACAGAGGCTGAGTGTGGGTGG + Intronic
968428550 4:538801-538823 GAGCTCAAGGTGTGTGTGGGGGG + Intronic
968936093 4:3611366-3611388 GAGCAGGGGCTGAGTGAGAGAGG - Intergenic
969093972 4:4718446-4718468 CAGCAGATGCTGTGTTTGGGAGG - Intergenic
969660867 4:8526663-8526685 CAGGAAAAGCTGAATGTGGGAGG + Intergenic
969978229 4:11126872-11126894 CAGCAGAAGATGAATGTTGGGGG + Intergenic
970309004 4:14762028-14762050 GAACAGAAGCTGAGGGTAGTGGG + Intergenic
970454776 4:16212286-16212308 GGGCAAAAGCTGATTGTGGCTGG + Intronic
971375348 4:26051561-26051583 GTGCAGCAGCTGAGTGGGGCTGG + Intergenic
971388013 4:26159372-26159394 GAGGAGAAGCTGAGTTGGGGTGG + Intergenic
972337035 4:38116308-38116330 GAGCAGATGCAGAGGCTGGGAGG - Intronic
972978279 4:44663909-44663931 AAGCAGCAGCCCAGTGTGGGAGG - Intronic
974067067 4:57088455-57088477 AAGCAGAAACTGAGAGTGGTAGG - Intronic
976199225 4:82562166-82562188 GGGCAGGAGCCGGGTGTGGGCGG + Exonic
976330998 4:83830981-83831003 CAGCAGAGGCTGAGTCTAGGTGG - Intergenic
978841405 4:113217718-113217740 CAGCAGAAGGTGAGTCGGGGCGG - Intronic
980066247 4:128191876-128191898 ATGAAGAAGCTGAGTCTGGGAGG + Intronic
980862574 4:138517349-138517371 AAGCAGAAGGTAGGTGTGGGTGG - Intergenic
980915839 4:139032558-139032580 GAGCAGAAGCCAAATATGGGTGG + Intronic
981007073 4:139886144-139886166 GAAAAGAAACTGAGTGTGGGAGG + Intronic
982005419 4:151058524-151058546 GAGGATCACCTGAGTGTGGGAGG + Intergenic
982738232 4:159029277-159029299 GAACAGCATCTGATTGTGGGAGG + Intronic
983932133 4:173463817-173463839 GAGAAGGAGCTGAGTGGGTGGGG + Intergenic
983998582 4:174214427-174214449 GAGCCCTAGCTGAGGGTGGGGGG + Intergenic
985045524 4:185936811-185936833 GAGCAGAAGCTGAGTGTGGGAGG - Intronic
985564900 5:610712-610734 GTGCAGAGGATGTGTGTGGGAGG - Intergenic
985879639 5:2628570-2628592 GAGCAGGAGCTGAGTGGGCAGGG - Intergenic
986857987 5:11893702-11893724 GGACAGAAGCGGAGTGTGAGAGG - Intronic
986968413 5:13303179-13303201 GAGCAAAAGCTGACTGTTTGCGG + Intergenic
987410136 5:17606611-17606633 GAGCAAAAGCTGAGTGTATGAGG - Intergenic
987410793 5:17612817-17612839 GAGCAAAAGATGAGTGTATGAGG - Intergenic
987413349 5:17636288-17636310 GAGCAAAAGCTGAGTGTATGAGG - Intergenic
987460822 5:18207624-18207646 GAGGAAAAGCTGAGTGATGGAGG - Intergenic
987954286 5:24717614-24717636 AAGCAGTCTCTGAGTGTGGGAGG + Intergenic
987977676 5:25035742-25035764 GAGGAGATGCTGGGGGTGGGTGG - Intergenic
989056626 5:37371724-37371746 AAGAAGAAGCTGAGTGCAGGTGG + Intergenic
989305176 5:39946877-39946899 AAGGAGAAGCTGAGTTTGAGAGG - Intergenic
990315426 5:54578555-54578577 GAGCAGAAGCTGCCTTTGTGGGG + Intergenic
991958080 5:72015366-72015388 AAGCTGAGGATGAGTGTGGGTGG + Intergenic
997387718 5:133486751-133486773 GAGCAGGAGCTGGCGGTGGGTGG + Intronic
998605125 5:143625677-143625699 GAGCTGACTCTGAATGTGGGCGG - Intergenic
998865377 5:146494838-146494860 GACCAGAAACTGACTGTGGGAGG - Intronic
999666208 5:153916440-153916462 GAGCCGAAACTGATTGAGGGTGG - Intergenic
1000777052 5:165432900-165432922 CACCAGTAGCTAAGTGTGGGAGG + Intergenic
1000948297 5:167449349-167449371 GAGCAGGAGGTGAAGGTGGGTGG + Intronic
1001257411 5:170194527-170194549 GAGCAGAGGCAGAGTCTGGGAGG + Intergenic
1001373943 5:171236568-171236590 GAGGTGAAGCTGAGTGTGTGCGG - Intronic
1001449707 5:171815191-171815213 GAGCTGAGGCTGAGTGTGCAAGG + Intergenic
1001579935 5:172791576-172791598 ATGAAGAAGCTGGGTGTGGGTGG - Intergenic
1003404382 6:5816569-5816591 AGGCAGAGGCTGAGTGTGTGAGG - Intergenic
1004205696 6:13589775-13589797 TAGCAGCAGCAGAGGGTGGGAGG + Intronic
1004931180 6:20464576-20464598 GAGCAGAAGCTGACTGCTGGTGG - Intronic
1005098017 6:22139968-22139990 GAGGATCACCTGAGTGTGGGAGG - Intergenic
1005102792 6:22191389-22191411 GAGGACAAGCTGAGTGAGGCAGG + Intergenic
1005626788 6:27669919-27669941 CAGAAGAAGATGAGTGTGGAAGG - Intergenic
1005905514 6:30259591-30259613 GGGGAGAATCTGAGTGCGGGTGG - Intergenic
1006421303 6:33935768-33935790 GTGCAGTGGCTGAGGGTGGGTGG - Intergenic
1006456850 6:34136916-34136938 GAGCAGAGGCAGGGTGTGGTGGG + Intronic
1006460598 6:34155391-34155413 CAGGAGATGCTGAGAGTGGGAGG - Intronic
1006829137 6:36958335-36958357 GAGGACAGGCCGAGTGTGGGTGG - Intronic
1007237995 6:40404960-40404982 GGGCACAGGCTGAGTATGGGAGG - Intronic
1008085151 6:47236597-47236619 AAGCAGCAGCAGGGTGTGGGTGG - Intronic
1008448563 6:51622150-51622172 AAGCTGTAGCTGACTGTGGGTGG - Intronic
1009833903 6:68972473-68972495 GAGGAGAAACTGAGTGCAGGAGG - Intronic
1010653704 6:78486244-78486266 TAGCAGAAGCTGAGAGGTGGTGG - Intergenic
1011018310 6:82782847-82782869 GAGAAGGATGTGAGTGTGGGGGG + Intergenic
1011108807 6:83813579-83813601 TAGGAGAACCTGAGTCTGGGAGG + Intergenic
1011547846 6:88500418-88500440 GAGCAGAACCTGTGTGAAGGAGG + Intergenic
1015137501 6:129890484-129890506 GAGAAGAAGCTCAGTTTGGGTGG + Intergenic
1015570407 6:134615234-134615256 GAGCATAATCTGAGGGTTGGGGG + Intergenic
1016293115 6:142545210-142545232 GAGCAGAGGATGATTGTGAGTGG - Intergenic
1016387624 6:143543752-143543774 GGGCAGAGACTGAGTATGGGAGG + Intronic
1016524886 6:144990455-144990477 GTGGAGAAGCTGGGTGTAGGAGG + Intergenic
1017282170 6:152636989-152637011 GAGCAGTAGATGCGTGGGGGAGG - Intronic
1018129689 6:160717195-160717217 GAGCAGAGGGTGAGTGGTGGGGG + Intronic
1018298682 6:162376951-162376973 GAGGAGAAGCCCAGTCTGGGAGG + Intronic
1018614996 6:165678693-165678715 AGGGAGATGCTGAGTGTGGGCGG - Intronic
1018691167 6:166345304-166345326 GGGAAAAAGCTGAGTGTTGGGGG - Intergenic
1019144029 6:169965384-169965406 GTGCAGATGCTGAGCATGGGCGG + Intergenic
1019504099 7:1382008-1382030 AAGCAGAAGCTGGAAGTGGGGGG - Intergenic
1019696393 7:2448582-2448604 GGGAAGAAGCTGAGGGTGGGTGG - Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020976764 7:15015972-15015994 GTGCTGAAACTGAGTGTGCGAGG + Intergenic
1021528102 7:21611274-21611296 AACCAGATGCTGAGGGTGGGAGG - Intronic
1022015586 7:26346078-26346100 GAGCAGAAGCCATGTGCGGGGGG - Intronic
1022334108 7:29406539-29406561 GAGGGGAGGCTGAGTGTGGCAGG - Intronic
1022657529 7:32333654-32333676 GAGCAGAAACTGAGTCAAGGAGG - Intergenic
1024128109 7:46321623-46321645 GAGGAGCACCAGAGTGTGGGAGG + Intergenic
1024230794 7:47361752-47361774 GAGCAGATGCCGAGTCTGGGAGG + Intronic
1024596410 7:50941237-50941259 GAGGAGAGGCTGAGTCTTGGGGG + Intergenic
1024977331 7:55125958-55125980 GAGATGAAGCTGAGAGTGTGAGG - Intronic
1025603281 7:63019377-63019399 GAGTAGAGGCTGGGTGTGGCGGG - Intergenic
1025794999 7:64731347-64731369 TAACAGAGGCTGAGTGTGGTGGG - Intergenic
1027218999 7:76202165-76202187 GAGCAGAGGGGCAGTGTGGGAGG + Intronic
1028332085 7:89607347-89607369 GAGATGATGCTGAGTGTGGAAGG - Intergenic
1029051184 7:97689481-97689503 GAGGATAAGCTGAGCCTGGGAGG + Intergenic
1029124636 7:98287741-98287763 GAGCAGCAGCTGCAGGTGGGAGG + Intronic
1029151921 7:98486322-98486344 GAGGTGAAGCTGGGTGAGGGGGG - Intergenic
1029318905 7:99739753-99739775 GAGTAAAAGCTGAGTGTGAGTGG - Intergenic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1029986423 7:104927266-104927288 GAGCAGGAGCGGGCTGTGGGCGG + Intergenic
1030313578 7:108092007-108092029 GAGCAGAACCTGGCAGTGGGGGG - Intronic
1030756472 7:113292445-113292467 CAGCACAAGCTGAGTGTAGCTGG + Intergenic
1031287257 7:119885839-119885861 GTGGAGAATCTGTGTGTGGGGGG + Intergenic
1032405731 7:131653935-131653957 GAGCAGTTGCTGCGTGTGTGGGG + Intergenic
1032427590 7:131833946-131833968 GAGCAGAAGCCGACTGTGGAAGG + Intergenic
1032599642 7:133279606-133279628 GAGGATCACCTGAGTGTGGGAGG - Intronic
1035472216 7:159117694-159117716 GAGTGGCAGCTGAGGGTGGGTGG + Intronic
1035536231 8:393373-393395 GACCAGCGGCTGACTGTGGGTGG + Intergenic
1035644750 8:1210445-1210467 GAGCAGCAGGAGTGTGTGGGGGG + Intergenic
1035661370 8:1351055-1351077 GTGCAGATCCTGAGTGTGTGTGG + Intergenic
1035661379 8:1351115-1351137 GTGCAGATCCTGAGTGTGTGTGG + Intergenic
1035661388 8:1351175-1351197 GTGCAGATCCTGAGTGTGTGTGG + Intergenic
1035670633 8:1414506-1414528 GAGCAGAAGCGGAAGGTGGCGGG + Intergenic
1035736063 8:1888415-1888437 GAGGAGACACTGAGTGTGGAGGG + Intronic
1035736338 8:1889941-1889963 GAGGAGACACTGAGTGGGGGAGG + Intronic
1036284505 8:7431954-7431976 GGGAAGGAGGTGAGTGTGGGTGG + Intergenic
1036336971 8:7879576-7879598 GGGAAGGAGGTGAGTGTGGGTGG - Intergenic
1036386760 8:8288498-8288520 GAGCAGAGGCTGTGTGCGGCAGG + Intergenic
1036599769 8:10249622-10249644 GTGCAGAAGCTGGTGGTGGGTGG - Intronic
1036727685 8:11234067-11234089 GAGCTTAGGCTGAGTGAGGGTGG - Intergenic
1036781962 8:11655469-11655491 GAGTAGAGGCTGGGTGTGGTGGG + Intergenic
1037192771 8:16147383-16147405 GAGAAGAAAAGGAGTGTGGGAGG + Intronic
1037603369 8:20417599-20417621 GAGCAGCAGCTGTGTCTGGCAGG + Intergenic
1038283771 8:26189244-26189266 GAGCAGATGCTCAGTATGTGAGG + Intergenic
1038718452 8:30012293-30012315 GAGCAGCTGCAGAGTGGGGGTGG - Intergenic
1039902285 8:41761842-41761864 GGGCAGCACCTGAGTGTGGAGGG - Intronic
1039983983 8:42432508-42432530 GAGCAGAGGCTGGGTGTGAGGGG + Intronic
1040453582 8:47573595-47573617 GAGGAGAAGCAAAGTCTGGGAGG + Intronic
1040462417 8:47661662-47661684 GAGCAGACGCTCACTGTGTGTGG - Intronic
1040856570 8:51954514-51954536 GAGCTGAAGCTGAGTGTCTGTGG + Intergenic
1042960114 8:74294239-74294261 GAGCAGGAGCTGAGGGCAGGTGG - Intronic
1043769966 8:84184964-84184986 GAGCAGGAGTTGAGCGTGCGAGG - Exonic
1043877335 8:85500680-85500702 GATCAGAAGCTGTGTCTGGTCGG + Intergenic
1046294984 8:112206252-112206274 TACCAGAAGCTGGGTGTGGAAGG + Intergenic
1047587538 8:126289936-126289958 GAGGAGTGGCTGAGTGTGGAAGG - Intergenic
1047754780 8:127910018-127910040 GGGCAGAGGCTGGGTGTGTGGGG + Intergenic
1047774444 8:128057954-128057976 GATCAAAAGCTGATTGTGTGAGG + Intergenic
1048317697 8:133374527-133374549 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048317703 8:133374578-133374600 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048728034 8:137408898-137408920 GAATAAAAGCTGAGGGTGGGAGG - Intergenic
1048795569 8:138146233-138146255 AACCAGACTCTGAGTGTGGGGGG - Intronic
1048847335 8:138613680-138613702 GAAAAGAATCTGAGTGTTGGGGG + Intronic
1049452895 8:142671871-142671893 GAGAAGAACCAGAGGGTGGGAGG - Intronic
1049689506 8:143952559-143952581 GTGCAGGAGGTCAGTGTGGGGGG - Intronic
1049939648 9:533120-533142 GAGGCAAAGCTGAGTGTGTGAGG + Intronic
1050331997 9:4555086-4555108 ATGGAGAAGCTGAGTCTGGGAGG + Intronic
1054454195 9:65421075-65421097 GAGCAGGGGCTGAGTGAGAGAGG + Intergenic
1055592293 9:77829687-77829709 ATGCAGAAGCTGCTTGTGGGTGG - Intronic
1056759334 9:89404266-89404288 GAGCAGACGCTCAGTGGGGCGGG + Intronic
1056770815 9:89476804-89476826 GAGCAGAACCTGACTGCGGAAGG + Intronic
1057082500 9:92183550-92183572 GAGGAGATGCTGTGTGGGGGGGG - Intergenic
1057598052 9:96433423-96433445 GGTCAGAAGCTGGGTGTGGTGGG + Intergenic
1058138493 9:101334071-101334093 GAGCAAAAGCTGAGTGATGATGG - Intergenic
1058190422 9:101907866-101907888 AAGTACAAGATGAGTGTGGGAGG + Intergenic
1058300353 9:103363907-103363929 GAGCAGAAGGTAAATCTGGGAGG - Intergenic
1059426414 9:114223463-114223485 GAGCAGAACCTGGGTGGGGTGGG + Intronic
1059695542 9:116726907-116726929 GAGCTAAAACTTAGTGTGGGTGG - Intronic
1059741498 9:117155030-117155052 GAGCAAAAGAAGAGTGTGGAGGG + Intronic
1060112013 9:120913314-120913336 GAGCAGAGGGTGAGTGTGGGAGG - Exonic
1060297890 9:122355508-122355530 GAGGAGAAGCTGGGAGTGGGTGG - Intergenic
1060548547 9:124474740-124474762 GACCAGGAGCTGTGGGTGGGGGG - Intronic
1060928626 9:127473689-127473711 GAGCAGTGGCTGAGTCAGGGTGG + Intronic
1060975528 9:127762709-127762731 GGGCAGAAGCTGACTGTGGGTGG - Intronic
1061381866 9:130263744-130263766 GAGCAGCAGCGGGGGGTGGGGGG - Intergenic
1061785766 9:133027310-133027332 GAGGAGGGGCTGAGTGTGAGGGG - Intergenic
1061909565 9:133715574-133715596 GAGCAGATGCTGAGCGTGCCAGG + Intronic
1062240400 9:135534542-135534564 GAGCAGGAGGAGAGTGCGGGCGG - Intergenic
1062421830 9:136486332-136486354 GAGCAGAAGCTCACAGTGAGGGG - Intergenic
1185432872 X:19663-19685 GCGCAGAACCTGCGAGTGGGCGG - Intergenic
1185440933 X:227367-227389 GCGCAGAACCTGCGAGTGGGCGG - Intergenic
1185442224 X:232485-232507 GCGCAGAACCTGCGAGTGGGCGG - Intergenic
1186203314 X:7176028-7176050 GCACAGAAGCTGAGGGTGAGTGG - Intergenic
1186884099 X:13895420-13895442 GACCAAAAGCTGGGGGTGGGGGG + Intronic
1187429671 X:19210772-19210794 GCGCAGAACCTGAATGTGGAAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189072551 X:37879582-37879604 GAGCAGCAGCAGAGTTTGAGAGG + Intronic
1190256657 X:48768053-48768075 GAGAAGCACCTGAGTCTGGGAGG - Intronic
1190712608 X:53081399-53081421 GGGCAGAAGCGGAGGGCGGGAGG + Intergenic
1190890612 X:54564064-54564086 TAGCAGAATCTGAGGGTCGGGGG - Intergenic
1191947209 X:66547872-66547894 GAGCAGAAGCTCTGTGAGGAGGG + Intergenic
1192668488 X:73113533-73113555 AAGCAGCAGCAGAGTTTGGGAGG - Intergenic
1193063490 X:77232658-77232680 GAGCATCAGCTGAGTTTGGTCGG - Intergenic
1194737214 X:97526803-97526825 AAGCAGAAGCAGAGTGGGTGTGG - Intronic
1196466931 X:115982429-115982451 GAGGAGAAGCTAACTTTGGGAGG + Intergenic
1197008323 X:121530945-121530967 GAGCAGAAGGTTGGAGTGGGGGG + Intergenic
1198683369 X:139204422-139204444 GGGCAGAAGCTGAGGGCGCGGGG - Intronic
1198874284 X:141206108-141206130 TAGGAGAAACTGTGTGTGGGAGG + Intergenic
1199397685 X:147358823-147358845 GAGGAGAAGATGAGTGTGTTTGG - Intergenic
1199881286 X:151975452-151975474 CCCCAGAAGCTGAGTGTGAGAGG + Intergenic
1199903070 X:152196571-152196593 GAGCAGAAGCTGTATGAGAGTGG - Intronic
1200041409 X:153373016-153373038 GAACAGCAGCTCAGTCTGGGAGG + Intergenic
1200149865 X:153946104-153946126 GAGCCGAGGCCGAGGGTGGGTGG - Intergenic
1201512215 Y:14777610-14777632 GAGGAGAGGGTGAGTGTGAGGGG + Intronic